Impact of Nutraceuticals on TERT gene encoded protein

Transcription

1 Impact of Nutraceuticals on TERT gene encoded protein Xu Liu Department of Biological Sciences Fordham University, Bronx, New York, Abstract Telomerase is a Ribonucleo-protein polymerase that plays essential role during DNA replication and maintains the chromosome length. Telomerase Reverse Transcriptase (TERT) is the protein subunit of telomerase, whose activity is usually turned down to avoid the uncontrolled cell proliferation in the normal somatic cells, while the increased TERT expression is always related with the immortality of cancer cells. Nearly all the eukaryotic cells apply alternative splicing to expand the coding capability of the genome and nutraceuticals are supposed to induce alternatively spliced RNAs. In this study, we treat Caco-2 cells with different nutraceutical compounds and find some nutraceutical treatments could induce Caco-2 cells to express more Exon7 & 8 non-deletion transcript variant, hence more full-length TERT protein. Introduction During DNA replication, Okazaki fragments are formed on the lagging strand to make sure both newly synthesized DNA strands could grow in the 5 -to-3 direction. However, when the replication fork reaches to the end of the linear chromosome, there is no enough space for producing RNA primer needed to start the last Okazaki fragment. Prokaryotic cells use circular DNA to solve the problem. However, eukaryotic cells use the RNA-protein complex, Telomerase, to solve the problem. Telomerase Reverse Transcriptase (TERT), the protein portion of Telomerase, is an enzyme and syntheses DNA using telomerase RNA subunit as the template. Then the synthesized DNA will be added to the parental DNA strand to complete the last Okazaki fragment. The human TERT gene is located at chromosome 5, with 16 Exons

2 and 15 Introns. There are several motifs on the TERT protein, and it has been shown that two of those motifs, encoded by Exon 5&6 and Exon 9, respectively, are responsible for its reverse transcriptase activity. [1][2] (Figure.1) Figure.1. Genomic structure of human TERT gene For normal somatic cells, the activity of TERT has been turned town to avoid uncontrolled cell proliferation, since the enzyme couldn t quite keep up with the chromosome replication. While it has been shown that increased TERT expression will contribute to the cell transformation and TERT knockdown also induces cancer cells apoptosis. [3] Therefore, TERT is a potential gene target for the cancer treatment. Given that approximately all the eukaryotic genes are affected by alternative splicing, expanding the coding capability of the genome, and it also has been shown that nutraceuticals could cause alternative RNA splicing. [4] Thus, in this study, we tend to test the impact of nutraceuticals on TERT gene encoded protein. Materials and Methods Caco-2 cells Caco-2 cells were provided by Dr. Rubin s lab, Department of Biological Sciences, Fordham University. Caco-2 cells were treated with 8 different nutraceutical compounds for two days before extracting protein and RNA. Protein and RNA extraction Proteins were extracted from both treated and untreated Caco-2 cells, and RNAs were extracted using RNeasy Plus Mini Kit (QIAGEN), according to the manufacturer s instructions.

3 Western Blot Western Blot was performed using the extracted protein samples. 37µl protein samples were add and run on 10% Bis-Tris Gel. Then the proteins were transferred to the Nitrocellulose membrane. After using milk blocking for one hour, the Nitrocellulose membrane was incubated with 15mL rabbit polyclonal TERT antibody (Dilution: 1:1000) overnight on 4 C shaker. Primer Primer pair was designed for the experiment, extending from Exon 6 to Exon 9, due to those Exons encode protein motifs responsible for the reverse transcriptase activity of TERT. The forward primer is located at Exon 6, with sequence CATCGCCAGCATCATCAAACC, the reverse primer is located at Exon 9, with sequence GCAAACAGCTTGTTCTCCATGTC. RT-PCR RT-PCR was performed using QIAGEN One-Step RT-PCR Kit following instructions. The forward primer Ten nanograms of RNA was amplified in 10µl RT-PCRs (2µl 5 RT buffer, 0.4µl 10 dntps, 0.4µl enzyme mix, 0.5µl forward primer, 0.5µl reverse primer, 2µl 5ng/µl RNA and 4.2µl dh2o). Temperature cycles as follow: one cycle of 50 C for 30min and 95 C for 15min, 94 C for 30 s, 58 C for 30s, and 72 C for 30s, and a final extension of 72 C for 5 min followed by a final hold at 5 C. Cycle number was 40. Electrophoresis 2 µl loading dye was added to each RT-PCR product. 5µl each product was then added to a 1% agarose gel, and electrophoresis was performed at 160V. Band intensities were visualized by ethidium bromide in a UV trans-illuminator (BioRad). 100bp DNA marker was used to measure the size of bands. Gel extraction and sequencing The target products was extracted by QIAquick Gel Extraction Kit (QIAGEN) following the manufacturer s instructions and subsequently sequenced by GENEWIZ in order to identify PCR products.

4 Results Some Nutraceuticals could induce significant increased full-length TERT protein expression. The molecular weight of full-length TERT protein is around 124Kd. After treating Caco-2 cells with 8 nutraceutical compounds, Western Blot was carried for the extracted proteins using rabbit polyclonal TERT antibody (Figure.2). For the cell samples treated with nutraceutical compound 1, 6 and 8, we could clearly find a robust band indicating Full-length TERT protein at the site around 120Kd when compared with untreated (control) Caco-2 cells and. To further confirm the result, we did second Western Blot using anther rabbit polyclonal TERT antibody, which is showing the same result. (Figure.3) Figure.2. Western blot results, using first rabbit polyclonal TERT antibody, for proteins extracted from cell samples treated with 8 Nutraceutical compounds and untreated one (Control).

5 Figure.3. Western blot, using second rabbit polyclonal TERT antibody, for proteins extracted from Caco-2 cell samples treated with 8 Nutraceutical compounds and untreated one (Control). Alternatively spliced variants of TERT were found in those Caco-2 cells expressing more full-length TERT protein. After confirming three of those nutraceuticals could induce increased expression of TERT protein, RT-PCR was carried out using the primer pair whose PCR product is located from Exon 6 to 9, (Figure.4) and the result is visualized by Gel Electrophoresis. (Figure.5) After purifying and sequencing those bands, we find two alternative TERT transcripts, around 240bp and 420bp, respectively, despite the existence of a non-specific band pointed by the yellow arrow.

6 Figure.4. The location of primer pair Figure 5. Gel Electrophoresis Results of RT-PCR After blasting and comparing, we find the upper band, which is around 420bp and not expressed in untreated cells, is the expected PCR products. However, the lower band that is around 240bp and expressed in all cell samples lacks total Exon 7 and Exon 8(Figure.6). Figure.6 Alternatively spliced TERT transcripts observed in this study

7 Discussion and Conclusion We have demonstrated alternative splicing of the transcripts generated by TERT gene. The deletion of Exon 7 and 8 will induce the reading frame shift and then there will be a premature stop codon in Exon 10. When only the Exon 7 and 8 are deleted, the translated product will be 807 Amino Acid length, around 90Kd. Since the TERT antibody we applied will recognize and bind with the C-terminal domain of full-length TERT protein, so the translated product is not visible on the Western Blot result. The exons being responsible for encoding C-terminus of full-length TERT protein are blue colored and shown below. [2][5] (Figure.7) Figure.7 Exons that encode C-terminus of human TERT protein, shown in blue color. In spite of the function of the transcript variant without Exon 7 and 8 is unknown, it is highly possible that such kind of deletion will affect its reverse transcriptase activity. It has been found that the motif A and B of the full-length TERT, encoded by Exon 5/6, and Exon 9, respectively, are responsible for its enzyme activity. [1] Therefore, the reading frame shift induced by deletion of Exon 7 and 8 will affect the TERT motif B, probably altering the reverse-transcriptase activity (Figure.8). Figure. 8 Diagram of TERT protein motifs being responsible for its reverse transcriptase activity

8 In this study, although we didn t test the changes of the reverse-transcriptase activity between different TERT transcript variants, what we could still confirm is that some nutraceutical treatments will induce Caco-2 cells to produce more non-deletion transcript variant, hence expressing more full-length TERT protein. Acknowledgement I would like to thank my Teaching Assistants, Anthony Evans and Catharina Grubaugh for all of their patient guidance, advices and suggestions, as well as all the valuable work they put in to assure the experiment went as smoothly as possible. Finally, I would also like to thank Dr. Berish Rubin for his help and support to make this project possible. Reference [1] Akincilar, Semih Can, Bilal Unal, and Vinay Tergaonkar. Reactivation of telomerase in cancer. Cellular and Molecular Life Sciences (2016): [2] Cong, Yu-Sheng, Jianping Wen, and Silvia Bacchetti. "The human telomerase catalytic subunit htert: organization of the gene and characterization of the promoter." Human molecular genetics 8.1 (1999): [3] Konnikova L, Simeone MC, Kruger MM. et al. Signal transducer and activator of transcription 3 (STAT3) regulates human telomerase reverse transcriptase (htert) expression in human cancer and primary cells. Cancer Res. 2005;65: [4] Ravi, Suhana, Rudolf J. Schilder, and Scot R. Kimball. "Role of precursor mrna splicing in nutrient-induced alterations in gene expression and metabolism." The Journal of nutrition (2015): [5] Huard, Sylvain, Tara J. Moriarty, and Chantal Autexier. "The C terminus of the human telomerase reverse transcriptase is a determinant of enzyme processivity." Nucleic acids research (2003):