Sequence Databases and database scanning
|
|
- Wendy Logan
- 6 years ago
- Views:
Transcription
1 Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases. 3D structure and structure classification databases. Specific databases (GTPases, AAA-protein, ligand binding, etc). Examples of primary databases: Nucleic acids ENA European Nucleotide Archive, NCBI (National Center for Biotechnology Information), DDBJ (DNA Database of Japan) The ENA (European Nucleotide Archive) formerly the EMBL (European Molecular Biology Laboratory) Nucleotide Sequence Database is included within the server of the European Bioinformatics Institute Very many other services/databases and tools are provided by EBI
2 ENA: The NCBI server ( includes many databases and services. Provides valuable educational material at: Proteins (amino acid sequence databases): Expasy PIR MIPS The Expasy group: ExPASy server (Expert Protein Analysis System) proteomics server of the Swiss Institute of Bioinformatics (SIB). This server is dedicated to the analysis of protein sequences and structures as well as 2-D PAGE. Includes: SWISS-PROT and TrEMBL - Protein sequences PROSITE - Protein families and domains SWISS-2DPAGE - Two-dimensional polyacrylamide gel electrophoresis SWISS-3DIMAGE - 3D images of proteins and other biological macromolecules SWISS-MODEL Repository - Automatically generated protein models ENZYME - Enzyme nomenclature
3 ExPASy The server also includes a large collection of links to various proteomics tools: Identification and characterization DNA -> Protein Similarity searches Pattern and profile searches Post-translational modification prediction Primary structure analysis Secondary structure prediction Functionality Tertiary structure Transmembrane regions Database UniprotKB/TrEMBL - sequences translated from the EMBL Nucleotide Sequence Database. The format of the sequence entries for standardization purposes follows as closely as possible that of the EMBL Nucleotide Sequence Database. The database is updated daily. SWISS-PROT makes cross-references to many specific databases. Examples: The PROSITE dictionary of sites and patterns in proteins The Protein Data Bank (PDB) Mendelian Inheritance in Man (MIM) Mouse Genome Database (MGD) The restriction enzymes database (REBASE) And more cross-references: Example of a Uniprot entry: human leukotriene A4 hydrolase The G-protein--coupled receptor database (GCRDb) The Encyclopedia of Escherichia coli genes and metabolism (EcoCyc) The 2D gel protein database (SWISS-2DPAGE) The Saccharomyces Genome Database (SGD) The Yeast Electrophoresis Protein Database (YEPD) The Harefield Hospital 2D gel protein databases The Drosophila genome database (FlyBase) The database of Homology-derived Secondary Structure of Proteins (HSSP) The transcription factor database (Transfac)
4 The PIR group: The Protein Information Resource (PIR), in collaboration with MIPS and JIPID, produces the PIR- International Protein Sequence Database (PIR-PSD) - a comprehensive, non-redundant, expertly annotated, fully classified and extensively crossreferenced protein sequence database in the public domain. The PIR-NRL3D database makes the sequence information in PDB available for similarity searches and retrieval and provides cross-reference information for use with the other PIR Protein Sequence Databases. Examples of specific databases: Proteome: Database on proteins from several different genome sources Human,mouse,rat, yeasts, worms & pathogenic fungi. Annotation focuses on the molecular function and biological role of proteins, expression patterns across cells, tissues, and organs, consequences of gene mutation (mouse proteins only), relationships to disease, and the physical and regulatory interactions between proteins and genes. NOT FREE See also eg (for free) Flybase or through ebi This is the database of the model organism Drosophila melanogaster. Genome database with information about genes, clones, function expression and lots and lots more. Enzyme nomenclature database: Enzyme contains the following data : EC number Recommended name Alternative names (if any) Catalytic activity Cofactors (if any) Pointers to the SWISS-PROT entry(s) that correspond to the protein Pointers to disease(s) associated with the particular protein
5 Secondary (pattern) databases: Secondary (pattern) databases: Contain the results of analysis of sequences in the primary databases: Homologous sequences may be gathered in multiple alignments, within which conserved regions (motifs) are clearly visible. These motifs often reflect some vital biological role. An unknown sequence may be searched against a database of motifs to determine whether or not it contains any of the conserved motifs. This will define the family to which the sequence belongs. PRINTS - Data library of conserved motifs used to characterize a protein family. PFAM - is a large collection of multiple sequence alignments covering many common protein domains. Version 7.5 of Pfam (July 2007) contains alignments and models for 9318 protein families. PROSITE - Data library of biologically significant sites and patterns to reliably identify to which known family of protein a sequence belongs to. REBASE - Data library of type 2 restriction enzymes. PRINTS ( is a compendium of protein fingerprints. A fingerprint is a group of conserved motifs used to characterize a protein family; its diagnostic power is refined by iterative scanning of a SWISS-PROT/TrEMBL composite. Usually the motifs do not overlap, but are separated along a sequence, though they may be contiguous in 3D-space. Fingerprints can encode protein folds and functionalities more flexibly and powerfully than can single motifs. PROSITE: dictionary of sites and patterns in proteins Examples of patterns: GDSGGP a pattern typical for a serine protease [A,G]-x(4)-G-K-[S,T] a pattern corresponding to the ATP/GTPbinding site
6 The conventions for the PROSITE patterns : The conventions for the PROSITE patterns 2: The standard IUPAC one-letter codes for the amino acids are used. The symbol x is used for a position where any amino acid is accepted. Ambiguities are indicated by listing the acceptable amino acids for a given position, between square parentheses [ ]. For example: [ALT] stands for Ala or Leu or Thr. Ambiguities are also indicated by listing between a pair of curly brackets { } the amino acids that are not accepted at a given position. For example: {AM} stands for any amino acid except Ala and Met. Each element in a pattern is separated from its neighbour by a -. Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: x(3) corresponds to x-x-x, x(2,4) corresponds to x-x or x-x-x or x-x-x-x. When a pattern is restricted to either the N- or C- terminal of a sequence, that pattern either starts with a < symbol or respectively ends with a > symbol. Examples: Example of a PROSITE entry: phospholipase A2 [AC]-x-V-x(4)-{ED} This pattern is translated as: [Ala or Cys]-any-Val-anyany-any-any-{any but Glu or Asp} < A-x-[ST](2)-x(0,1)-V This pattern, which must be in the N-terminus of the sequence (<), is translated as: Ala-any-[Ser or Thr]- [Ser or Thr]-(any or none)-val
7 Searching databases: Homology search - Used to search for related sequences in sequence databases and allows a search with long sequences, programs like FASTA and BLAST are used. Pattern Searches - used to find short sequence patterns in a single sequence, in a group of sequences or in a database. Pattern searches only decide whether there is an exact match or not (subsequently no gaps or substitution matrices used). Useful when there is no information on a particular protein. Steps in sequences analysis: 1. Sequence the gene, translate the nucleotides 2. Search databases using BLAST or FASTA (local alignment of short stretches). If convinced by the hits, go to step If the BLAST search was not 100% convincing, also search for patterns, motifs. Compare with known function, if known, etc. 4. If identified correctly: Sequence alignment - align and compare the sequence to a family of related sequences. 5. Search PDB. Any homologues with a known 3D structure? Make a homology-based model - useful for a deeper understanding of function, design of mutations, etc. BLAST: BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ( BLAST/) Programs within BLAST: blastp - Compares an amino acid query sequence against a protein sequence database. blastn - Compares a nucleotide query sequence against a nucleotide sequence database. blastx - Compares a nucleotide query sequence translated in all reading frames against a protein sequence database. This option can be used to find potential translation products of an unknown nucleotide sequence. BLAST algorithm:
8 Example of BLAST search: Example of a BLAST search output: Example of a BLAST search output 2 Example of a BLAST search output 3
9 Example of a BLAST search output 4 Distribution of Blast alignments Alignment score distribution for a database search Black bars - proteins known to be similar to the query sequence. White bars - not related sequences. a- scan does not discriminate well c- perfect discrimination b- usual intermediate result showing overlap between true hits and unrelated sequences. Profile analysis another method Profile analysis is a method of sequence comparison which is distinct from homology and pattern searches. Starts with a multiple sequence alignment which is then used to create a profile. The profile is a table where we find for each amino acid position the frequency of each of the 20 amino acids (Profile = position-specific scoring table). Profile searching can be useful for finding and aligning distantly related sequences and finding new family members. Example of a profile: Cons A B C D E F G H I K L M N P Q... P W T T P S G K R T E G P A P
10 Some rules for sequence search: The requirement for a common folded structure in homologous proteins usually causes these proteins to be similar over the entire length. Therefore, most sequences that share statistically significant similarity throughout their entire lengths are homologous. Matches that are more than 50% identical in a amino acid region occur frequently by chance. Distantly related homologues may lack significant similarity. Two or more homologous sequences may have very few absolutely conserved residues. If homology between A and B and also between B and C --> A and C are related as well. Low complexity regions, trans-membrane regions and coiled-coil regions frequently display significant similarity in the absence of homology (filter out). Guidelines for database scanning: To assess the success of a scanning technique, test its ability to find all the members of a known family from the database. Count how many of the known family members are found with scores higher than for nonmembers. Tutorial: concepts.html see also chime/ and for King and kinemages 39
Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationBiological databases an introduction
Biological databases an introduction By Dr. Erik Bongcam-Rudloff SLU 2017 Biological Databases Sequence Databases Genome Databases Structure Databases Sequence Databases The sequence databases are the
More informationBiological databases an introduction
Biological databases an introduction By Dr. Erik Bongcam-Rudloff SGBC-SLU 2016 VALIDATION Experimental Literature Manual or semi-automatic computational analysis EXPERIMENTAL Costs Needs skilled manpower
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationOutline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationSince 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL
Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality
More informationWill discuss proteins in view of Sequence (I,II) Structure (III) Function (IV) proteins in practice
Will discuss proteins in view of Sequence (I,II) Structure (III) Function (IV) proteins in practice integration - web system (V) 1 Touring the Protein Space (outline) 1. Protein Sequence - how rich? How
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationONLINE BIOINFORMATICS RESOURCES
Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower
More informationWeb-based Bioinformatics Applications in Proteomics
Web-based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu January 30, 2009 NCBI (National Center for Biotechnology Information) http://www.ncbi.nlm.nih.gov/ 1 Pubmed
More informationFACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE
FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)
More informationB I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationI nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
More informationCSE/Beng/BIMM 182: Biological Data Analysis. Instructor: Vineet Bafna TA: Nitin Udpa
CSE/Beng/BIMM 182: Biological Data Analysis Instructor: Vineet Bafna TA: Nitin Udpa Today We will explore the syllabus through a series of questions? Please ASK All logistical information will be given
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationSequence Analysis. BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI MAY P. Benos 1
Sequence Analysis (part III) BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI 2006 31-MAY-2006 2006 P. Benos 1 Outline Sequence variation Distance measures Scoring matrices Pairwise alignments (global,
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools
CAP 5510: Introduction to Bioinformatics : Bioinformatics Tools ECS 254A / EC 2474; Phone x3748; Email: giri@cis.fiu.edu My Homepage: http://www.cs.fiu.edu/~giri http://www.cs.fiu.edu/~giri/teach/bioinfs15.html
More informationCompiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology
Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationThis practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.
PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,
More informationChimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
More informationThe String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.
Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif
More informationComparative Bioinformatics. BSCI348S Fall 2003 Midterm 1
BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to
More informationDatabases in genomics
Databases in genomics Search in biological databases: The most common task of molecular biologist researcher, to answer to the following ques7ons:! Are they new sequences deposited in biological databases
More informationBIOINFORMATICS IN BIOCHEMISTRY
BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and
More informationNiceProt View of Swiss-Prot: P18907
Hosted by NCSC US ExPASy Home page Site Map Search ExPASy Contact us Swiss-Prot Mirror sites: Australia Bolivia Canada China Korea Switzerland Taiwan Search Swiss-Prot/TrEMBL for horse alpha Go Clear NiceProt
More informationDina El-Khishin (Ph.D.) Bioinformatics Research Facility. Deputy Director of AGERI & Head of the Genomics, Proteomics &
Dina El-Khishin (Ph.D.) Deputy Director of AGERI & Head of the Genomics, Proteomics & Bioinformatics Research Facility Agricultural Genetic Engineering Research Institute (AGERI) Giza EGYPT Bioinformatics
More informationBIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationComputational Biology and Bioinformatics
Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management
More informationBiology 4100 Minor Assignment 1 January 19, 2007
Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on
More informationFUNCTIONAL BIOINFORMATICS
Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.
More informationExercise I, Sequence Analysis
Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt
More informationLecture 7 Motif Databases and Gene Finding
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC
More informationBioinformatics Databases
Bioinformatics Databases Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com Agenda
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationBioinformatics Introduction to genomics and proteomics II
Bioinformatics Introduction to genomics and proteomics II ulf.schmitz@informatik.uni-rostock.de Bioinformatics and Systems Biology Group www.sbi.informatik.uni-rostock.de Ulf Schmitz, Introduction to genomics
More informationG4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
More informationBioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases
Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence
More informationAnnotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
More informationFiles for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More informationSmall Genome Annotation and Data Management at TIGR
Small Genome Annotation and Data Management at TIGR Michelle Gwinn, William Nelson, Robert Dodson, Steven Salzberg, Owen White Abstract TIGR has developed, and continues to refine, a comprehensive, efficient
More informationWeb based Bioinformatics Applications in Proteomics. Genbank
Web based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu February 9, 2010 Genbank Primary nucleic acid sequence database Maintained by NCBI National Center for Biotechnology
More informationMatch the Hash Scores
Sort the hash scores of the database sequence February 22, 2001 1 Match the Hash Scores February 22, 2001 2 Lookup method for finding an alignment position 1 2 3 4 5 6 7 8 9 10 11 protein 1 n c s p t a.....
More informationBioinformatics & Protein Structural Analysis. Bioinformatics & Protein Structural Analysis. Learning Objective. Proteomics
The molecular structures of proteins are complex and can be defined at various levels. These structures can also be predicted from their amino-acid sequences. Protein structure prediction is one of the
More informationIdentifying Regulatory Regions using Multiple Sequence Alignments
Identifying Regulatory Regions using Multiple Sequence Alignments Prerequisites: BLAST Exercise: Detecting and Interpreting Genetic Homology. Resources: ClustalW is available at http://www.ebi.ac.uk/tools/clustalw2/index.html
More informationGenome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita
Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing
More informationChristian Sigrist. January 27 SIB Protein Bioinformatics course 2016 Basel 1
Christian Sigrist January 27 SIB Protein Bioinformatics course 2016 Basel 1 General Definition on Conserved Regions Conserved regions in proteins can be classified into 5 different groups: Domains: specific
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationBasic concepts of molecular biology
Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it Life The main actors in the chemistry of life are molecules called proteins nucleic acids Proteins: many different
More informationBLAST. compared with database sequences Sequences with many matches to high- scoring words are used for final alignments
BLAST 100 times faster than dynamic programming. Good for database searches. Derive a list of words of length w from query (e.g., 3 for protein, 11 for DNA) High-scoring words are compared with database
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not
More informationUNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics
UNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, 2010 SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics DURATION: 3 HOURS TOTAL MARKS: 125 Internal Examiner: Dr. Ché Pillay External Examiner: Prof. Nicola
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationKlinisk kemisk diagnostik BIOINFORMATICS
Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,
More informationExercises (Multiple sequence alignment, profile search)
Exercises (Multiple sequence alignment, profile search) 8. Using Clustal Omega program, available among the tools at the EBI website (http://www.ebi.ac.uk/tools/msa/clustalo/), calculate a multiple alignment
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationMaking Sense of DNA and Protein Sequences. Lily Wang, PhD Department of Biostatistics Vanderbilt University
Making Sense of DNA and Protein Sequences Lily Wang, PhD Department of Biostatistics Vanderbilt University 1 Outline Biological background Major biological sequence databanks Basic concepts in sequence
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
More informationab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More informationQuestion 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences.
Bio4342 Exercise 1 Answers: Detecting and Interpreting Genetic Homology (Answers prepared by Wilson Leung) Question 1: Low complexity DNA can be described as sequences that consist primarily of one or
More information2. The dropdown box has a number of databases that are searchable. Select the gene option and search for dihydrofolate reductase.
Bioinformatics Introduction Worksheet The first part of this exercise is aimed at walking you through some of the key tools used by scientists to explore the relationship between genes and proteins throughout
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationSequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases
Chapter 2 Paul Rangel Abstract DNA and Protein sequence databases are the cornerstone of bioinformatics research. DNA databases such as GenBank and EMBL accept genome data from sequencing projects around
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationSequence Analysis. Introduction to Bioinformatics BIMMS December 2015
Sequence Analysis Introduction to Bioinformatics BIMMS December 2015 abriel Teku Department of Experimental Medical Science Faculty of Medicine Lund University Sequence analysis Part 1 Sequence analysis:
More informationAnnotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station
Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Library preparation Sequencing Hypothesis testing Bioinformatics 2 Why annotate?
More informationComparative Modeling Part 1. Jaroslaw Pillardy Computational Biology Service Unit Cornell Theory Center
Comparative Modeling Part 1 Jaroslaw Pillardy Computational Biology Service Unit Cornell Theory Center Function is the most important feature of a protein Function is related to structure Structure is
More informationDatabases in Bioinformatics. Molecular Databases. Molecular Databases. NCBI Databases. BINF 630: Bioinformatics Methods
Databases in Bioinformatics BINF 630: Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu Molecular Databases Molecular Databases Nucleic acid sequences: GenBank, DNA Data Bank of Japan, EMBL
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com
More informationEvolutionary Genetics. LV Lecture with exercises 6KP
Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP HS2017 >What_is_it? AATGATACGGCGACCACCGAGATCTACACNNNTC GTCGGCAGCGTC 2 NCBI MegaBlast search (09/14) 3 NCBI MegaBlast search (09/14) 4 Submitted
More informationDatabases/Resources on the web
Databases/Resources on the web Jon K. Lærdahl jonkl@medisin.uio.no A lot of biological databases available on the web... MetaBase, the database of biological databases (1801 entries) - h p://metadatabase.org
More informationLast Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background
More informationBasic concepts of molecular biology
Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it What is life made of? 1665: Robert Hooke discovered that organisms are composed of individual compartments called cells
More informationBLAST. Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences.
BLAST Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences. An example could be aligning an mrna sequence to genomic DNA. Proteins are frequently composed of
More informationG4120: Introduction to Computational Biology
ICB Fall 2004 G4120: Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Copyright 2004 Oliver Jovanovic, All Rights Reserved. Analysis of Protein Sequences Coding
More informationFrom assembled genome to annotated genome
From assembled genome to annotated genome Procaryotic genomes Eucaryotic genomes Genome annotation servers (web based) 1. RAST 2. NCBI Gene prediction pipeline: Maker Function annotation pipeline: Blast2GO
More informationCFSSP: Chou and Fasman Secondary Structure Prediction server
Wide Spectrum, Vol. 1, No. 9, (2013) pp 15-19 CFSSP: Chou and Fasman Secondary Structure Prediction server T. Ashok Kumar Department of Bioinformatics, Noorul Islam College of Arts and Science, Kumaracoil
More informationAn Introduction to Bioinformatics for Biological Sciences Students
An Introduction to Bioinformatics for Biological Sciences Students Department of Microbiology and Immunology, McGill University Version 2.5 (For the BIOC-300 lab), March 2006 2 AN INTRODUCTION TO BIOINFORMATICS
More informationWorksheet for Bioinformatics
Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research
More informationWhy study sequence similarity?
Sequence Similarity Why study sequence similarity? Possible indication of common ancestry Similarity of structure implies similar biological function even among apparently distant organisms Example context:
More informationIn 1996, the genome of Saccharomyces cerevisiae was completed due to the work of
Summary: Kellis, M. et al. Nature 423,241-253. Background In 1996, the genome of Saccharomyces cerevisiae was completed due to the work of approximately 600 scientists world-wide. This group of researchers
More informationBiotechnology Explorer
Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual
More informationMARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305
MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What
More information