Introduction to BIOINFORMATICS

Size: px
Start display at page:

Download "Introduction to BIOINFORMATICS"

Transcription

1 COURSE OF BIOINFORMATICS a.a Introduction to BIOINFORMATICS

2 What is Bioinformatics? (I) The sinergy between biology and informatics

3 What is Bioinformatics? (II) From:

4 (some) Features of Bioinformatics Interdisciplinary Rapidly growing field Highly required expertise Increasingly necessary

5 Bioinformatics Challenges (I) The challenge is: providing researchers with better access to analysis and computing tools in order to advance understanding of genetic data and their interplay in health and diseases finding new approaches to deal with the volume and complexity of data

6 Biological Complexity (I) From:

7 Biological Complexity (II) GWAS (Genome- wide associa/on studies) DATABASES Gene Expression (Microarray expression profile) CNV (Copy- number varia/ons) Protein Interac:on or Protein Complexes ChIP- seq

8 Speed in the capability of Data production Data interpretation

9 Components of Bioinformatics From:

10 What is an Algorithm? Is a finite list of well-defined instructions for calculating a function

11 Bioinformatics: Components and Aims Databases: allowing the storage and management of large biological data sets Algorithms: to determine relationships among members of large data sets The use of these tools for the analysis and interpretation and integration of various types of biological data, including DNA, RNA and protein sequences, protein structures, gene expression profiles, and biochemical pathways

12 Bioinformatics Developers They develop tools for bioinformatics Experts in Mathematics, Statistics and Informatics Computational biologists Bioinformatics Users They use the tools of bioinformatics Researchers (Biologists, Biotechnologist. )

13 Bioinformatics Applications Sequence analysis Genome annotation Literature analysis Analysis of gene expression Analysis of regulation Analysis of protein expression Analysis of mutations in cancer Comparative genomics Computational evolutionary biology Modeling biological systems High-throughput image analysis

14 Bioinformatics Applications: Example (I) To which mouse chromosome this sequence belong?? GTATTAGAGGGTGAAGAAGGCTCTGGAGGCTGCTTCTGGGGAGTGGCTGAGGGACTAGGGCAGCTAATTG CCCATAGCCCCATCCTAGGGGCTTCAGGGACAGTGGCAGCAATGAGAGATTTGAGACTTGGTGTGTTCGT GGGGCCGTAGGCAGGTGCTGTTAACTTGTGTGGGTGTGAGTGGGGACTGAAACAGCGACAGCGAAGGCTG AGAGATGGATGGGTGGACTGAGTTAGAGGACAGAGGTGAGGAAGGCAGGTTGGGAGAGGGGACACTGGCT CCTTGCCAAGTAGCTTGGGGAGGACAGGGTGCTGCAGCTGCCTGCAGCAGTCCTAGCTAGCTCAGATGCC TGCTTGATAAAGCACTGTGGGGGTAACGTGGGTGTGTGTGCCCCTTCTGCAGGGCAGCCTGTGGGAGAAG GGGTATTGGGCAGAAGGAAGGTAAGCCAGCAGGTGGTACCTTGTAGATTGGTTCTCTTGAAGGCTGCTCT TGACATCCCAGGGCACTGGCTTCTTCCTCCCTCCCCGCAAGGTGGGAGGTCCTGAGCGAGGTGTTTCCCT TCGCTCCCACAGGAAAAGCTGCTTTACTGAGTTCTCAAGTTTGGAACTACAGCCATGATTTGGCCACCAT TACAGACCTGGGACTTTAGGGCTAACCAGATCTTTGTAAGGACTTGTGCCTCTTGGGGGACCTCTGCCTG TTCTCATGCTTGGCCCTCTGGCACTTCTGTAGTGGGAGGGATGGGGGGTGGTATTCTGGGATGTGGGTCC CAGGCCTCCCATCCCTCACACAGCCACTGTATCCCCTCTCTCTGTCCTATCATGCCCACGTCTGCCACGA GAGCTAGTCACTGCCGTCCGTACATCACGTCTCACTGTCCTGAGTGCCATGCCTCTCCCAGCCCCCATCC CTGGCCCCTGGGTAGATATGGGCAATATCTGCTCTACACTAGGGGTTGGAGTCCAGGGAAGGCAAAGATT TGGGCCTCAGTCTCTAGTCCTACGTTCCACGAATCCAACCAGTGTGCCTCCCACAAGGAACCTTACGACC TTGTTTGGTTCACTCCATTACTTCCTATCCTGGATGGGAACTGGTGTGTGCCTGCCTGGGGATGACCTTG GACCTCTGCCTTTTCTTTTATCTAAGTGGATGCCTCCTAGGCCTGACTCCTTGTGTTGAGCTGGAGGCAG CCAAGTCAGGTGCCAATGTCTTGGCATCAGTAAGAACAGTCAAGAGTCCCAGGGCAGGGCCACACTTCTC CCATCTTTCGCTTCCACCCCAGCTTGTGATCGCTAGCCTCCCAGAGCTCAGCTGCCATTAAGTCCCCATG How could you know it experimentally?? How could you know it bioinformatically??

15 Bioinformatics Applications: Example (I) Experimentally.. Think about costs, time, pitfalls

16 Bioinformatics Applications: Example (I) Bioinformatically.. costs, time, pitfalls

17 Bioinformatics Applications: Example (II) Is your gene of interest subjected to alternative splicing events? How could you know it experimentally?? How could you know it bioinformatically??

18 Bioinformatics Applications: Example (II) Experimentally.. Is exon 11 alternatively spliced? 10

19 Bioinformatics Applications: Example (II) Bioinformatically..

20 Do you have any Doubt?? Any questions?? Do you need more information??

21 What is Bioinformatics? (III) From:

22 Biological Complexity (III): next generation sequencing From:

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility 2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,

More information

Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview

Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

What is Bioinformatics?

What is Bioinformatics? What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is

More information

Capabilities & Services

Capabilities & Services Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro

More information

Applied Bioinformatics

Applied Bioinformatics Applied Bioinformatics In silico and In clinico characterization of genetic variations Assistant Professor Department of Biomedical Informatics Center for Human Genetics Research ATCAAAATTATGGAAGAA ATCAAAATCATGGAAGAA

More information

Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future.

Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Louis Bernatchez Genomics and Conservation of Aquatic Resources Université LAVAL! Molecular

More information

bioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5

bioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5 Bioinformatica 1 / 5 2 / 5 3 / 5 Bioinformatica Bioinformatics is the name given to these mathematical and computing approaches used to glean understanding of biological processes. Common activities in

More information

Machine Learning. HMM applications in computational biology

Machine Learning. HMM applications in computational biology 10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

Computers in Biology and Bioinformatics

Computers in Biology and Bioinformatics Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come

More information

Genomes: What we know and what we don t know

Genomes: What we know and what we don t know Genomes: What we know and what we don t know Complete draft sequence 2001 October 15, 2007 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms!

More information

Genomes contain all of the information needed for an organism to grow and survive.

Genomes contain all of the information needed for an organism to grow and survive. Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Evidence of Purifying Selection in Humans. John Long Mentor: Angela Yen (Kellis Lab)

Evidence of Purifying Selection in Humans. John Long Mentor: Angela Yen (Kellis Lab) Evidence of Purifying Selection in Humans John Long Mentor: Angela Yen (Kellis Lab) Outline Background Genomes Expression Regulation Selection Goal Methods Progress Future Work Outline Background Genomes

More information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

Inferring Gene Networks from Microarray Data using a Hybrid GA p.1

Inferring Gene Networks from Microarray Data using a Hybrid GA p.1 Inferring Gene Networks from Microarray Data using a Hybrid GA Mark Cumiskey, John Levine and Douglas Armstrong johnl@inf.ed.ac.uk http://www.aiai.ed.ac.uk/ johnl Institute for Adaptive and Neural Computation

More information

CSC 121 Computers and Scientific Thinking

CSC 121 Computers and Scientific Thinking CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Agilent Genomics Software Future Directions

Agilent Genomics Software Future Directions Agilent Genomics Software Future Directions Michael Rosenberg, PhD Director, Genomics Software Agilent: A Focused Measurement Company Serving Diverse End Markets Electronic Measurement 2008 Revenue: $3.6

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

More information

From Proteomics to Systems Biology. Integration of omics - information

From Proteomics to Systems Biology. Integration of omics - information From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

More information

THE HEALTH AND RETIREMENT STUDY: GENETIC DATA UPDATE

THE HEALTH AND RETIREMENT STUDY: GENETIC DATA UPDATE : GENETIC DATA UPDATE April 30, 2014 Biomarker Network Meeting PAA Jessica Faul, Ph.D., M.P.H. Health and Retirement Study Survey Research Center Institute for Social Research University of Michigan HRS

More information

Chapter 14: Biotechnology and Genomics

Chapter 14: Biotechnology and Genomics Chapter 14: Biotechnology and Genomics AP Curriculum Alignment Biotechnology is extremely important to humans. Human desires for improvements in our food, environment and health have driven this field

More information

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...

More information

Bioinformatics Programming and Analysis CSC Dr. Garrett Dancik

Bioinformatics Programming and Analysis CSC Dr. Garrett Dancik Bioinformatics Programming and Analysis CSC 315-01 Dr. Garrett Dancik What is bioinformatics Bioinformatics: Biology + information the study and utilization of methods for storing, retrieving and analyzing

More information

Complete draft sequence 2001

Complete draft sequence 2001 Genomes: What we know and what we don t know Complete draft sequence 2001 November11, 2009 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms

More information

Functional Annotation and Prioritization of Whole Exome and Whole Genome Sequencing Variants. Mulin Jun Li

Functional Annotation and Prioritization of Whole Exome and Whole Genome Sequencing Variants. Mulin Jun Li Functional Annotation and Prioritization of Whole Exome and Whole Genome Sequencing Variants Mulin Jun Li 2017.04.19 Content Genetic variant, potential function impact and general annotation Regulatory

More information

INTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet

INTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

Bioinformatics. Outline of lecture

Bioinformatics. Outline of lecture Bioinformatics Uma Chandran, MSIS, PhD Department of Biomedical Informatics University of Pittsburgh chandran@pitt.edu 412 648 9326 07/08/2014 Outline of lecture What is Bioinformatics? Examples of bioinformatics

More information

A very brief introduc0on to bioinforma0cs. Mikhail Spivakov, PhD European Bioinforma0cs Ins0tute

A very brief introduc0on to bioinforma0cs. Mikhail Spivakov, PhD European Bioinforma0cs Ins0tute A very brief introduc0on to bioinforma0cs Mikhail Spivakov, PhD European Bioinforma0cs Ins0tute What bioinforma0cs does? Cataloguing Mining Modelling For lab biologists to look at favourite genes etc.

More information

Processing Data from Next Generation Sequencing

Processing Data from Next Generation Sequencing July 2 nd, 2009 INRIA - ActiveEon - Nice - Sophia-Antipolis Processing Data from Next Generation Sequencing Functional Genomics platform of Nice-Sophia-Antipolis Kévin Lebrigand, CNRS / University of Nice

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

Short Course Instructors

Short Course Instructors Short Course Instructors Andrew Allen, Ph.D., Professor of Biostatistics and Bioinformatics and Director of the new Duke Center of Statistical Genetics and Genomics, Duke University, has expertise in statistical

More information

ChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015

ChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 ChIP-Seq Tools J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA or

More information

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

BIOINFORMATICS THE MACHINE LEARNING APPROACH

BIOINFORMATICS THE MACHINE LEARNING APPROACH 88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

NGS Approaches to Epigenomics

NGS Approaches to Epigenomics I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic

More information

MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305

MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What

More information

Genomic Resources and Gene/QTL Discovery in Livestock

Genomic Resources and Gene/QTL Discovery in Livestock Genomic Resources and Gene/QTL Discovery in Livestock Jerry Taylor University of Missouri FAO Intl Tech Conf on Agric Biotech in Dev Count, Guadalajara, March 2 nd 2010 5/7/2010 http://animalgenomics.missouri.edu

More information

Lecture 11: Bioinformatics tools and databases Vladimir Rogojin. Fall 2015

Lecture 11: Bioinformatics tools and databases Vladimir Rogojin. Fall 2015 Introduction to Computational and Systems Biology Lecture 11: Bioinformatics tools and databases Vladimir Rogojin Department of Computer Science, Åbo Akademi http://users.abo.fi/ipetre/compsysbio Fall

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

Microbial Metabolism Systems Microbiology

Microbial Metabolism Systems Microbiology 1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

Exercise1 ArrayExpress Archive - High-throughput sequencing example

Exercise1 ArrayExpress Archive - High-throughput sequencing example ArrayExpress and Atlas practical: querying and exporting gene expression data at the EBI Gabriella Rustici gabry@ebi.ac.uk This practical will introduce you to the data content and query functionality

More information

What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?

What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells? Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression

More information

Do engineered ips and ES cells have similar molecular signatures?

Do engineered ips and ES cells have similar molecular signatures? Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Classification and Learning Using Genetic Algorithms

Classification and Learning Using Genetic Algorithms Sanghamitra Bandyopadhyay Sankar K. Pal Classification and Learning Using Genetic Algorithms Applications in Bioinformatics and Web Intelligence With 87 Figures and 43 Tables 4y Spri rineer 1 Introduction

More information

DNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs

DNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs DNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs Nadia Pisanti University of Pisa & Leiden University Outline New Generation Sequencing (NGS), and the importance of detecting

More information

Computational Genomics ( )

Computational Genomics ( ) Computational Genomics (0382.3102) http://www.cs.tau.ac.il/ bchor/comp-genom.html Prof. Benny Chor benny@cs.tau.ac.il Tel-Aviv University Fall Semester, 2002-2003 c Benny Chor p.1 AdministraTrivia Students

More information

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists Rickard Sandberg Karolinska Institutet 13-17 May 2013 OUTLINE INTRODUCTION Introduce yourselves HISTORY MODERN What is bioinformatics today? COURSE ONLINE LEARNING OPPORTUNITIES

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!

More information

RNA-Sequencing analysis

RNA-Sequencing analysis RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges

More information

Introduction to RNA-Seq in GeneSpring NGS Software

Introduction to RNA-Seq in GeneSpring NGS Software Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through

More information

Hidden Markov Models. Some applications in bioinformatics

Hidden Markov Models. Some applications in bioinformatics Hidden Markov Models Some applications in bioinformatics Hidden Markov models Developed in speech recognition in the late 1960s... A HMM M (with start- and end-states) defines a regular language L M of

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Challenging algorithms in bioinformatics

Challenging algorithms in bioinformatics Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com

More information

ROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE

ROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE CHAPTER1 ROAD TO STATISTICAL BIOINFORMATICS Jae K. Lee Department of Public Health Science, University of Virginia, Charlottesville, Virginia, USA There has been a great explosion of biological data and

More information

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome. Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all

More information

The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential

The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,

More information

Introduction to Genome Biology

Introduction to Genome Biology Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure

More information

Design a super panel for comprehensive genetic testing

Design a super panel for comprehensive genetic testing Design a super panel for comprehensive genetic testing Rong Chen, Ph.D. Assistant Professor Director of Clinical Genome Sequencing Dept. of Genetics and Genomic Sciences Institute for Genomics and Multiscale

More information

Illumina Genome Analyzer. Progenika Experience. - Susana Catarino -

Illumina Genome Analyzer. Progenika Experience. - Susana Catarino - Illumina Genome Analyzer Progenika Experience - Susana Catarino - Who are we? 2000 PROGENIKA BIOPHARMA Development, production and commercialization of new genomic tools for diagnosis, prognosis and drug-response

More information

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger

More information

Introduction to Bioinformatics Finish. Johannes Starlinger

Introduction to Bioinformatics Finish. Johannes Starlinger Introduction to Bioinformatics Finish Johannes Starlinger This Lecture Genomics Sequencing Gene prediction Evolutionary relationships Motifs - TFBS Transcriptomics Alignment Proteomics Structure prediction

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

Pioneering Clinical Omics

Pioneering Clinical Omics Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of

More information

Computational Genomics. Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall

Computational Genomics. Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall Computational Genomics Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall 2015-16 1 What s in class this week Motivation Administrata Some very basic biology Some very basic biotechnology Examples of our type

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

Beyond Genomics: Detecting Codes and Signals in the Cellular Transcriptome

Beyond Genomics: Detecting Codes and Signals in the Cellular Transcriptome Beyond Genomics: Detecting Codes and Signals in the Cellular Transcriptome Brendan J. Frey University of Toronto Purpose of my talk To identify aspects of bioinformatics in which attendees of ISIT may

More information

Jumping Into Your Gene Pool: Understanding Genetic Test Results

Jumping Into Your Gene Pool: Understanding Genetic Test Results Jumping Into Your Gene Pool: Understanding Genetic Test Results Susan A. Berry, MD Professor and Director Division of Genetics and Metabolism Department of Pediatrics University of Minnesota Acknowledgment

More information

Introduction to iplant Collaborative Jinyu Yang Bioinformatics and Mathematical Biosciences Lab

Introduction to iplant Collaborative Jinyu Yang Bioinformatics and Mathematical Biosciences Lab Introduction to iplant Collaborative Jinyu Yang Bioinformatics and Mathematical Biosciences Lab May/27 th /2016 About iplant What is iplant Collaborative? 1. A virtual organization 2. Created by a cooperative

More information

Bioinformatics Analysis of Nano-based Omics Data

Bioinformatics Analysis of Nano-based Omics Data Bioinformatics Analysis of Nano-based Omics Data Penny Nymark, Pekka Kohonen, Vesa Hongisto and Roland Grafström Hands-on Workshop on Nano Safety Assessment, 29 th September, 2016, National Technical University

More information

Gene expression microarrays and assays. Because your results can t wait

Gene expression microarrays and assays. Because your results can t wait Gene expression microarrays and assays Because your results can t wait A simple path from data to decision-making The power of expression microarrays Transcriptome-wide analysis can be complex. Matching

More information

9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3

9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3 cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences

More information

DNA is normally found in pairs, held together by hydrogen bonds between the bases

DNA is normally found in pairs, held together by hydrogen bonds between the bases Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,

More information