NANOSCALE MANUFACTURING
|
|
- Ferdinand Horn
- 6 years ago
- Views:
Transcription
1 NANOSCALE MANUFACTURING From the Bottom Up: DNA Focus Todd Nilsen
2 Overview Current Techniques Lithography Mechanical Stamping Advantages/Disadvantages New Technology Bottom Up Approach Using DNA Protein Basics DNA Basics Molecular Recognition DNA Assisted Assembly BioMolecule Cluster Other Applications Advantages/Drawbacks What To Take Away
3 Lithography Sub 50nm range Above 25nm commercially. Cost is exponentially increasing. Cost to scale is becoming greater than research costs. Using Extreme UV Light Electron Beam
4
5 Mechanical Stamping Can yield feature sizes of 20 40nm. Constructed with Electron Beam Lithography. Cost an issue Very Expensive Molds. Hard to change design.
6 **Solid State Technology Magazine. Sept Electron Beam & Nanoimprint lithography.
7 Advantages/Disadvantages Advantages Mature Technologies Allow for Mass Production Small Feature Sizes Wide Variety of Materials Drawbacks Devices can be much smaller physically Limited to 2 Dimensions Reaching Limitations
8 The Bottom up Approach (Self Assembly Approach) Chemical or Physical Forces at nanoscale. Assembles primary pieces into devices. Many techniques exist DNA Spontaneous Formation Clustered Nanocrystals Carbon Nanotube Growth
9 Lets Talk About DNA Protein 101 All Amino Acids derived from same structure. R group defines the amino acid. Amino acid chains create proteins.
10
11 DNA
12 Real DNA
13 DNA Basics Essentially Intelligent Glue Size 20 Angstroms wide 34 Angstroms for every 360 degrees along axis Composed of Sequences of Base Pairs Adenine(A), Thymine(T), Cytosine(C), Guanine(G) A goes with T and C goes with G When all base pairs of strand match Double Helix
14 Hmmmm We can exploit the concept of base pairing to make specific structures. Lets have a computer generate code for specific strands Synthesize strands in solution, and watch them assemble.
15 Molecular Recognition Specific interactions through non covalent bonding (hydrogen, carbon, electrostatic bonds, electromagnetic effects). Consists of Two Modes Static Recognition Dynamic Recognition
16 Static Recognition One spot for one bond Host sites need to be implemented for a specific guest atom. Occurs because system is seeking equilibrium (reduction in free energy). G = U+pV+TS U = internal energy, p = pressure, V = volume, T = temperature, S = entropy.
17 Dynamic Recognition Two phase reaction Second reaction is based on an initial reaction. First reaction could cause an increase in the association constant within a material for a second guest substance. Source of further research
18 DNA Assisted Assembly Method for connecting separate heterogeneous parts into a single device. DNA will be used as a structural material only. Can be used for complex architectures (especially 3D).
19 DNA Structure
20 DNA Array
21 3D group.mcgill.ca/teaching/nanotechnology
22
23 Other Nano Applications (DNA) DNA Nano Mechanical Devices Bio Applications Stem Loop Controller DNA Logic Gate.
24 Advantages/Disadvantages Advantages Easy to produce large amounts of DNA through synthesis DNA is a nanoscale structure Disadvantages Cost Technology isn t there yet DNA Microarrays have 400 printing steps and cost $500 each
25
26 Future for DNA Production of other DNA like molecules Large 2D and 3D structures DNA nanobots to target specific molecules and locate them accordingly BioApplications Increased device complexity and functions
27 What to Take From Presentation Top down approach is stuck at the 10 25nm range. Integration of these two processes is likely. DNA is a likely candidate for further research. DNA can be built to self assemble devices. Nature is doing these incredibly complex steps all the time, un aided.
28 References Rothemund, Paul W. K. (2006). "Folding DNA to create nanoscale shapes and patterns". Nature 440: doi: /nature ISSN Introduction to Nanoelectronics (2008) Mitin et al. Cambridge Publishing. ISBN Winfree, Erik; Liu, Furong; Wenzler, Lisa A. & Seeman, Nadrian C. (6 August 1998). "Design and self assembly of two dimensional DNA crystals". Nature 394: Mathieu, Frederick; Liao, Shiping; Kopatsch, Jens; Wang, Tong; Mao, Chengde & Seeman, Nadrian C. (April 2005). "Six Helix Bundles Designed from DNA". Nano Letters 5 (4): doi: /nl050084f
29
Investigating Protein Stability with the Optical Tweezer
Investigating Protein Stability with the Optical Tweezer I. Introduction. Various experimental and computational techniques have been developed to study the process by which proteins go from a linear sequence
More informationDNA Nanotechnology. Organization: Sciencenter, Ithaca, NY Contact person: Rae Ostman Contact information: x24
DNA Nanotechnology General Description Facilitated activity Organization: Sciencenter, Ithaca, NY Contact person: Rae Ostman Contact information: rostman@sciencenter.org 607-272-0600 x24 DNA Nanotechnology
More informationNanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 50% midterm, 50% final.
Nanobiotechnology Place: IOP 1 st Meeting Room Time: 9:30-12:00 Reference: Review Papers Grade: 50% midterm, 50% final Midterm: 5/15 History Atom Earth, Air, Water Fire SEM: 20-40 nm Silver 66.2% Gold
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationStructural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
More informationChapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.
Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationDNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
More informationTest Prep Pretest. in the. the. whereas prokaryotic DNA contains only replication forks during replication. Skills Worksheet
Skills Worksheet Test Prep Pretest Complete each statement by writing the correct term or phrase in the space provided. 1. In 1928, Frederick Griffith found that the capsule that enclosed one strain of
More informationAll Rights Reserved. U.S. Patents 6,471,520B1; 5,498,190; 5,916, North Market Street, Suite CC130A, Milwaukee, WI 53202
Secondary Structure In the previous protein folding activity, you created a hypothetical 15-amino acid protein and learned that basic principles of chemistry determine how each protein spontaneously folds
More informationDNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
More informationNanofabrication Prof. Stephen Y. Chou NanoStructure Laboratory
Nanofabrication Prof. Stephen Y. Chou Department of Electrical Engineering Princeton University 1 Acknowledgment Dr. Paul Fischer Dr. Yun Wang Dr. Jay Guo Dr. Peter Klauss Dr. Jim Wang Dr. Longtin He Dr.
More informationTHE SEARCH FOR THE GENETIC MATERIAL "IF I HAVE SEEN FURTHER, IT IS BY STANDING ON THE SHOULDERS OF GIANTS." ISAAC NEWTON
THE SEARCH FOR THE GENETIC MATERIAL "IF I HAVE SEEN FURTHER, IT IS BY STANDING ON THE SHOULDERS OF GIANTS." ISAAC NEWTON WHAT WAS KNOWN SO FAR Chromosomes are made up of DNA and protein Protein is the
More informationDNA is the Genetic Material
Lecture#1 DNA is the Genetic Material Readings: Griffiths et al (2004) 8th Edition: Chap. 1, 2-4; Chap. 7 pp 227-249 Problems: Chap. 7: 1-25, 26, 27 Genetics has been approached from two directions. Mendel,
More informationClick here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
More informationCHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More informationLecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
More informationCSE : Computational Issues in Molecular Biology. Lecture 19. Spring 2004
CSE 397-497: Computational Issues in Molecular Biology Lecture 19 Spring 2004-1- Protein structure Primary structure of protein is determined by number and order of amino acids within polypeptide chain.
More informationBy the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication?
Name: Period: Date: KIPP NYC College Prep Genetics and Biotech UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and Intro to Replication By the end of today, you will have an answer to: How can 1 strand
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationCentral Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationDNA Circuits for Analog Computing
DNA Circuits for Analog Computing Tianqi Song Department of Computer Science Duke University 1 Outline Motivation What is DNA computing? Why are we interested in DNA computing? What has been done? Why
More informationPre-Lab: Molecular Biology
Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double
More informationThe Structure of DNA
Name: The Structure of DNA 06/08/11 Students will turn in: 1. Assignment 1: DNA Worksheet 2. Assignment 2: Poster Draw a poster of the ladder structure of DNA, labeled. 3. Assignment 3: The completed DNA
More information4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.
1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.
More informationLecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary
More informationNucleic Acids and the RNA World. Pages Chapter 4
Nucleic Acids and the RNA World Pages 74-89 Chapter 4 RNA vs. Protein Chemical Evolution stated that life evolved from a polymer called a protein. HOWEVER, now many scientists question this. There is currently
More informationDNA: The Molecule of Heredity
DNA: The Molecule of Heredity STRUCTURE AND FUNCTION - a nucleic acid o C, H, O, N, P o Made of nucleotides = smaller subunits o Components of nucleotides: Deoxyribose (simple sugar) Phosphate group Nitrogen
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationGENETICS الفريق الطبي االكاديمي. DNA Genes & Chromosomes. DONE BY : Buthaina Al-masaeed & Yousef Qandeel. Page 0
GENETICS ومن أحياها DNA Genes & Chromosomes الفريق الطبي االكاديمي DNA Genes & Chromosomes DONE BY : Buthaina Al-masaeed & Yousef Qandeel Page 0 T(0:44 min) In the pre lecture we take about the back bone
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationMolecular Biology I: DNA Replication
Molecular Biology I: DNA Replication Learning Goals: To work with a physical model of DNA in order to help you to understand: o rules for DNA structure o base-pairing o DNA replication Introduction: In
More informationHow Do You Clone a Gene?
S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationRNA Secondary Structure Prediction
RNA Secondary Structure Prediction Outline 1) Introduction: RNA structure basics 2) Dynamic programming for RNA secondary structure prediction The Central Dogma of Molecular Biology DNA CCTGAGCCAACTATTGATGAA
More informationName: SID: ( ) MIDTERM EXAMINATION (October 7, 2014) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Fall Semester, 2014
MIDTERM EXAMINATION (October 7, 2014) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Fall Semester, 2014 0. Write down your name and the last 4 digits of your SID on all the pages (1) 1.
More informationNanotechnology for Molecular and Cellular Manipulation
Nanotechnology for Molecular and Cellular Manipulation Logan Liu Micro and Nano Technology Lab Department of Electrical & Computer Engineering University of Illinois Physical Systems Nano vs. Bio Micro
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationDNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
More informationThe Molecular Basis of Inheritance
The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;
More informationThe Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines
DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic
More informationNON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28
More informationFriedrich Miescher (1869) Isolated nucleic acids from the nuclei of white blood cells
Friedrich Miescher (1869) Isolated nucleic acids from the nuclei of white blood cells Collected pus from local hospital bandages After further examination he discovered a substance that he called Nuclein
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationSuperionic Solid State Stamping (S4)
Superionic Solid State Stamping (S4) Lead Faculty Researcher: Placid Ferreira Department: Materials Science & Engineering Hsu et al, Nano Letters, 2007 1. Description: This dry, single step, electrochemical
More informationNucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More information90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006
90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006 8 RNA Secondary Structure Sources for this lecture: R. Durbin, S. Eddy, A. Krogh und G. Mitchison. Biological sequence analysis,
More informationGenome Architecture Structural Subdivisons
Lecture 4 Hierarchical Organization of the Genome by John R. Finnerty Genome Architecture Structural Subdivisons 1. Nucleotide : monomer building block of DNA 2. DNA : polymer string of nucleotides 3.
More informationBiochemistry study of the molecular basis of life
Biochemistry : An Introduction Biochemistry study of the molecular basis of life n Study of the chemistry of living organisms Studies organic molecules & organic reactions in living organisms n Living
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationDNA. The Rise of the. Nanorobots. When designed properly, DNA folds into tiny devices that move like macroscopic machines.
The Rise of the DNA Nanorobots When designed properly, DNA folds into tiny devices that move like macroscopic machines. MECHANICAL ENGINEERING AUGUST 2016 P.45 Throughout the patient s body, the tiny robots
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationDNA: Structure and Replication - 1
DNA: Structure and Replication - 1 We have briefly discussed that DNA is the genetic molecule of life. In eukaryotic organisms DNA (along with its histone proteins) is found in chromosomes. All cell activities
More informationBrief History. Many people contributed to our understanding of DNA
DNA (Ch. 16) Brief History Many people contributed to our understanding of DNA T.H. Morgan (1908) Frederick Griffith (1928) Avery, McCarty & MacLeod (1944) Erwin Chargaff (1947) Hershey & Chase (1952)
More informationNucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationFrom Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
More informationTHE COMPONENTS & STRUCTURE OF DNA
THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationFinal exam. Please write your name on the exam and keep an ID card ready.
Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an
More informationChapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs
Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More information6- Important Molecules of Living Systems. Proteins Nucleic Acids Taft College Human Physiology
6- Important Molecules of Living Systems Proteins Nucleic Acids Taft College Human Physiology Proteins Proteins- made from: C, H, O, N, and S. Proteins are very large molecules composed of long chains
More informationNucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
More informationDNA is a nucleic acid which acts as molecular repository for all genetic information
FLOW OF INFORMATION DNA is a nucleic acid which acts as molecular repository for all genetic information Chemically, DNA is a long polymer of simple units called nucleotides, with a backbone made of sugars
More informationDNA Replication AP Biology
DNA Replication 2007-2008 Watson and Crick 1953 article in Nature Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationDNA & Protein Synthesis #21
Name: Period: Date: Living Environment Lab DNA & Protein Synthesis #21 Introduction Of all the molecules that is in the body, DNA is perhaps the most important. DNA or dioxiribosenucleic acid is important
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationReplication. Obaidur Rahman
Replication Obaidur Rahman DIRCTION OF DNA SYNTHESIS How many reactions can a DNA polymerase catalyze? So how many reactions can it catalyze? So 4 is one answer, right, 1 for each nucleotide. But what
More informationFY06 ACCOMPLISHMENTS. Nanoelectronics Manufacture, Inspection, and Repair using Thermal Dip Pen Nanolithography
FY06 ACCOMPLISHMENTS Nanoelectronics Manufacture, Inspection, and Repair using Thermal Dip Pen Nanolithography William P. King Georiga Institute of Technology FY06 was the second year of this grant, and
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationVocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase
DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)
More informationThe replication of DNA Kornberg 1957 Meselson and Stahl 1958 Cairns 1963 Okazaki 1968 DNA Replication The driving force for DNA synthesis. The addition of a nucleotide to a growing polynucleotide
More informationGenes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology
Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationDNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.
DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose
More informationWhat is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationThe Central Dogma of Molecular Biology
The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction
More informationDNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationStorage and Expression of Genetic Information
Storage and Expression of Genetic Information 29. DNA structure, Replication and Repair ->Ch 25. DNA metabolism 30. RNA Structure, Synthesis and Processing ->Ch 26. RNA metabolism 31. Protein Synthesis
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More information