Every object that biology studies is a system of systems (1974) Francois Jacob (1965 Nobel Prize in Medicine)
|
|
- Buck Lucas
- 5 years ago
- Views:
Transcription
1
2 Every object that biology studies is a system of systems (1974) Francois Jacob (1965 Nobel Prize in Medicine) 2
3 Reductionism vs Holism (Aristotle, 1946) The whole is something over and above its parts and not just the sum of them all 3
4 Life s Complexity Pyramid Information storage, processing, and execution lie in different levels of organizations 4
5 High-throughput Data 5
6 Systems Medicine A systems approach to health and disease (Hood) A disease is rarely the outcome from one single gene or its product with genetic abnormality, but a cohort of genes/proteins that involve in a complex network Paul O Shea: Future medicine shaped by an interdisciplinary new biology 6
7 A Simple Example Mutation leading to the gene regulatory network malfunctioning (Current Opinion in Biotechnology, 2010, 21: ) 7
8 Systems Medicine Proactive P4 (predictive/preventive/personalized/participatory) medicine: L. Hood and M. Flores, 2012 Provide deep insights into disease mechanisms Make it possible for viewing health and disease for the individual Stratify complex diseases into their distinct subtypes for a match against proper drugs Provide new approaches to drug discovery Generate metrics for assessing wellness 8
9 Outlines Network Constructions Networks and Human Diseases Network properties & diseases Prediction of disease genes Other applications Opportunities and Challenges 9
10 Network Constructions 10
11 Simplified Biological Systems Abstract representations of biological systems Nodes: RNA, gene, proteins, metabolites etc Edges: physical, biochemical and functional interactions Alon, Science 301,
12 Network Types Gene Regulatory Networks Protein-protein Interaction Networks Metabolic Networks Transcriptional Profiling Networks Phenotypic Profiling Networks Others 12
13 Network Constructions High-throughput Experiments Large scale versus accuracy Manual Curation Existing information from literatures Quality of the published data and quantity Computational Methods Large scale, take advantage of the existing knowledge Capable of dealing with noises 13
14 Examples Networks in Cellular Systems Vidal, Cusick, and Barabasi, Cell 144,
15 Gene Regulatory Networks Nodes: TF or DNA regulatory elements Edges: physical (functional) binding (directional) 15
16 Modeling GRN Biological Knowledge 16
17 Modeling GRNs Hypothesis-driven approaches assume the network structure is known (e.g., biochemically driven models, neural network models) Clustering assumes co-expression is caused by coregulation; Hierarchical, k-means, biclustering etc Ordinary differential equations Boolean networks Bayesian networks 17
18 Bayesian Networks Data are noisy The behavior of GRNs at the single-cell level is fundamentally stochastic (e.g., Computational Modeling of GRNs by Hamid Bolouri) Optical readout noise ODE and Boolean Networks inherently deterministic The sound probabilistic semantics allows BNs to deal with the noises BNs can handle missing data and permit the incomplete knowledge about the biological system BNs are capable of integrating the prior biological knowledge into the system 18
19 Challenges High dimensionality Genome-wide structure learning task is NP-hard Need dimensionality reduction Small sample size Several tens to hundreds (typically < 200) Model overfiting Our solution HMM-based model for dimensionality reduction Integration of constraint-based and scoring-based structure learning methods for network reconstruction 19
20 Computational System Dimensionality reduction followed by structure learning 20
21 Constructing an Undirected Network Integration of mutual information and graph theory for complete connectivity (e.g., path matrix based approach) 21
22 Refine the Network Using the d-separation and the Markov independence criterion to evaluate the edges (remove and add edges). For example, C P(A C) P(A B,C) T estafterdeleting A B P(A B) P(A C, B) T estafterdeleting A C A B P(B A) P(B C, A) T estafterdeleting B C A C B D If the conditional independence test fails for all the deletions, it could be that the triangle loop is authentic, or other paths exist from one node to another. For example, consider a true sub-network. Assume that in the UDS, a triangle loop A B C is identified; while in a true network, the edge between C and B (dashed line) does not exist, and another node D is involved in this network. 22
23 Direction Assignment Using graph theory, d-separation, and maximizing BIC score (exhaustive methods on sub-networks, e.g., find loops with four or five nodes), coming edges etc. C A B Computational complexity: O(n^4) + O(mn^2), m: # samples, n: # of nodes 23
24 Structure Learning X. Chen, et al., Improving Bayesian Network Structure Learning with Mutual Information-based Node Ordering in the K2 Algorithm, IEEE Transactions on Knowledge and Data Engineering, vol. 20(5): , X. Chen, et al., An effective structure learning method for constructing gene networks, Bioinformatics, 22(11): ,
25 Experimental Results POL 30 BN built with our algorithm for yeast cell cycle-related genes. A total of 20 nodes (genes) and 34 edges (interactions) were incorporated. This network captured 65% of all currently reported direct and indirect interactions among these genes. CDC 45 RFA 3 MS H6 MS H2 HPR 5 PRI1 POL 2 POL 1 PDS 1 RAD 53 ASF 1 MCD 1 PRI2 RAD 54 POL 12 DPB 2 CLB 5 PMS 1 25 CLB 6
26 Protein-protein Interaction Networks Nodes: proteins Edges: physical interaction, complexes 26
27 Model Organisms Jeong, Mason, Barabasi, and Oltvai - Nature, 411, 3 May, Rual et al., Nature, 437(20), Oct. 2005
28 In Silico Methods Sequence based methods Rosetta Stone Method Co-evolution Method Physicochemical Properties Method Domain based methods Association Method MLE Method Random Forest Method Integrative methods Decision Tree Logistic Regression Bayesian Network 28
29 Domain-based Approaches p 1 d 1 d 2 d 3 d 5 p 2 d 4 d 5 d 5 d 3 d 2 d 4 p 4 p 3 Protein-protein interactions d 2 Domain-domain interaction 29
30 RFD Methods X. Chen and M. Liu, Prediction of Protein-protein Interactions Using Random Decision Forest Framework, Bioinformatics, 21(24): ,
31 Extended Method X. Chen, M. Liu, and R. Ward, Protein Function Assignment through Mining Cross-Species Protein-protein Interactions, PLoS ONE, 3(2): e1562, 2008 X. Chen and J. Jeong, Sequencebased Prediction of Protein Interaction sites with an Integrative Method, Bioinformatics, 25(5): , 2009 M. Liu, X. Chen and R. Jothi, Knowledge-Guided Inference of Domain-Domain Interactions from Incomplete Protein-Protein Interaction Networks, Bioinformatics, 25(19): ,
32 KUPS Structure of KUPS Workflow diagram 32 URL:
33 KUPS X. Chen, J. Jeong, and P. Dermyer, KUPS: Constructing datasets of interacting and non-interacting protein pairs with associated attributes, Nucleic Acids Research, 2011, Jan; 39:D750-4 Purpose Services Providing high-quality interacting protein pairs (IPPs) and noninteracting pairs (NIPs) for researchers IPPs from three manually curated PPI databases (i.e. IntAct, MINT and HPRD) NIPs calculated with four different methods Test set collections Benchmark datasets 33
34 Metabolic Networks Nodes: metabolites Edges: biochemical reactions (or enzyme that catalyzes) Construction: manual curation + computational assist KEGG 34
35 Genotypic Profiling Networks Indirect interactions (functional links): protein (genes) who function together share similar expressions Genes versus microarray, DNA chip, de novo RNA sequencing etc. Correlation + threshold, e.g., Pearson correlation coeff Stuart et al. Science 302, 2003 Gunsale et al. Nature 436,
36 Some Other Methods Clustering algorithms Signature Algorithm (Ihmels, Bergman, et al. 2002, Nature Genet; 2003, Bioinformatice) Supervised Neural Networks (Alvaro et al., PNAS, 2002) Gene Recommender (Owen et al., Genome Research, 2003) Bayesian Network Biclustering (Dhollander et al., Bioinformatics, 2007) Other bi-clustering algorithms Not considering time sequence 36
37 Dimensionality Reduction rand HMM Σ FFR seed HMM p-val Iterations? 37 37
38 HMM-based Approach A. Senf and X. Chen, Identification of Genes Involved in the Same Pathway Using a Hidden Markov Model-based Approach, Bioinformatics, 25(22): ,
39 Synthetic Data According to Signature Algorithm Literature Initial matrix contains all-zeros Add a module by adding ones to the matrix Randomly scale all genes and conditions Add noise Using a trained Hidden Markov Model Initial matrix contains all-zeros Add module by generating observation sequences using a previously trained HMM Add random values at remaining matrix positions Add noise 39
40 Signature Algorithm Data Set 2600 genes, 100 experimental conditions Embedded modules: 250 genes, 40 conditions Low amount of noise High amount of noise 40
41 HMM Data Sets 500 genes, 100 experimental conditions Embedded module: 125 genes, 40 conditions Low amount of noise 41 High amount of noise
42 Cell Cycle Pathway Found new genes functionally related to input genes Same functional annotations overrepresented as in input gene group 42
43 Phenotypic Profiling Networks Nodes: genes Edges: correlated phenotypic profiles (e.g., RNA interference (RNAi), gene knock-out) Giaever et al., 2002, yeast Mohr et al., 2010, c. elegans, human etc. PPNs confer PPIs (evidence in c. elegans DNA damage response etc.) 43
44 Network Integration Overlap all the networks constructed (Gunsalus et al.,nature 2005; Vidal et al., Cell 2011) 44
45 Network Properties & Diseases 45
46 Network Properties The structure and evolution of networks (social, food, biological etc.) share some common principles: Scale free Hubs Essential genes (Jeong et al. 2001) Evolved more slowly (Fraser et al., 2002) Cancer proteins tend to have more interacting partners than non-cancer proteins Motifs Subgraphs (patterns), more frequent than expected Tied to some biological functions 46
47 Disease Networks Diseases are not independent from each other They may be triggered by different perturbations of some highly connected biological networks Nodes: diseases; edges: how the two diseases are linked Constructing a bipartite network Goh et al, 2007: OMIM genes, two diseases share the same disease genes whose mutations are the cause Rzhetsky et al. 2007; Hidalgu et al., 2009: by data mining individuals who were diagnosed for disease A often for disease B as well - comorbidity (e.g., diabetes and obesity) 47
48 Disease Networks Integrative analysis of cellular networks and disease networks (e.g., the molecular defects for diseases A and B in disease networks how will it affect other genes or other diseases? 48 Barabasi et al., Nature 2011 (12)
49 Prediction of disease genes 49
50 Network-based Applications The human interactome network is predictive (Lim et al., Lee et al., 2010) Linkage methods direct interaction partners Disease module-based methods genes in the same topological, functional or disease modules (integrative analysis of both cellular and disease networks) Diffuse-based methods seed genes randomly walk along an identified pathways (closely related to the see genes) 50
51 Disease Modules Nature reviews, vol. 12,
52 Our Recent Work Based on an integrative model OMIM Gene Network Red circle: mitochondrial deficiency related diseases Yellow circle: protocadherin beta related diseases 52
53 Our Recent Work Newly discovered disease genes 53
54 SNPs-disease Associations Epistasis: interactive effect between two or more genetic variants The primary reason for variation in common (or complex) human diseases Detection of epistatic interactions can help to improve pathogenesis, prevention, diagnosis and treatment of complex diseases Challenges of epistatic interaction detection Large size of genotyped data (10 million SNPs) Enormous number of all possible combinations of genetic factors 54
55 General Methods Statistical methods Only can be applied to small-scale analysis due to their computational complexity Machine learning-based methods Might identify a SNP set that produces the highest classification accuracy, but not necessarily has the strongest association with the diseases lack the ability to detect the causal elements Tend to introduce many false positives How many SNPs??? 55
56 POWER POWER POWER POWER BN-based Approaches A new scoring method and search algorithm Age-related Macular Degeneration (AMD) dataset Contains 116,204 SNPs genotyped with 96 cases and 50 controls. Three associated SNPs were found: Rs Found with a significant association with AMD BN-BnB DASSO-MB BEAM SVM MDR Model1 (=0.3 r 2 =1) MAF Model3 (=0.6 r 2 =1) BN-BnB DASSO-MB BEAM SVM MDR MAF BN-BnB DASSO-MB BEAM SVM MDR Model2 (=0.3 r 2 =1) MAF BN-BnB DASSO-MB BEAM SVM MDR Model4 (=7 r 2 =1) MAF 56
57 Other Applications Network Pharmacology systems level method for drug design: reduce the search for therapeutic agents; identify potential side effects; multi-target drug strategy an essential part for drug development Network Perturbation Disease Classification Personalized Medicine Reformed healthcare (predictive/preventive) 57
58 Opportunities and Challenges Big picture: personalized medicine/healthcare, preventative medicine Whole genome information available Data Sources: large scale + heterogeneous (BIG Data) still need creative algorithms and systematic approached for data analysis (genome wide etc.) Perturbation and time series analyses Integration: a (weighted) complete, reliable human interactome Current Opinion Pharmacology, 2012, 12:1-6 58
59 Thank You 59
Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger
Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Biological networks Ulf Leser: Introduction
More informationProtein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger
Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Protein-protein interaction networks Ulf
More informationProtein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger
Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger SHK Stelle frei Ab 1.9.2015, 2 Jahre, 41h/Monat Verbundprojekt MaptTorNet: Pankreatische endokrine Tumore Insb. statistische Aufbereitung und
More informationData Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationThe application of hidden markov model in building genetic regulatory network
J. Biomedical Science and Engineering, 2010, 3, 633-637 doi:10.4236/bise.2010.36086 Published Online June 2010 (http://www.scirp.org/ournal/bise/). The application of hidden markov model in building genetic
More informationThe Interaction-Interaction Model for Disease Protein Discovery
The Interaction-Interaction Model for Disease Protein Discovery Ken Cheng December 10, 2017 Abstract Network medicine, the field of using biological networks to develop insight into disease and medicine,
More informationECS 234: Genomic Data Integration ECS 234
: Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG
More informationBIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis
BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology
More informationMachine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University
Machine learning applications in genomics: practical issues & challenges Yuzhen Ye School of Informatics and Computing, Indiana University Reference Machine learning applications in genetics and genomics
More informationNetwork System Inference
Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What
More informationAlexander Statnikov, Ph.D.
Alexander Statnikov, Ph.D. Director, Computational Causal Discovery Laboratory Benchmarking Director, Best Practices Integrative Informatics Consultation Service Assistant Professor, Department of Medicine,
More informationVALLIAMMAI ENGINEERING COLLEGE
VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year 2018-19 Prepared
More informationComputational Genomics. Reconstructing signaling and dynamic regulatory networks
02-710 Computational Genomics Reconstructing signaling and dynamic regulatory networks Input Output Hidden Markov Model Input (Static transcription factorgene interactions) Bengio and Frasconi, NIPS 1995
More informationBIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics
More informationCS 5984: Topics and Schedule
CS 5984: and Schedule T. M. Murali January 19, 2006 T. M. Murali January 19, 2006 CS 5984: and Schedule Continuum of Models in Systems Biology From Building with a scaffold: emerging strategies for high-
More informationadvanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA
advanced analysis of gene expression microarray data aidong zhang State University of New York at Buffalo, USA World Scientific NEW JERSEY LONDON SINGAPORE BEIJING SHANGHAI HONG KONG TAIPEI CHENNAI Contents
More informationEra with Computational Biology/Toxicology
USM Seminar 1/22/2010 Embracing the Post-Omics Era with Computational Biology/Toxicology Ping Gong Environmental Genomics and Genetics (EGG) Team @ Environmental Laboratory Outline Introduction Bioinformatics
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationIdentifying Signaling Pathways. BMI/CS 776 Spring 2016 Anthony Gitter
Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu Goals for lecture Challenges of integrating high-throughput assays Connecting relevant
More informationMicroarrays & Gene Expression Analysis
Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed
More informationBioinformatics : Gene Expression Data Analysis
05.12.03 Bioinformatics : Gene Expression Data Analysis Aidong Zhang Professor Computer Science and Engineering What is Bioinformatics Broad Definition The study of how information technologies are used
More informationV 1 Introduction! Fri, Oct 24, 2014! Bioinformatics 3 Volkhard Helms!
V 1 Introduction! Fri, Oct 24, 2014! Bioinformatics 3 Volkhard Helms! How Does a Cell Work?! A cell is a crowded environment! => many different proteins,! metabolites, compartments,! On a microscopic level!
More informationROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE
CHAPTER1 ROAD TO STATISTICAL BIOINFORMATICS Jae K. Lee Department of Public Health Science, University of Virginia, Charlottesville, Virginia, USA There has been a great explosion of biological data and
More informationSurvival Outcome Prediction for Cancer Patients based on Gene Interaction Network Analysis and Expression Profile Classification
Survival Outcome Prediction for Cancer Patients based on Gene Interaction Network Analysis and Expression Profile Classification Final Project Report Alexander Herrmann Advised by Dr. Andrew Gentles December
More informationMethods and tools for exploring functional genomics data
Methods and tools for exploring functional genomics data William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington Outline Searching for
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationRandom matrix analysis for gene co-expression experiments in cancer cells
Random matrix analysis for gene co-expression experiments in cancer cells OIST-iTHES-CTSR 2016 July 9 th, 2016 Ayumi KIKKAWA (MTPU, OIST) Introduction : What is co-expression of genes? There are 20~30k
More informationUncovering differentially expressed pathways with protein interaction and gene expression data
The Second International Symposium on Optimization and Systems Biology (OSB 08) Lijiang, China, October 31 November 3, 2008 Copyright 2008 ORSC & APORC, pp. 74 82 Uncovering differentially expressed pathways
More informationDNA Based Disease Prediction using pathway Analysis
2017 IEEE 7th International Advance Computing Conference DNA Based Disease Prediction using pathway Analysis Syeeda Farah Dr.Asha T Cauvery B and Sushma M S Department of Computer Science and Shivanand
More informationPéter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS
Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS The Bioinformatics book covers new topics in the rapidly
More informationAccuracy of the Bayesian Network Algorithms for Inferring Gene Regulatory Networks
HELSINKI UNIVERSITY OF TECHNOLOGY Engineering Physics and Mathematics Systems Analysis Laboratory Mat-2.108 Independent research projects in applied mathematics Accuracy of the Bayesian Network Algorithms
More informationMFMS: Maximal Frequent Module Set mining from multiple human gene expression datasets
MFMS: Maximal Frequent Module Set mining from multiple human gene expression datasets Saeed Salem North Dakota State University Cagri Ozcaglar Amazon 8/11/2013 Introduction Gene expression analysis Use
More informationFinding Compensatory Pathways in Yeast Genome
Finding Compensatory Pathways in Yeast Genome Olga Ohrimenko Abstract Pathways of genes found in protein interaction networks are used to establish a functional linkage between genes. A challenging problem
More informationBayesian Variable Selection and Data Integration for Biological Regulatory Networks
Bayesian Variable Selection and Data Integration for Biological Regulatory Networks Shane T. Jensen Department of Statistics The Wharton School, University of Pennsylvania stjensen@wharton.upenn.edu Gary
More informationFrom genome-wide association studies to disease relationships. Liqing Zhang Department of Computer Science Virginia Tech
From genome-wide association studies to disease relationships Liqing Zhang Department of Computer Science Virginia Tech Types of variation in the human genome ( polymorphisms SNPs (single nucleotide Insertions
More information2. Materials and Methods
Identification of cancer-relevant Variations in a Novel Human Genome Sequence Robert Bruggner, Amir Ghazvinian 1, & Lekan Wang 1 CS229 Final Report, Fall 2009 1. Introduction Cancer affects people of all
More informationGene expression connectivity mapping and its application to Cat-App
Gene expression connectivity mapping and its application to Cat-App Shu-Dong Zhang Northern Ireland Centre for Stratified Medicine University of Ulster Outline TITLE OF THE PRESENTATION Gene expression
More informationInferring Gene Networks from Microarray Data using a Hybrid GA p.1
Inferring Gene Networks from Microarray Data using a Hybrid GA Mark Cumiskey, John Levine and Douglas Armstrong johnl@inf.ed.ac.uk http://www.aiai.ed.ac.uk/ johnl Institute for Adaptive and Neural Computation
More informationTowards Gene Network Estimation with Structure Learning
Proceedings of the Postgraduate Annual Research Seminar 2006 69 Towards Gene Network Estimation with Structure Learning Suhaila Zainudin 1 and Prof Dr Safaai Deris 2 1 Fakulti Teknologi dan Sains Maklumat
More informationGrand Challenges in Computational Biology
Grand Challenges in Computational Biology Kimmen Sjölander UC Berkeley Reconstructing the Tree of Life CITRIS-INRIA workshop 24 May, 2011 Prediction of biological pathways and networks Human microbiome
More informationGenome Biology and Biotechnology
Genome Biology and Biotechnology Functional Genomics Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course
More informationUpstream/Downstream Relation Detection of Signaling Molecules using Microarray Data
Vol 1 no 1 2005 Pages 1 5 Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data Ozgun Babur 1 1 Center for Bioinformatics, Computer Engineering Department, Bilkent University,
More informationBioinformatics. Microarrays: designing chips, clustering methods. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Microarrays: designing chips, clustering methods Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18 Feb 25 Sequence
More informationOur view on cdna chip analysis from engineering informatics standpoint
Our view on cdna chip analysis from engineering informatics standpoint Chonghun Han, Sungwoo Kwon Intelligent Process System Lab Department of Chemical Engineering Pohang University of Science and Technology
More informationBioinformatics opportunities in Genomics and Genetics
Bioinformatics opportunities in Genomics and Genetics Case Study: Prediction of novel gene functions of NSF1/YPL230W in Saccharomyces Cerevisiae via search for maximally interconnected sub-graph Kyrylo
More informationCS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes
CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes Coalescence Scribe: Alex Wells 2/18/16 Whenever you observe two sequences that are similar, there is actually a single individual
More informationPredicting prokaryotic incubation times from genomic features Maeva Fincker - Final report
Predicting prokaryotic incubation times from genomic features Maeva Fincker - mfincker@stanford.edu Final report Introduction We have barely scratched the surface when it comes to microbial diversity.
More informationAugmenting DIAMOnD: A Method for Improving Disease Networks Among Human Genes
Augmenting DIAMOnD: A Method for Improving Disease Networks Among Human Genes A Major Qualifying Project submitted to the Faculty of WORCESTER POLYTECHNIC INSTITUTE in partial fulfillment of the requirements
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationFrom Bench to Bedside: Role of Informatics. Nagasuma Chandra Indian Institute of Science Bangalore
From Bench to Bedside: Role of Informatics Nagasuma Chandra Indian Institute of Science Bangalore Electrocardiogram Apparent disconnect among DATA pieces STUDYING THE SAME SYSTEM Echocardiogram Chest sounds
More informationTechnical University of Denmark
1 of 13 Technical University of Denmark Written exam, 15 December 2007 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open Book Exam Provide your answers and calculations on
More informationGene function prediction. Computational analysis of biological networks. Olga Troyanskaya, PhD
Gene function prediction Computational analysis of biological networks. Olga Troyanskaya, PhD Available Data Coexpression - Microarrays Cells of Interest Known DNA sequences Isolate mrna Glass slide Resulting
More informationMANIFESTO OF STUDIES 2012
MANIFESTO OF STUDIES 2012 1st YEAR Course Teacher Hours Synopsis Evaluation procedure Laboratory Safety Course (Mandatory) Prof. Mancini I. Dr. Provenzani A. 12 General Laboratory Procedures, Equipment
More informationOutline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationFrom Proteomics to Systems Biology. Integration of omics - information
From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What
More informationECS 234: Introduction to Computational Functional Genomics ECS 234
: Introduction to Computational Functional Genomics Administrativia Prof. Vladimir Filkov 3023 Kemper filkov@cs.ucdavis.edu Appts: Office Hours: Wednesday, 1:30-3p Ask me or email me any time for appt
More informationBayesian Networks as framework for data integration
Bayesian Networks as framework for data integration Jun Zhu, Ph. D. Department of Genomics and Genetic Sciences Icahn Institute of Genomics and Multiscale Biology Icahn Medical School at Mount Sinai New
More informationReconstructing Gene Regulatory Networks from Homozygous and Heterozygous Deletion Data Using Gaussian Noise Model
2013 First International Conference on Artificial Intelligence, Modelling & Simulation Reconstructing Gene Regulatory Networks from Homozygous and Heterozygous Deletion Data Using Gaussian Noise Model
More informationPredictive and Causal Modeling in the Health Sciences. Sisi Ma MS, MS, PhD. New York University, Center for Health Informatics and Bioinformatics
Predictive and Causal Modeling in the Health Sciences Sisi Ma MS, MS, PhD. New York University, Center for Health Informatics and Bioinformatics 1 Exponentially Rapid Data Accumulation Protein Sequencing
More informationNETWORK BASED PRIORITIZATION OF DISEASE GENES
NETWORK BASED PRIORITIZATION OF DISEASE GENES by MEHMET SİNAN ERTEN Submitted in partial fulfillment of the requirements for the degree of Master of Science Thesis Advisor: Mehmet Koyutürk Department of
More information11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11
Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the
More informationand Promoter Sequence Data
: Combining Gene Expression and Promoter Sequence Data Outline 1. Motivation Functionally related genes cluster together genes sharing cis-elements cluster together transcriptional regulation is modular
More information27041, Week 02. Review of Week 01
27041, Week 02 Review of Week 01 The human genome sequencing project (HGP) 2 CBS, Department of Systems Biology Systems Biology and emergent properties 3 CBS, Department of Systems Biology Different model
More informationA MACHINE LEARNING APPROACH TO QUERY TIME- SERIES MICROARRAY DATA SETS FOR FUNCTIONALLY RELATED GENES USING HIDDEN MARKOV MODELS
A MACHINE LEARNING APPROACH TO QUERY TIME- SERIES MICROARRAY DATA SETS FOR FUNCTIONALLY RELATED GENES USING HIDDEN MARKOV MODELS BY Alexander Senf Submitted to the graduate degree program in Computer Science
More informationThe interactions that occur between two proteins are essential parts of biological systems.
Gabor 1 Evaluation of Different Biological Data and Computational Classification Methods for Use in Protein Interaction Prediction in Signaling Pathways in Humans Yanjun Qi 1 and Judith Klein-Seetharaman
More informationSystem Identification methods for Reverse Engineering Gene Regulatory Networks
System Identification methods for Reverse Engineering Gene Regulatory Networks by Zhen Wang A thesis submitted to the School of Computing in conformity with the requirements for the degree of Master of
More informationIn silico prediction of novel therapeutic targets using gene disease association data
In silico prediction of novel therapeutic targets using gene disease association data, PhD, Associate GSK Fellow Scientific Leader, Computational Biology and Stats, Target Sciences GSK Big Data in Medicine
More informationECS 234: Introduction to Computational Functional Genomics ECS 234
: Introduction to Computational Functional Genomics Administrativia Prof. Vladimir Filkov 3023 Kemper filkov@cs.ucdavis.edu Appts: Office Hours: M,W, 3-4pm, and by appt. , 4 credits, CRN: 54135 http://www.cs.ucdavis.edu~/filkov/234/
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationMetabolic Networks. Ulf Leser and Michael Weidlich
Metabolic Networks Ulf Leser and Michael Weidlich This Lecture Introduction Systems biology & modelling Metabolism & metabolic networks Network reconstruction Strategy & workflow Mathematical representation
More informationSmart India Hackathon
TM Persistent and Hackathons Smart India Hackathon 2017 i4c www.i4c.co.in Digital Transformation 25% of India between age of 16-25 Our country needs audacious digital transformation to reach its potential
More informationEpigenetics and DNase-Seq
Epigenetics and DNase-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by Anthony
More information6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008
MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationBTRY 7210: Topics in Quantitative Genomics and Genetics
BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu Spring 2015, Thurs.,12:20-1:10
More informationFunction Prediction of Proteins from their Sequences with BAR 3.0
Open Access Annals of Proteomics and Bioinformatics Short Communication Function Prediction of Proteins from their Sequences with BAR 3.0 Giuseppe Profiti 1,2, Pier Luigi Martelli 2 and Rita Casadio 2
More informationCapabilities & Services
Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro
More informationBIOINFORMATICS THE MACHINE LEARNING APPROACH
88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and
More informationStatistical Methods for Network Analysis of Biological Data
The Protein Interaction Workshop, 8 12 June 2015, IMS Statistical Methods for Network Analysis of Biological Data Minghua Deng, dengmh@pku.edu.cn School of Mathematical Sciences Center for Quantitative
More informationDetecting gene-gene interactions in high-throughput genotype data through a Bayesian clustering procedure
Detecting gene-gene interactions in high-throughput genotype data through a Bayesian clustering procedure Sui-Pi Chen and Guan-Hua Huang Institute of Statistics National Chiao Tung University Hsinchu,
More informationExploring the Genetic Basis of Congenital Heart Defects
Exploring the Genetic Basis of Congenital Heart Defects Sanjay Siddhanti Jordan Hannel Vineeth Gangaram szsiddh@stanford.edu jfhannel@stanford.edu vineethg@stanford.edu 1 Introduction The Human Genome
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationA Propagation-based Algorithm for Inferring Gene-Disease Associations
A Propagation-based Algorithm for Inferring Gene-Disease Associations Oron Vanunu Roded Sharan Abstract: A fundamental challenge in human health is the identification of diseasecausing genes. Recently,
More informationStudy on the Application of Data Mining in Bioinformatics. Mingyang Yuan
International Conference on Mechatronics Engineering and Information Technology (ICMEIT 2016) Study on the Application of Mining in Bioinformatics Mingyang Yuan School of Science and Liberal Arts, New
More informationFunctional genomics + Data mining
Functional genomics + Data mining BIO337 Systems Biology / Bioinformatics Spring 2014 Edward Marcotte, Univ of Texas at Austin Edward Marcotte/Univ of Texas/BIO337/Spring 2014 Functional genomics + Data
More informationCS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016
CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016 Background A typical human cell consists of ~6 billion base pairs of DNA and ~600 million bases of mrna. It is time-consuming and expensive to
More informationLARGE-SCALE PROTEIN INTERACTOMICS. Karl Frontzek Institute of Neuropathology
LARGE-SCALE PROTEIN INTERACTOMICS Karl Frontzek Institute of Neuropathology STUDYING THE INTERACTOME A yeast 2 hybrid (DB: DNA binding domain, AD: activation domain) B tandem affinity purification (dashed
More informationRole of Centrality in Network Based Prioritization of Disease Genes
Role of Centrality in Network Based Prioritization of Disease Genes Sinan Erten 1 and Mehmet Koyutürk 1,2 Case Western Reserve University (1)Electrical Engineering & Computer Science (2)Center for Proteomics
More informationStatistical Inference and Reconstruction of Gene Regulatory Network from Observational Expression Profile
Statistical Inference and Reconstruction of Gene Regulatory Network from Observational Expression Profile Prof. Shanthi Mahesh 1, Kavya Sabu 2, Dr. Neha Mangla 3, Jyothi G V 4, Suhas A Bhyratae 5, Keerthana
More informationKnowledge-Guided Analysis with KnowEnG Lab
Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing
More informationBioinformatics for Biologists
Bioinformatics for Biologists Functional Genomics: Microarray Data Analysis Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Outline Introduction Working with microarray data Normalization Analysis
More informationIngenuity Pathway Analysis (IPA )
Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationInformation Driven Biomedicine. Prof. Santosh K. Mishra Executive Director, BII CIAPR IV Shanghai, May
Information Driven Biomedicine Prof. Santosh K. Mishra Executive Director, BII CIAPR IV Shanghai, May 21 2004 What/How RNA Complexity of Data Information The Genetic Code DNA RNA Proteins Pathways Complexity
More informationCS 6824: New Directions in Computational Systems Biology
CS 6824: New Directions in Computational Systems Biology T. M. Murali January 19, 2011 Course Structure Discuss state-of-the-art research papers. Course Structure Lectures Discuss state-of-the-art research
More informationEditorial. Current Computational Models for Prediction of the Varied Interactions Related to Non-Coding RNAs
Editorial Current Computational Models for Prediction of the Varied Interactions Related to Non-Coding RNAs Xing Chen 1,*, Huiming Peng 2, Zheng Yin 3 1 School of Information and Electrical Engineering,
More informationUsing Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart
Using Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart Hospital, Norfolk, VA Disclosure Consulting: Livanova,
More information