Chapter 2 The Structure of Genes and Genomes. Electron micrograph of a metaphase chromosome
|
|
- Brook Marsh
- 6 years ago
- Views:
Transcription
1 Chapter 2 The Structure of Genes and Genomes Electron micrograph of a metaphase chromosome
2 Genetic information is stored in double stranded DNA
3 DNA structure, building blocks: (A) Bases
4 DNA structure, building blocks: (B) Pentose sugars
5 DNA structure, building blocks: (C) A ribonucleotide
6 A single stranded DNA (ssdna) chain Representations of DNA
7 The structure of DNA was solved by Watson and Crick 1953
8 minor groove major groove
9 DNA Units of measurement base pair (bp) or nucleotide (nt) kilobase (1kb) megabase (1Mb) Replication: each strand serves as template for synthesis of complement, using rules of base pairing Information: specified by sequence of nucleotides; may be copied into RNA Mutation: replacement, insertion, deletion of nucleotides results in altered sequence
10 dsdna Wasserstoffdonor N - H O δ - δ + δ - Wasserstoffacceptor
11 Sequence specific DNA recognition occurs predominantly via the major groove
12 Generalized eukaryotic gene structure
13 Genome sizes of various organisms
14
15 25,000
16 Arabidopsis Fritillaria times more DNA
17 Genomes Viruses: Prokaryotes: Mitochondria: Chloroplasts: Eukaryontes: DNA, RNA, single and double stranded DNA, mostly circular circular DNA circular DNA Chromosomes with linear DNA
18 Electron micrographs of small genomes: plasmids
19 Electron micrographs of the E. coli genome
20 Prokaryotic genome Usually circular double helix occupies nucleoid region of cell attached to plasma membrane Genes are close together with little intergenic spacer Operon tandem cluster of coordinately regulated genes transcribed as single mrna Introns very rare
21 Eukaryotic Genomes Eukarotic species are haploid or diploid 1n or 2n n = haploid chromosome number Plants are often polyploid
22
23 Visible chromosomal landmarks a) Chromosome size
24 Human chromosomes
25 Visible chromosomal landmarks c) Position of nucleolar organizer A maize microsporocyte nucleus at pachytene stage, showing the 10 chromosomes and the nucleolus.
26 photograph interpretation Chromosome 2 of tomato, showing the nucleolus and the nucleolar organizer
27 The function of the nucleolus in ribosome (and other ribonucleoprotein) synthesis.
28 Message Nucleoli are spherical structures found associated with constrictions of the chromosomes called nucleolar organizers (NO). NOs contain numerous tandem copies of the genes that code for ribosomal RNA. rrna is synthesized in the NO, deposited in the nucleolus, then assembled and matured, and finally transported to the cytoplasm.
29 Visible chromosomal landmarks d) Heterochromatin patterns
30 Message Densley staining regions of chromosomes are called heterochromatin and reflect a high degree of compactness; poorly staining regions are called euchromatin and indicate less tightly packed regions. Most of the active genes are in euchromatin.
31 Eukaryotic chromosomes Heterochromatin densely stained regions of highly compact DNA mostly repetitive sequences Euchromatin: poorly stained, less compact, contains transcribed genes Banding patterns (metaphase chromosomes) differential uptake of dyes G bands, Giemsa stain (A/T rich) R bands, reverse of Giemsa (G/C rich) Polytene chromosomes replicated, unseparated chromosomes present in certain tissues of dipteran insects
32 The structure of chromosomes What is the best way to efficiently pack DNA? 2m of human DNA are packed into 46 chromosomes inside a nucleus of 6x10-6 m The most famous ball of twine resides in Darwin, Minnesota. This behemoth weighs in at 17,400 lbs. and measures 12 feet in diameter. This monument is the lifework of a Mr. Francis A. Johnson, who began work on the twine ball in March of Mr. Johnson dedicated his life to the construction of that twine ball. In fact, Mr. Johnson labored on the twine ball for the next 39 years until his death in 1989.
33 What is the best way to efficiently pack DNA? 2m of human DNA are packed into 46 chromosomes inside a nucleus of 6x10-6 m nucleosomes
34 Regulated chromatin folding directs gene expression A parsimonious model illustrating the transition from a 10-nm "beads-ona-string" open chromatin formation to the next level of chromatin organization: the compacted 30-nm chromatin fiber. Depicted is one possible form of the chromatin fiber produced by a "two-start helix." Folding or unfolding of the chromatin fiber affects the accessibility of DNA to regulatory factors, which control gene expression. Whereas gene silencing factors such as the PCC complex, HP1, and H1 stabilize higher order chromatin folding, gene activators such as the SWI/SNF remodeling complexes and histone acetyl transferases (HATS) initiate chromatin unfolding. Mohod-Sarip, Verrijzer, Science (2004) 306, 1484
35 Nucleosome Arrays Reveal the Two-Start Organization of the Chromatin Fibre Dorigo et al, Science (2004), 306,1571 possible structures Models for the DNA path in the chromatin fiber. Higher order structure models: (A) one-start solenoidal, (B) two-start supercoiled, and (C) two-start twisted. Upper views have the fiber axis running vertically; lower views are down the fiber axis. DNA associated with the nucleosome core is red/blue, and linker DNA running between cores is yellow. These models are idealized, with nucleosome cores in each start contacting each other. The open threedimensional zigzag seen in conditions not fully compacting may be a precursor.
36 Model of a nucleosome, the DNA is wrapped twice around a histone octamer
37 The Nucleosome is stabilized by histone H1.
38 Message A nucleosome consists of DNA wrapped arround an octamer of histone proteins made up of two tetramers, each consisting of H2A, H2B, H3, and H4. A bp spacer intervenes between adjacent nucleosomes. An additional histone, H1, binds outside the nucleosome core; one of its function is to stabilize both the nucleosome array and higher order chromatin structures.
39 Model for chromosome structure The solenoid loops attach to a central scaffold. The scaffold plus loops arrange into a giant supercoil.
40 Scaffold attachment regions (SARs).
41 Modifications of chromatin (= protein and DNA) can influence gene activity by influencing euchromation/heterochromation structure Chromatin remodelling
42 Modification of histones in chromatin affects DNA accessibility Histones can be modified by actetyl transferases and deacetylases to influence the degree of chromatin condensation.
43 Histone Modifications Chromatin chemistry. Chemical modifications - acetylation (Ac) or methylation (Me) - of histone proteins determine whether genes on the surrounding DNA are active. HP1 is a transcription-inhibiting protein.
44 Message In eukaryotic chromosomes histon acetylations correlates with active euchromatin. The histones in condensed heterochromatin are methylated.
45 DNA methylation affects gene expression and developmental regulation Message Many eukaryotic genes exhibit a strong inverse correlation between density of DNA methylation and transcriptional activity. In eukaryotes the 5 position of cytosin is methylated.
46 Cytosine methylation H 3 C
47 CpG-islands Cytosines found in CpG or CpNpG context are possible substrates for methylation. Often CpG-islands occur upstream of promoters. C-methylation is counter selected because it favours C to T mutation by oxidative deamination.
48 Cytosine methylation and inheritance of methylation patterns
NUCLEUS. Fig. 2. Various stages in the condensation of chromatin
NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules
More informationPlant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter
Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1 Learning Objectives 1. List and explain how DNA
More informationDNA AND CHROMOSOMES. Genetica per Scienze Naturali a.a prof S. Presciuttini
DNA AND CHROMOSOMES This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. The Building Blocks
More informationGenes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology
Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may
More informationChapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".
Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope
More informationY1 Biology 131 Syllabus - Academic Year
Y1 Biology 131 Syllabus - Academic Year 2016-2017 Monday 28/11/2016 DNA Packaging Week 11 Tuesday 29/11/2016 Regulation of gene expression Wednesday 22/9/2014 Cell cycle Sunday 4/12/2016 Tutorial Monday
More informationChapter 5 DNA and Chromosomes
Chapter 5 DNA and Chromosomes DNA as the genetic material Heat-killed bacteria can transform living cells S Smooth R Rough Fred Griffith, 1920 DNA is the genetic material Oswald Avery Colin MacLeod Maclyn
More informationCell Nucleus. Chen Li. Department of Cellular and Genetic Medicine
Cell Nucleus Chen Li Department of Cellular and Genetic Medicine 13 223 chenli2008@fudan.edu.cn Outline A. Historical background B. Structure of the nucleus: nuclear pore complex (NPC), lamina, nucleolus,
More informationDNA: The Genetic Material. Chapter 10
DNA: The Genetic Material Chapter 10 DNA as the Genetic Material DNA was first extracted from nuclei in 1870 named nuclein after their source. Chemical analysis determined that DNA was a weak acid rich
More informationChromatin. Structure and modification of chromatin. Chromatin domains
Chromatin Structure and modification of chromatin Chromatin domains 2 DNA consensus 5 3 3 DNA DNA 4 RNA 5 ss RNA forms secondary structures with ds hairpins ds forms 6 of nucleic acids Form coiling bp/turn
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationNUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
More informationLecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics
Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Epigenetics represents the science for the studying heritable
More information6.2 Chromatin is divided into euchromatin and heterochromatin
6.2 Chromatin is divided into euchromatin and heterochromatin Individual chromosomes can be seen only during mitosis. During interphase, the general mass of chromatin is in the form of euchromatin. Euchromatin
More informationChromatin Structure and its Effects on Transcription
Chromatin Structure and its Effects on Transcription Epigenetics 2014 by Nigel Atkinson The University of Texas at Austin From Weaver 4th edition and Armstrong 1st edition What is the point? DNA is not
More informationOverview of Human Genetics
Overview of Human Genetics 1 Structure and function of nucleic acids. 2 Structure and composition of the human genome. 3 Mendelian genetics. Lander et al. (Nature, 2001) MAT 394 (ASU) Human Genetics Spring
More informationHow can something so small cause problems so large?
How can something so small cause problems so large? Objectives Identify the structural components of DNA and relate to its function Create and ask questions about a model of DNA DNA is made of genes. Gene
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationNucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.
BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid
More information12 2 Chromosomes and DNA Replication
DNA Replication 12-2 Chromosomes and 1 of 21 DNA and Chromosomes DNA and Chromosomes In prokaryotic cells, DNA is located in the cytoplasm. Most prokaryotes have a single DNA molecule containing nearly
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationEpigenetics. Medical studies in English, Lecture # 12,
Epigenetics Medical studies in English, 2018. Lecture # 12, Epigenetics Regulation of gene activity in eukaryotes Correlation of chromatin structure with transcription stably heritable phenotype resulting
More informationStructure of nucleic acids II Biochemistry 302. January 20, 2006
Structure of nucleic acids II Biochemistry 302 January 20, 2006 Intrinsic structural flexibility of RNA antiparallel A-form Fig. 4.19 High Temp Denaturants In vivo conditions Base stacking w/o base pairing/h-bonds
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationGenetics Biology 331 Exam 3B Spring 2015
Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationGenome Architecture Structural Subdivisons
Lecture 4 Hierarchical Organization of the Genome by John R. Finnerty Genome Architecture Structural Subdivisons 1. Nucleotide : monomer building block of DNA 2. DNA : polymer string of nucleotides 3.
More information3.1.5 Nucleic Acids Structure of DNA and RNA
alevelbiology.co.uk 3.1.5 Nucleic Acids 3.1.5.1 Structure of DNA and RNA SPECIFICATION Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are important information-carrying molecules. In all living
More information14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION
14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION Chapter Outline 14.1 ESTABLISHING DNA AS THE HEREDITARY MOLECULE Experiments began when Griffith found a substance that could genetically transform pneumonia
More informationEUKARYOTIC GENE CONTROL
EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationChapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationEssential Questions. DNA: The Genetic Material. Copyright McGraw-Hill Education
Essential Questions Which experiments led to the discovery of DNA as the genetic material? What is the basic structure of DNA? What is the basic structure of eukaryotic chromosomes? Vocabulary Review nucleic
More informationOverview: Life s Operating Instructions Concept 16.1: DNA is the genetic material The Search for the Genetic Material: Scientific Inquiry
Overview: Life s Operating Instructions In 1953, James Watson and Francis Crick introduced an elegant double-helical model for the structure of deoxyribonucleic acid, or DNA DNA, the substance of inheritance,
More informationBCMB Nucleic Acids - Chapter 33. DNA is the genetic component of life
BCMB 3100 - Nucleic Acids - Chapter 33 Discovery of DNA Nucleotides, nucleosides & bases Polynucleotides DNA as genetic material Structure of double-stranded DNA Chromatin RNA Nucleases 1 DNA is the genetic
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationWednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
More informationStructure of nucleic acids II Biochemistry 302. Bob Kelm January 21, 2005
Structure of nucleic acids II Biochemistry 302 Bob Kelm January 21, 2005 http://biochem.uvm.edu/courses/kelm/302 User: student PW: nucleicacid Secondary structure of RNAs antiparallel A-form Fig. 4.19
More informationGene Expression and Heritable Phenotype. CBS520 Eric Nabity
Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.
More informationDNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
More informationTypes of nucleic acid
RNA STRUCTURE 1 Types of nucleic acid DNA Deoxyribonucleic acid RNA ribonucleic acid HOCH 2 O OH HOCH 2 O OH OH OH OH (no O) ribose deoxyribose 2 Nucleic acids consist of repeating nucleotide that have
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationNCERT MULTIPLE-CHOICE QUESTIONS
36 BIOLOGY, EXEMPLAR PROBLEMS CHAPTER 6 MOLECULAR BASIS OF INHERITANCE MULTIPLE-CHOICE QUESTIONS 1. In a DNA strand the nucleotides are linked together by: a. glycosidic bonds b. phosphodiester bonds c.
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationThe discovery that DNA is the genetic code involved many experiments.
Section 1: The discovery that DNA is the genetic code involved many experiments. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review nucleic acid New double helix nucleosome Discovery
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationChapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationThe Molecular Basis of Inheritance
The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationCHAPTER 13 LECTURE SLIDES
CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationNucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
More informationBiology Lecture 2 Genes
Genes Definitions o Gene: DNA that codes for a single polypeptide/mrna/rrna/trna o Euchromatin: region of DNA containing genes being actively transcribed o Heterochromatin: region of DNA containing genes
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More informationThe DNA Molecule: The Molecular Basis of Inheritance
Slide hapter 6 he DN Molecule: he Molecular Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil ampbell and Jane Reece Lectures by hris Romero, updated by Erin Barley
More informationLecture 1 Introduction. Human genetics, its goals and role in modern medicine. Nuclear and mitochondrial genomes.
Lecture 1 Introduction. Human genetics, its goals and role in modern medicine. Nuclear and mitochondrial genomes. 1. Introduction into human genetics. 2. Methods of studying in human genetics. 3. Levels
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationTHE CELLULAR AND MOLECULAR BASIS OF INHERITANCE
Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationMolecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology
Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Question No. 1 of 10 1. Which statement describes how an organism is organized from most simple to most complex? Question
More information12-1 DNA The Structure of DNA (Pages )
12-1 DNA The Structure of DNA (Pages 291-294) The Components and Structure of DNA You might think that knowing genes were made of DNA would have satisfied scientists, but that was not the case at all.
More informationnucleolus nucleus number proteins ribosomes type
Name Use with textbook pages 123 129 Inside the nucleus Cloze Activity Section 41 Vocabulary 23 46 chromosomes DNA genes genetic molecule nucleolus nucleus number proteins ribosomes type Use the terms
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationGenes found in the genome include protein-coding genes and non-coding RNA genes. Which nucleotide is not normally found in non-coding RNA genes?
Midterm Q Genes found in the genome include protein-coding genes and non-coding RNA genes Which nucleotide is not normally found in non-coding RNA genes? G T 3 A 4 C 5 U 00% Midterm Q Which of the following
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationChromosomes. Ms. Gunjan M. Chaudhari
Chromosomes Ms. Gunjan M. Chaudhari Chromsomes Chromosome structure Chromatin structure Chromosome variations The new cytogenetics Prokaryotic chromosomes Circular double helix Complexed with protein in
More informationThe Nucleus and DNA Replication
OpenStax-CNX module: m46073 1 The Nucleus and DNA Replication OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
More informationGene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory
Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes
More informationTranscription & Translation. From Gene to Protein
Transcription & Translation From Gene to Protein Part 1 A little history lesson In 1909, British physician Archibald Garrod first suggested that genes dictate phenotypes through enzymes that catalyze specific
More informationDNA Chapter 12. DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B Griffith s Experiment
DNA Chapter 12 DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B.1.27 To truly understand genetics, biologists after Mendel had to discover the chemical nature of the gene. In 1928, Frederick Griffith was trying
More informationChapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
More informationZool 3200: Cell Biology Exam 2 2/20/15
Name: TRASK Zool 3200: Cell Biology Exam 2 2/20/15 Answer each of the following short and longer answer questions in the space provided; circle the BEST answer or answers for each multiple choice question
More information