NANOSCALE MANUFACTURING

Size: px
Start display at page:

Download "NANOSCALE MANUFACTURING"

Transcription

1 NANOSCALE MANUFACTURING From the Bottom Up: DNA Focus Todd Nilsen

2 Overview Current Techniques Lithography Mechanical Stamping Advantages/Disadvantages New Technology Bottom Up Approach Using DNA Protein Basics DNA Basics Molecular Recognition DNA Assisted Assembly BioMolecule Cluster Other Applications Advantages/Drawbacks What To Take Away

3 Lithography Sub 50nm range Above 25nm commercially. Cost is exponentially increasing. Cost to scale is becoming greater than research costs. Using Extreme UV Light Electron Beam

4

5 Mechanical Stamping Can yield feature sizes of 20 40nm. Constructed with Electron Beam Lithography. Cost an issue Very Expensive Molds. Hard to change design.

6 **Solid State Technology Magazine. Sept Electron Beam & Nanoimprint lithography.

7 Advantages/Disadvantages Advantages Mature Technologies Allow for Mass Production Small Feature Sizes Wide Variety of Materials Drawbacks Devices can be much smaller physically Limited to 2 Dimensions Reaching Limitations

8 The Bottom up Approach (Self Assembly Approach) Chemical or Physical Forces at nanoscale. Assembles primary pieces into devices. Many techniques exist DNA Spontaneous Formation Clustered Nanocrystals Carbon Nanotube Growth

9 Lets Talk About DNA Protein 101 All Amino Acids derived from same structure. R group defines the amino acid. Amino acid chains create proteins.

10

11 DNA

12 Real DNA

13 DNA Basics Essentially Intelligent Glue Size 20 Angstroms wide 34 Angstroms for every 360 degrees along axis Composed of Sequences of Base Pairs Adenine(A), Thymine(T), Cytosine(C), Guanine(G) A goes with T and C goes with G When all base pairs of strand match Double Helix

14 Hmmmm We can exploit the concept of base pairing to make specific structures. Lets have a computer generate code for specific strands Synthesize strands in solution, and watch them assemble.

15 Molecular Recognition Specific interactions through non covalent bonding (hydrogen, carbon, electrostatic bonds, electromagnetic effects). Consists of Two Modes Static Recognition Dynamic Recognition

16 Static Recognition One spot for one bond Host sites need to be implemented for a specific guest atom. Occurs because system is seeking equilibrium (reduction in free energy). G = U+pV+TS U = internal energy, p = pressure, V = volume, T = temperature, S = entropy.

17 Dynamic Recognition Two phase reaction Second reaction is based on an initial reaction. First reaction could cause an increase in the association constant within a material for a second guest substance. Source of further research

18 DNA Assisted Assembly Method for connecting separate heterogeneous parts into a single device. DNA will be used as a structural material only. Can be used for complex architectures (especially 3D).

19 DNA Structure

20 DNA Array

21 3D group.mcgill.ca/teaching/nanotechnology

22

23 Other Nano Applications (DNA) DNA Nano Mechanical Devices Bio Applications Stem Loop Controller DNA Logic Gate.

24 Advantages/Disadvantages Advantages Easy to produce large amounts of DNA through synthesis DNA is a nanoscale structure Disadvantages Cost Technology isn t there yet DNA Microarrays have 400 printing steps and cost $500 each

25

26 Future for DNA Production of other DNA like molecules Large 2D and 3D structures DNA nanobots to target specific molecules and locate them accordingly BioApplications Increased device complexity and functions

27 What to Take From Presentation Top down approach is stuck at the 10 25nm range. Integration of these two processes is likely. DNA is a likely candidate for further research. DNA can be built to self assemble devices. Nature is doing these incredibly complex steps all the time, un aided.

28 References Rothemund, Paul W. K. (2006). "Folding DNA to create nanoscale shapes and patterns". Nature 440: doi: /nature ISSN Introduction to Nanoelectronics (2008) Mitin et al. Cambridge Publishing. ISBN Winfree, Erik; Liu, Furong; Wenzler, Lisa A. & Seeman, Nadrian C. (6 August 1998). "Design and self assembly of two dimensional DNA crystals". Nature 394: Mathieu, Frederick; Liao, Shiping; Kopatsch, Jens; Wang, Tong; Mao, Chengde & Seeman, Nadrian C. (April 2005). "Six Helix Bundles Designed from DNA". Nano Letters 5 (4): doi: /nl050084f

29

Investigating Protein Stability with the Optical Tweezer

Investigating Protein Stability with the Optical Tweezer Investigating Protein Stability with the Optical Tweezer I. Introduction. Various experimental and computational techniques have been developed to study the process by which proteins go from a linear sequence

More information

DNA Nanotechnology. Organization: Sciencenter, Ithaca, NY Contact person: Rae Ostman Contact information: x24

DNA Nanotechnology. Organization: Sciencenter, Ithaca, NY Contact person: Rae Ostman Contact information: x24 DNA Nanotechnology General Description Facilitated activity Organization: Sciencenter, Ithaca, NY Contact person: Rae Ostman Contact information: rostman@sciencenter.org 607-272-0600 x24 DNA Nanotechnology

More information

Nanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 50% midterm, 50% final.

Nanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 50% midterm, 50% final. Nanobiotechnology Place: IOP 1 st Meeting Room Time: 9:30-12:00 Reference: Review Papers Grade: 50% midterm, 50% final Midterm: 5/15 History Atom Earth, Air, Water Fire SEM: 20-40 nm Silver 66.2% Gold

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Structural Bioinformatics (C3210) DNA and RNA Structure

Structural Bioinformatics (C3210) DNA and RNA Structure Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit

More information

Chapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.

Chapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc. Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between

More information

Test Prep Pretest. in the. the. whereas prokaryotic DNA contains only replication forks during replication. Skills Worksheet

Test Prep Pretest. in the. the. whereas prokaryotic DNA contains only replication forks during replication. Skills Worksheet Skills Worksheet Test Prep Pretest Complete each statement by writing the correct term or phrase in the space provided. 1. In 1928, Frederick Griffith found that the capsule that enclosed one strain of

More information

All Rights Reserved. U.S. Patents 6,471,520B1; 5,498,190; 5,916, North Market Street, Suite CC130A, Milwaukee, WI 53202

All Rights Reserved. U.S. Patents 6,471,520B1; 5,498,190; 5,916, North Market Street, Suite CC130A, Milwaukee, WI 53202 Secondary Structure In the previous protein folding activity, you created a hypothetical 15-amino acid protein and learned that basic principles of chemistry determine how each protein spontaneously folds

More information

DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.

DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases. DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types

More information

Nanofabrication Prof. Stephen Y. Chou NanoStructure Laboratory

Nanofabrication Prof. Stephen Y. Chou NanoStructure Laboratory Nanofabrication Prof. Stephen Y. Chou Department of Electrical Engineering Princeton University 1 Acknowledgment Dr. Paul Fischer Dr. Yun Wang Dr. Jay Guo Dr. Peter Klauss Dr. Jim Wang Dr. Longtin He Dr.

More information

THE SEARCH FOR THE GENETIC MATERIAL "IF I HAVE SEEN FURTHER, IT IS BY STANDING ON THE SHOULDERS OF GIANTS." ISAAC NEWTON

THE SEARCH FOR THE GENETIC MATERIAL IF I HAVE SEEN FURTHER, IT IS BY STANDING ON THE SHOULDERS OF GIANTS. ISAAC NEWTON THE SEARCH FOR THE GENETIC MATERIAL "IF I HAVE SEEN FURTHER, IT IS BY STANDING ON THE SHOULDERS OF GIANTS." ISAAC NEWTON WHAT WAS KNOWN SO FAR Chromosomes are made up of DNA and protein Protein is the

More information

DNA is the Genetic Material

DNA is the Genetic Material Lecture#1 DNA is the Genetic Material Readings: Griffiths et al (2004) 8th Edition: Chap. 1, 2-4; Chap. 7 pp 227-249 Problems: Chap. 7: 1-25, 26, 27 Genetics has been approached from two directions. Mendel,

More information

Click here to read the case study about protein synthesis.

Click here to read the case study about protein synthesis. Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics

More information

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

More information

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints

More information

CSE : Computational Issues in Molecular Biology. Lecture 19. Spring 2004

CSE : Computational Issues in Molecular Biology. Lecture 19. Spring 2004 CSE 397-497: Computational Issues in Molecular Biology Lecture 19 Spring 2004-1- Protein structure Primary structure of protein is determined by number and order of amino acids within polypeptide chain.

More information

By the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication?

By the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication? Name: Period: Date: KIPP NYC College Prep Genetics and Biotech UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and Intro to Replication By the end of today, you will have an answer to: How can 1 strand

More information

DNA & Protein Synthesis UNIT D & E

DNA & Protein Synthesis UNIT D & E DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

Central Dogma. 1. Human genetic material is represented in the diagram below.

Central Dogma. 1. Human genetic material is represented in the diagram below. Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

DNA Circuits for Analog Computing

DNA Circuits for Analog Computing DNA Circuits for Analog Computing Tianqi Song Department of Computer Science Duke University 1 Outline Motivation What is DNA computing? Why are we interested in DNA computing? What has been done? Why

More information

Pre-Lab: Molecular Biology

Pre-Lab: Molecular Biology Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double

More information

The Structure of DNA

The Structure of DNA Name: The Structure of DNA 06/08/11 Students will turn in: 1. Assignment 1: DNA Worksheet 2. Assignment 2: Poster Draw a poster of the ladder structure of DNA, labeled. 3. Assignment 3: The completed DNA

More information

4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.

4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e. 1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.

More information

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329. Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary

More information

Nucleic Acids and the RNA World. Pages Chapter 4

Nucleic Acids and the RNA World. Pages Chapter 4 Nucleic Acids and the RNA World Pages 74-89 Chapter 4 RNA vs. Protein Chemical Evolution stated that life evolved from a polymer called a protein. HOWEVER, now many scientists question this. There is currently

More information

DNA: The Molecule of Heredity

DNA: The Molecule of Heredity DNA: The Molecule of Heredity STRUCTURE AND FUNCTION - a nucleic acid o C, H, O, N, P o Made of nucleotides = smaller subunits o Components of nucleotides: Deoxyribose (simple sugar) Phosphate group Nitrogen

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

GENETICS الفريق الطبي االكاديمي. DNA Genes & Chromosomes. DONE BY : Buthaina Al-masaeed & Yousef Qandeel. Page 0

GENETICS الفريق الطبي االكاديمي. DNA Genes & Chromosomes. DONE BY : Buthaina Al-masaeed & Yousef Qandeel. Page 0 GENETICS ومن أحياها DNA Genes & Chromosomes الفريق الطبي االكاديمي DNA Genes & Chromosomes DONE BY : Buthaina Al-masaeed & Yousef Qandeel Page 0 T(0:44 min) In the pre lecture we take about the back bone

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Molecular Biology I: DNA Replication

Molecular Biology I: DNA Replication Molecular Biology I: DNA Replication Learning Goals: To work with a physical model of DNA in order to help you to understand: o rules for DNA structure o base-pairing o DNA replication Introduction: In

More information

How Do You Clone a Gene?

How Do You Clone a Gene? S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction RNA Secondary Structure Prediction Outline 1) Introduction: RNA structure basics 2) Dynamic programming for RNA secondary structure prediction The Central Dogma of Molecular Biology DNA CCTGAGCCAACTATTGATGAA

More information

Name: SID: ( ) MIDTERM EXAMINATION (October 7, 2014) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Fall Semester, 2014

Name: SID: ( ) MIDTERM EXAMINATION (October 7, 2014) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Fall Semester, 2014 MIDTERM EXAMINATION (October 7, 2014) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Fall Semester, 2014 0. Write down your name and the last 4 digits of your SID on all the pages (1) 1.

More information

Nanotechnology for Molecular and Cellular Manipulation

Nanotechnology for Molecular and Cellular Manipulation Nanotechnology for Molecular and Cellular Manipulation Logan Liu Micro and Nano Technology Lab Department of Electrical & Computer Engineering University of Illinois Physical Systems Nano vs. Bio Micro

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function

More information

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs. DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,

More information

The Molecular Basis of Inheritance

The Molecular Basis of Inheritance The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;

More information

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic

More information

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28

More information

Friedrich Miescher (1869) Isolated nucleic acids from the nuclei of white blood cells

Friedrich Miescher (1869) Isolated nucleic acids from the nuclei of white blood cells Friedrich Miescher (1869) Isolated nucleic acids from the nuclei of white blood cells Collected pus from local hospital bandages After further examination he discovered a substance that he called Nuclein

More information

STUDY GUIDE SECTION 10-1 Discovery of DNA

STUDY GUIDE SECTION 10-1 Discovery of DNA STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has

More information

Superionic Solid State Stamping (S4)

Superionic Solid State Stamping (S4) Superionic Solid State Stamping (S4) Lead Faculty Researcher: Placid Ferreira Department: Materials Science & Engineering Hsu et al, Nano Letters, 2007 1. Description: This dry, single step, electrochemical

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006

90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006 90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006 8 RNA Secondary Structure Sources for this lecture: R. Durbin, S. Eddy, A. Krogh und G. Mitchison. Biological sequence analysis,

More information

Genome Architecture Structural Subdivisons

Genome Architecture Structural Subdivisons Lecture 4 Hierarchical Organization of the Genome by John R. Finnerty Genome Architecture Structural Subdivisons 1. Nucleotide : monomer building block of DNA 2. DNA : polymer string of nucleotides 3.

More information

Biochemistry study of the molecular basis of life

Biochemistry study of the molecular basis of life Biochemistry : An Introduction Biochemistry study of the molecular basis of life n Study of the chemistry of living organisms Studies organic molecules & organic reactions in living organisms n Living

More information

DNA Replication and Protein Synthesis

DNA Replication and Protein Synthesis DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

DNA. The Rise of the. Nanorobots. When designed properly, DNA folds into tiny devices that move like macroscopic machines.

DNA. The Rise of the. Nanorobots. When designed properly, DNA folds into tiny devices that move like macroscopic machines. The Rise of the DNA Nanorobots When designed properly, DNA folds into tiny devices that move like macroscopic machines. MECHANICAL ENGINEERING AUGUST 2016 P.45 Throughout the patient s body, the tiny robots

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

DNA: Structure and Replication - 1

DNA: Structure and Replication - 1 DNA: Structure and Replication - 1 We have briefly discussed that DNA is the genetic molecule of life. In eukaryotic organisms DNA (along with its histone proteins) is found in chromosomes. All cell activities

More information

Brief History. Many people contributed to our understanding of DNA

Brief History. Many people contributed to our understanding of DNA DNA (Ch. 16) Brief History Many people contributed to our understanding of DNA T.H. Morgan (1908) Frederick Griffith (1928) Avery, McCarty & MacLeod (1944) Erwin Chargaff (1947) Hershey & Chase (1952)

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

From Gene to Protein Transcription and Translation

From Gene to Protein Transcription and Translation Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism

More information

THE COMPONENTS & STRUCTURE OF DNA

THE COMPONENTS & STRUCTURE OF DNA THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Final exam. Please write your name on the exam and keep an ID card ready.

Final exam. Please write your name on the exam and keep an ID card ready. Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an

More information

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

6- Important Molecules of Living Systems. Proteins Nucleic Acids Taft College Human Physiology

6- Important Molecules of Living Systems. Proteins Nucleic Acids Taft College Human Physiology 6- Important Molecules of Living Systems Proteins Nucleic Acids Taft College Human Physiology Proteins Proteins- made from: C, H, O, N, and S. Proteins are very large molecules composed of long chains

More information

Nucleic Acids, Proteins, and Enzymes

Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

DNA is a nucleic acid which acts as molecular repository for all genetic information

DNA is a nucleic acid which acts as molecular repository for all genetic information FLOW OF INFORMATION DNA is a nucleic acid which acts as molecular repository for all genetic information Chemically, DNA is a long polymer of simple units called nucleotides, with a backbone made of sugars

More information

DNA Replication AP Biology

DNA Replication AP Biology DNA Replication 2007-2008 Watson and Crick 1953 article in Nature Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

DNA & Protein Synthesis #21

DNA & Protein Synthesis #21 Name: Period: Date: Living Environment Lab DNA & Protein Synthesis #21 Introduction Of all the molecules that is in the body, DNA is perhaps the most important. DNA or dioxiribosenucleic acid is important

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

Replication. Obaidur Rahman

Replication. Obaidur Rahman Replication Obaidur Rahman DIRCTION OF DNA SYNTHESIS How many reactions can a DNA polymerase catalyze? So how many reactions can it catalyze? So 4 is one answer, right, 1 for each nucleotide. But what

More information

FY06 ACCOMPLISHMENTS. Nanoelectronics Manufacture, Inspection, and Repair using Thermal Dip Pen Nanolithography

FY06 ACCOMPLISHMENTS. Nanoelectronics Manufacture, Inspection, and Repair using Thermal Dip Pen Nanolithography FY06 ACCOMPLISHMENTS Nanoelectronics Manufacture, Inspection, and Repair using Thermal Dip Pen Nanolithography William P. King Georiga Institute of Technology FY06 was the second year of this grant, and

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase

Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)

More information

The replication of DNA Kornberg 1957 Meselson and Stahl 1958 Cairns 1963 Okazaki 1968 DNA Replication The driving force for DNA synthesis. The addition of a nucleotide to a growing polynucleotide

More information

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.

DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand. DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose

More information

What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function

What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction

More information

DNA- THE MOLECULE OF LIFE. Link

DNA- THE MOLECULE OF LIFE. Link DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,

More information

Storage and Expression of Genetic Information

Storage and Expression of Genetic Information Storage and Expression of Genetic Information 29. DNA structure, Replication and Repair ->Ch 25. DNA metabolism 30. RNA Structure, Synthesis and Processing ->Ch 26. RNA metabolism 31. Protein Synthesis

More information

DNA Transcription. Visualizing Transcription. The Transcription Process

DNA Transcription. Visualizing Transcription. The Transcription Process DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription

More information