The drawing of RNA and cdna is worth 3 points, if there is no second strand of cdna or no oligo dc or dg linker added, 1 point will be deducted.
|
|
- Evan Dean
- 6 years ago
- Views:
Transcription
1 1. a) The 3 end of mrna usually ends up copied in a cdna because the first strand of cdna is synthesized by reverse transcriptase using oligo dt as the primer. The enzyme will fall off after a while resulting a unfinished 5 end. ( 2 points) mrna 5 mrna 5 TTT T(n)5 first strand cdna 3 GGGGG 5 CCCCC TTT T(n)5 The drawing of RNA and cdna is worth 3 points, if there is no second strand of cdna or no oligo dc or dg linker added, 1 point will be deducted. b) 1. Label your partial cdna with 32P or non radioactive markers to make a probe.(2 points) 2. plate out the Gene-Whiz cdna library.(1 point) 3. Screen the library with your probe, specifically, membrane lift to copy the library to nylon or nitrocellulose membrane, release and denature DNA. Hybridize the library with your probe. Find the positive clone by autoradiography or color reaction. (1 point) 4. Go back to the original plate, isolate the corresponding positive clone and extract the vector. (1 point) c) The answer we are looking for is the following: sequence the isolated cdna from both end, if you find the start codon (ATG) preceded by inframe stop codon at the 5 end, and poly A tail at the 3 end, the cdna is complete. There are several different answers we also give credit: 1) design oligos according to known full length sequence from both 5 end and 3 end, and apply PCR on to the isolated cdna clone, if it is full length, you can get PCR product. We gave full credit to this answer, 5 points. 2) PCR amplify or restriction enzyme digest to release the cdna insert, compare the length with the fulllength cdna by gel electrophoresis. We gave 4 point to this one since the gel electrophoresis is not good enough to tell the small difference in length. Some student simply compare the gene-whiz cdna to the partial cdna, we gave 3 points. 3) Subclone the cdna into an expression vector, and look for functional protein. We gave 4 points to this one since sometimes, the partial protein can also have function.
2 2a. It is the thermostability of Taq polymerase (and others such as Pfu and Vent) that makes it ideal for the polymerase chain reaction (PCR). Most polymerases would denature at temperatures well below 95 degrees. 2b. Your desired product is a double-stranded duplex of DNA, the strands complementing each other exactly (in base pair composition and length). This occurs during the 3rd round. At the end of the 2nd round only partially double-stranded molecules are present. (Refer to the PCR video shown in class from the CD-ROM.) Also, 2 n - 2n = # of copies of desired fragment (Where n = number of cycles) (3) = 2. Whereas, 2 2-2(2) = 0. 2c. Taq moves along the template strand in a 3 to 5 manner (Synthesizing 5 to 3 ). So PCR primers should be designed to anneal to the 3 ends of the template sequences, not the 5 ends. 3. C. elegans (a eukaryote) genomic DNA contains introns. While expressing this gene the translational machinery encountered a stop codon within an intron causing a truncated form of the protein you were studying to be expressed. It is clearly stated that the cloning and expression were done correctly (i.e. you isolated the DNA fragment you wanted and the correct expression vector was used). The gene should have been isolated from a cdna library, because cdna libraries do not contain introns bp bp bp deletion of amino acids 31-61= deletion of base pairs Primer 1: base pairs , complementary to the 3-5 (bottom) strand Primer 2: base pairs CCC , complementary to the 5-3 (top) strand Primer 3: base pairs GGG , complementary to the 3-5 (bottom) strand Primer 4: base pairs , complementary to the 5-3 (top) strand Step 1: Perform PCR with cdna, primer 1, and primer GGG CCC Step 2: Perform PCR with cdna, primer 3, and primer GGG CCC
3 Step 3: Mix PCR products from steps 1 and 2 and add primers 1 and GGG CCC Taq Polymerase GGG CCC Points: +1: deleting the correct base pairs +8: designing the correct primers +6: designing the correct procedure Primers 1 and 4 Amplify Common Mistakes: Unnecessary steps: -1 Confusing amino acids with base pairs: -1 Incorrect length of primer (e.g. insufficient overlap): -2 Inefficient PCR procedure (e.g. running PCR for one cycle): -4 Incorrect complementation of GGG (GGG/CCC): -1 Additional model that is incorrect: -2 Using any procedure other than PCR: up to -15 5a. There are three methods to look at the inside vs. the outside of the cell with fluorescence. 1. Inject antibodies into the cell. If the fluorescence is seen along the edge of the cell, that part of the protein is in the cytosol. (if you did not mention localization to the membrane, -1) 2. Do not permeablize the cell. Add one antibody and see if it sticks to the outside of the cell. If you see a green ring around the cell, the N-terminus is protruding into the extracellular matrix, and if green, then the C-terminus is. If you add both at the same time and they both stick, the color will be yellow. 3. If you have done one of the above, you must also do the other or do this: permeablize the cell and see that both antibodies (together as yellow or separately) bind to the membrane. This tells you that the other terminus is not actually tucked INTO the membrane.) If you only confirmed one or the other, you got 6 points. Answers involving the use of digital cameras or computers got no points. Even with the best systems available, you cannot resolve less than 200nm distance. 5b. out _ C (-----)----( ---- ) ( )---(------) inside N If you did not label inside/outside 1. If you did not label N+C or if you had them on the wrong ends, -1
4 If your protein did not clearly span the membrane, -2 If your segments were stacked, you didn t notice the many figures in the book. 3 If you had other lines of the protein spanning the membrane, -1 5c. Several answers were awarded full credit. The one that appeared most often was to test if section 6 was partially imbedded in the membrane or if it was completely outside of the cell. This can be done by creating an antibody to the region. If the antibody sticks, the region is not in the membrane. Many people suggested that the lysine and aspartate form a salt bridge that loops region 6 in a U. To get full credit you had to propose a method to see structural change. Mutating the residues and looking to see what happens was not enough. If you proposed that the 6th region would become a membrane spanning region with Lys and Asp mutated into hydrophobic regions, and this can be tested by looking for the C- terminus flipping to the cytosol, that got credit. Although these are not simple, credit was given to anyone who suggested NMR or X-ray crystallography. Electron microscopy is easier and could confirm some structural information. If you stated the problem to investigate, possible options the results would differentiate between, but an impossible method of testing, you were given 1-2 points. Anyone who wanted to test if the 6 th segment was membrane-spanning got no credit because the information in the beginning and 5b make this very unlikely. If it spanned the membrane, both termini would be on the same side of the membrane. 6. This question had some careful wording in it. Most people understood that complementation was occurring and that multiple proteins came together to form a working complex. The problem came from the sentence "After an extensive genetic and molecular investigation you conclude that each patient is homozygous for a different point mutation in the catalytic subunit of the sarcoplasmic reticulum CA2+ ATP-ase." What this sentence says is that all mutations occurred in the same gene (1 gene = 1 subunit). Therefore mutant copies of the gene apparently complement different mutant copies in the same gene. For this to occur, the subunits apparently dimerize (or polymerize as a trimer/tetramer/ etc) to form a functional protein. In other words AA, BB, and CC dimers fail as pumps but AB, AC, and BC dimers have normal function. Wildtype genes do not restore function since there are no wildtype genes to be had in the hetorokaryon. A) Full points were awarded for stating that the protein exists as a homodimer in the membrane coupled with a logical explanation. Complementation by mutant copies of the same gene suggest the existence of homodimers of the protein was worth 10 points. B) Writing complementation would have rewarded you with 5 points The most common error was the belief that the subunit was encoded for by three separate genes and that these subunits would create a functional protein. Most people then wrote a completely correct answer to a different question in which the underlined section was removed. This resulted in a loss of 6 points in A for incorrect determination of homodimerization and generally a loss of 1 point in B for failing to recognize how the complementation worked on the physical level.
5 No points were awarded in A for definitions of the protein copied from the book. Your experiments do not tell you any of that information. 7. The most important points you needed get from the question in order answer this question were that there is only ONE protein in the membrane, and that it is only capable of pumping Na+ out of the cell upon ATP binding. This tells you that water (needs water channels), ions (including K+), and glucose are completely impermeable so there should be no mention of osmosis, K+ establishing membrane potential, or anything else going across the membrane. As the Na+ is pumped out, it localizes to the outer membrane because it is attracted to the negative charge on the interior caused by the ionic imbalance after the exit of the Na+ ions. This creates a small membrane potential. Very little of the Na+ is able to get out of the cell before the electrostatic repulsion between the + charged outer membrane and the cytosolic Na+ is too strong to be overcome by the energy of ATP hydrolysis. (While Fig 15-8 in the Lodish text depicts a similar experiment, the initial concentrations are different from that on the exam question, so the equilibrium potentials would not be the same as in the text) Because of the small change in Na+ concentration, you can say that it is lower in the cell, but the change is so little, that there is virtually no concentration gradient (not comparable to levels needed for physiological functions). - Establishes membrane potential (6 pts total). If you said anything indicating that the potential is high, or approaches/is greater than wild-type membrane potential (-3 pts). No credit was given to answers referring to it as a "potential gradient" or "electric field." If you did not mention potential but said that there was build up of some - charge on the cytosolic side and + charge on the extracellular side (+3 pts). No credit was given if you say that the membrane depolarizes, because it does the opposite (polarize). - Na+ concentration on the outside is greater than the inside (3 pts) Must say this explicitly. No points were given if you mentioned that the Na+ concentration outside was very high, approaching physiological levels, or that all or nearly all of them will get pumped outside. - K+ concentrations remain unchanged on both sides. (3 pts) No points for anything about K+ localization to the membrane or that a change in osmolarity causes a concentration decrease. (not enough Na+ gets pumped out for any of those to happen) - Overall no establishment of concentration gradient, with establishment of membrane potential (3 pts). Statments about the Na+ pumping reaction not going to completion are true, but say nothing about the extent of pumping and how the result affects the concentration gradient or membrane potential.
Recitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationQ1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution.
Short questions 1 point per question. Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution. Q2 (1 point): Put a cross by the correct answer(s) below. The Na
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationChapter 4. Recombinant DNA Technology
Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationMolecular Genetics II - Genetic Engineering Course (Supplementary notes)
1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationXXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationStudent name ID # Second Mid Term Exam, Biology 2020, Spring 2002 Scores Total
Second Mid Term Exam, Biology 2020, Spring 2002 Scores 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. Total 1 1. Matching (7 pts). Each answer is used exactly once Helicase
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationComputational Biology 2. Pawan Dhar BII
Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationTechnical University of Denmark. Written examination, 29 May 2012 Course name: Life Science. Course number: Aids allowed: Written material
1 Technical University of Denmark Written examination, 29 May 2012 Course name: Life Science Course number: 27008 Aids allowed: Written material Exam duration: 4 hours Weighting: The exam set consists
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationQ1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution.
Short questions 1 point per question. Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution. Answer: Water is sucked out of the cells by osmosis (this reduces
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationModule Code: BIO00007C
Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 Hour 30 Minutes Marking Scheme: Total marks available for
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationSTANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host).
STANDARD CLONING PROCEDURES Shotgun cloning (using a plasmid vector and E coli as a host). 1) Digest donor DNA and plasmid DNA with the same restriction endonuclease 2) Mix the fragments together and treat
More informationChapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationIntroduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
More informationBIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
More informationQuiz Submissions Quiz 4
Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present
More informationBasic lab techniques
Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.
More informationBasics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm
Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More information3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves
Central Dogma Genes are units perpetuating themselves and functioning through their expression in the form of proteins 1 DNA RNA Protein 2 3 1. Replication 2. Transcription 3. Translation Spring 2002 21
More information5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?
Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationPolymerase Chain Reaction PCR
Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A
More information7.02/ RECOMBINANT DNA METHODS EXAM KEY
MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 RECOMBINANT DNA METHODS EXAM KEY Regrade requests are due to the instructor in the 7.02 teaching lab by the
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationMolecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:
Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.
More informationPolymerase chain reaction
Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain
More informationBA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available
More information3. This is the name of the small fragments of DNA that are replicated with several RNA primers in between them:
Section A: Multiple Choice [15] 1. The central dogma states that: a) DNA is held in the nucleus, which is translated into an amino acid strand, which leaves the nucleus and is transcribed into a mrna strand
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationSite directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha
Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationBefore starting, write your name on the top of each page Make sure you have all pages
Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will
More informationAh, Lou! There really are differences between us!
Name Per Ah, Lou! There really are differences between us! Introduction The human genome (the total sum of our genetic makeup) is made up of approximately 6 billion base pairs distributed on 46 chromosomes.
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationExam 2 Key - Spring 2008 A#: Please see us if you have any questions!
Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationBiol 321 Spring 2013 Quiz 4 25 pts NAME
Biol 321 Spring 2013 Quiz 4 25 pts NAME 1. (3 pts.) a. What is the name of this compound? BE EXPLICIT deoxyribose 5 b. Number the carbons on this structure: 4 1 3 2 2. (4 pts.) Circle True or False. If
More informationRecombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
More informationDESIGNER GENES SAMPLE TOURNAMENT
DESIGNER GENES SAMPLE TOURNAMENT PART ONE- GENETICS PROBLEMS In dogs, the inheritance of hair color involves a gene (B) for black hair and a gene (b) for brown hair. A dominant (C) is also involved. It
More informationDESIGNER GENES - BIOTECHNOLOGY
DESIGNER GENES - BIOTECHNOLOGY Technology to manipulate DNA techniques often called genetic engineering or Recombinant DNA Technology-Technology used to manipulate DNA Procedures often called genetic engineering
More informationBiology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More informationChapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
More informationChapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationBiotechnology. Biotechnology is difficult to define but in general it s the use of biological systems to solve problems.
MITE 2 S Biology Biotechnology Summer 2004 Austin Che Biotechnology is difficult to define but in general it s the use of biological systems to solve problems. Recombinant DNA consists of DNA assembled
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationImpact of Nutraceuticals on TERT gene encoded protein
Impact of Nutraceuticals on TERT gene encoded protein Xu Liu Department of Biological Sciences Fordham University, Bronx, New York, 10458 Abstract Telomerase is a Ribonucleo-protein polymerase that plays
More informationLecture 22: Molecular techniques DNA cloning and DNA libraries
Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationi. This type of DNA damage will result in (circle all correct answers) b. a transversion mutation
Biol 321 Winter 2010 Quiz 5 40 points NAME ANSWERS IN RED COMMENTS IN BLUE 1. (2 pts.) Recall the article entitled: Human Genetic Variation By each statement circle True/False/Not addressed in the paper.
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationQ2 (1 point). How many carbon atoms does a glucose molecule contain?
Q1 (1 point). Name three amino acids that are typically found at the surface of integrated membrane proteins.. Q2 (1 point). How many carbon atoms does a glucose molecule contain? Q3 (1 point). What do
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationA) (5 points) As the starting step isolate genomic DNA from
GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB
More informationBIOTECHNOLOGY. Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS
BIOTECHNOLOGY Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS Bacteria: are prokaryotic organisms that contain circular DNA and no organelles. They
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More information7.012 Exam Two KEY
7.012 Exam wo KEY -- 2006 Exam starts at 10:05 am and ends at 10:55 am. here are 9 pages including this cover page & the genetic code. Please write your name on each page. Only writing on the FRON of every
More informationChapter 4 DNA Structure & Gene Expression
Biology 12 Name: Cell Biology Per: Date: Chapter 4 DNA Structure & Gene Expression Complete using BC Biology 12, pages 108-153 4.1 DNA Structure pages 112-114 1. DNA stands for and is the genetic material
More informationBio 366: Biological Chemistry II Test #3, 100 points
Bio 366: Biological Chemistry II Test #3, 100 points READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the back of the
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationThe Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
More informationBSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06
Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift
More informationBlotting Techniques (Southern blot, Northern blot, Western blot, and Eastern blot)
Blotting Techniques (Southern blot, Northern blot, Western blot, and Eastern blot) Masheal Aljumaah SEP 2018 Learning Objectives: What is blotting? Blotting Techniques Types. Applications for each technique.
More information