ACCEPTED. Korean patient isolate in an effort to understand the prevalence, antibiotic resistance, and
|
|
- Emmeline Booth
- 5 years ago
- Views:
Transcription
1 JB Accepts, published online ahead of print on June 00 J. Bacteriol. doi:./jb.00-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved The Complete Genome Sequence of Neisseria gonorrhoeae NCCP Gyung Tae Chung 1, Jeong Sik Yoo 1, Hee Bok Oh 1, Yeong Seon Lee 1, Sun Ho Cha, Sang Jun Kim, Cheon Kwon Yoo * Centers for Infectious Diseases, National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul 1-01, Korea 1, GenoTech Corporation - Jang-Dong, Yuseong-Gu, Daejeon 0-, Korea, and Division of Biosafety Evaluation and Control, National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul 1-01, Korea Neisseria gonorrhoeae is an obligate human pathogen that is the etiological agent of gonorrhea. We explored variations in genes of a multidrug-resistant N. gonorrhoeae Korean patient isolate in an effort to understand the prevalence, antibiotic resistance, and importance of horizontal gene transfer within this important, naturally competent organism. Here we report the complete annotated genome sequence of N. gonorrhoeae strain NCCP. Downloaded from on July 1, 01 by guest *Corresponding Author: Cheon Kwon Yoo ckyoo@nih.go.kr Tel: --0-1
2 Fax: Short title: Genome sequence of N. gonorrhoeae Keywords: N. gonorrhoeae, genome sequence Neisseria gonorrhoeae NCCP was isolated from a vaginal smear of a Korean patient. This strain fit the pattern of antimicrobial resistance that is prevalent in Korea, namely chromosome-mediated resistance to penicillin and tetracycline, and a ciprofloxacin MICof 1 mg/l. The complete genome sequence of NCCP was determined by whole-genome shotgun sequencing. Two genome libraries were generated by random shearing of genomic DNA; one was a fosmid library with mean insert size kb (CopyControl Fosmid library production kit, Epicentre, Madison, WI), and the other was a smaller insert library of 1~ kb. Automated DNA sequencing chromatograms were analyzed by the Phred/Phrap/Consed software package ( Gap closure and additional sequencing of low- Downloaded from on July 1, 01 by guest 1 coverage regions were accomplished via primer walking of gap-spanning clones and direct 1 sequencing of PCR products. In particular, the order of 1 contigs was predicted by 1 comparison with the genome sequence of N. gonorrhoeae FA0 (strain AE00) and
3 1 1 then confirmed by PCR. To solve problems with misassembled regions caused by repetitive sequences and to close remaining sequence gaps, we used long PCR along with six fosmid clones. Their relationships were reassembled manually based on location information for paired-end reads using Consed. The completed genome sequence had -fold sequence coverage with an error rate of 0.1 per,000 bases. Open reading frame (ORF) prediction and annotation were performed using GLIMMER () and BLAST. Functional assignment of genes was performed by searching translated ORFs against the COG () and KEGG () databases. The genome of NCCP consists of one circler chromosome (,,0 bp), encoding, predicted ORFs, and one plasmid (,1 bp) encoding 1 predicted ORFs. The estimated coding density over the entire genome is %, and the average G+C content is.%, values that are similar to those of strain FA0. The strain NCCP genome encodes trnas and four copies of 1S-S-S ribosomal RNA operons. Downloaded from on July 1, 01 by guest 1 Genome structure comparisons between NCCP and FA0 were performed using 1 the programs ACT () and MUMMER (). Genome colinearity between these strains is 1 interrupted by NCCP-specific and FA0-specific regions as well as by several
4 1 1 inversions and translocations. The strain NCCP genome is, bp larger than that of FA0, and the overall genome sequence identity is.%. This difference in genome size is caused by a gonococcal genetic island (GGI) in the NCCP. The GGI is present in 0% of gonococcal isolates and encodes a type IV secretion system (). The GGI of NCCP encodes 1 predicted ORFs (AY00) and is similar to the GGI of N. gonorrhoeae strain MSA ( kb). The GGI sequence similarity between these two strains is.%. As with other Neisseria sp., NCCP genome contains hundreds of repetitive sequence elements. We analyzed these repetitive elements using EMBOSS () and Nicolas method (1). The most abundant repeat type is the DNA uptake sequence ('-gccgtctgaa-'), comprising 1, copies throughout the genome. The next abundant repeat type is neisseria intergenic mosaic elements (RS: 1 copies, and drs: 1 copies). (). The NCCP genome also contains copies of Correia elements. (1) Downloaded from on July 1, 01 by guest 1
5 Nucleotide sequence accession number. The complete genome sequence of N. gonorrhoeae NCCP has been assigned GenBank accession number CP Funding for the sequencing project was provided by the National Institute of Health, Ministry of Health and Welfare, Republic of Korea. REFFERENCES 1. Buisine, N., C. M. Tang, and R. Chalmers. 00. Transposon-like Correia elements: structure, distribution and genetic exchange between pathogenic Neisseria sp. FEBS Letters. : -. Carver, T. J., K. M. Rutherford, M. Berriman, M. A. Rajandream, B. G. Barrell, and J. Parkhill. 00. ACT: the Artemis Comparison Tool. Bioinformatics. 1:-.. Delcher, A. L., D. Harmon, S. Kasif, O. White, and S. L. Salzberg. 1. Improved microbial gene identification with GLIMMER. Nucleic Acid Res. :-1.. Hamilton H. L., N. M. Dominguez, K. J. Schwartz, K. T. Hackett, and J. P. Dillard. 00. Neisseria gonorrhoeae secretes chromosomal DNA via a novel type IV secretion system. Molecular Microbiology. : -.. Kanehisa, M., S. Goto, S. Kawashima, Y. Okuno, and M. Hattori. 00. The KEGG resource for deciphering the genome. Nucleic Acid Res. :D-D0.. Kurtz S., A. Phillippy, A. L. Delcher, M. Smoot., M. Shumway, C. Antonescu, and S. L. Salzberg. 00. Versatile and open software for comparing large genomes. Genome Biology. :R1. Downloaded from on July 1, 01 by guest
6 . Liu, S. V., N. J. Saunders, A. Jeffries, and R. F. Rest. 00. Genome analysis and strain comparison of Correia repeats and Correia repeat-enclosed elements in pathogenic Neisseria. J. Bacteriol. 1:1-1.. Rice, P., I. Longden, and A. Bleasby EMBOSS: the European molecular biology open software suite. Trends Genet. 1: -. Tatusov, R. L., D. A. Natale, I. V. Garkavtsev, T. A. Tatusova, U. T. Shankavaram, B. S. Rao, B. Kiryutin, M. Y. Galperin, N. D. Fedorova, and E. V. Koonin The COG database: new developments in phylogenetic classification of proteins from complete genomes. Nucleic Acid Res. :-. Downloaded from on July 1, 01 by guest
Complete Genome Sequence of Bifidobacterium longum subsp. longum KACC 91563
JB Accepts, published online ahead of print on 8 July 2011 J. Bacteriol. doi:10.1128/jb.05620-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationProbiotic Strain Isolated from the Vagina of Healthy Women
JB Accepts, published online ahead of print on 1 April 2011 J. Bacteriol. doi:10.1128/jb.00358-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationComplete Genome Sequence of the Polycyclic Aromatic Hydrocarbon-Degrading. Bacterium Alteromonas sp. Strain SN2
JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi:10.1128/jb.05252-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationComplete Genome Sequence of Pathogenic Bacterium
JB Accepts, published online ahead of print on 25 March 2011 J. Bacteriol. doi:10.1128/jb.00301-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationGenome sequence of Acinetobacter baumannii MDR-TJ
JB Accepts, published online ahead of print on 11 March 2011 J. Bacteriol. doi:10.1128/jb.00226-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationComplete genome sequence of Clostridium acetobutylicum. DSM 1731, a solvent producing strain with multi-replicon
JB Accepts, published online ahead of print on 8 July 2011 J. Bacteriol. doi:10.1128/jb.05596-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationGenome sequence of Enterobacter mori type strain LMG 25706, a
JB Accepts, published online ahead of print on 20 May 2011 J. Bacteriol. doi:10.1128/jb.05200-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationTitle: Genome sequence of lineage III Listeria monocytogenes strain HCC23
JB Accepts, published online ahead of print on 20 May 2011 J. Bacteriol. doi:10.1128/jb.05236-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationThis is the accepted version of this conference paper: Buckingham, Lawrence and Hogan, James and Mann, Scott
QUT Digital Repository: http://eprints.qut.edu.au/ This is the accepted version of this conference paper: Buckingham, Lawrence and Hogan, James and Mann, Scott and Wirges, Sally (2010) BLAST Atlas : a
More informationCorynebacterium pseudotuberculosis genome sequencing: Final Report
Summary To provide an invaluable resource to assist in the development of diagnostics and vaccines against caseous lymphadenitis (CLA), the sequencing of the genome of a virulent, United Kingdom Corynebacterium
More informationMolecular Biology: DNA sequencing
Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationComputational Biology 2. Pawan Dhar BII
Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationGenome Analysis. Bacterial genome projects
Genome Analysis Bacterial Genome sequencing does this help us in the investigation of adaptive responses/regulatory systems? Genome Sequencing Projects strategy & methods annotation Comparative genomics
More informationJB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi: /jb
JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi:10.1128/jb.05345-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationFunctional annotation of metagenomes
Functional annotation of metagenomes Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction Functional analysis Objectives:
More informationAntimicrobial Agents and Chemotherapy New Data Letter
AAC Accepted Manuscript Posted Online 15 August 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.01519-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 Antimicrobial Agents
More informationBio-Reagent Services. Custom Gene Services. Gateway to Smooth Molecular Biology! Your Innovation Partner in Drug Discovery!
Bio-Reagent Services Custom Gene Services Gateway to Smooth Molecular Biology! Gene Synthesis Mutagenesis Mutant Libraries Plasmid Preparation sirna and mirna Services Large-scale DNA Sequencing GenPool
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationA Robust Method for Finding the Automated Best Matched Genes Based on Grouping Similar Fragments of Large-Scale References for Genome Assembly
S S symmetry Article A Robust Method for Finding the Automated Best Matched Genes Based on Grouping Similar Fragments of Large-Scale References for Genome Assembly Jaehee Jung 1, Jong Im Kim 2, Young-Sik
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist
More informationDetection of Mobile Genetic Elements (MGEs) in Bacterial Genomes
Detection of Mobile Genetic Elements (MGEs) in Bacterial Genomes PhD student: Zheng WANG Supervisor: Professor Margaret IP Department of Microbiology, CUHK Date: 3rd Dec, 2013 Contents Introduction Methodology
More informationBSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06
Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift
More informationBioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
More informationJB Accepts, published online ahead of print on 26 February 2010 J. Bacteriol. doi: /jb
JB Accepts, published online ahead of print on 26 February 2010 J. Bacteriol. doi:10.1128/jb.00109-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationBacterial Genetics. Prof. Dr. Asem Shehabi Faculty of Medicine University of Jordan
Bacterial Genetics Prof. Dr. Asem Shehabi Faculty of Medicine University of Jordan Bacterial Genes-1 All patterns of growth, metabolism, essential cellular structures, biological characteristics of bacteria
More informationComplete nucleotide sequence of pld-tex-kl, a 66-kb plasmid of Legionella dumoffii TEX-KL strain
Complete nucleotide sequence of pld-tex-kl, a 66-kb plasmid of Legionella dumoffii TEX-KL strain Plasmid, 2007 Tian Qin a,*, Hideki Hirakawa b, Ken-ichiro Iida a, Kenshiro Oshima c, Masahira Hattori c,d,
More informationBioinformatics Sequence And Genome Analysis David W Mount
Bioinformatics Sequence And Genome Analysis David W Mount We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer,
More informationApplied bioinformatics in genomics
Applied bioinformatics in genomics Productive bioinformatics in a genome sequencing center Heiko Liesegang Warschau 2005 The omics pyramid: 1. 2. 3. 4. 5. Genome sequencing Genome annotation Transcriptomics
More informationMolecular Biology Services. Make Research Easy
Molecular Biology Services Make Research Easy Gene-on-Demand Technology Platform Any gene conceivable in any vector you desire GenScript s Gene-on-Demand technology platform combines patented OptimumGene
More informationProtein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationDegenerate site - twofold degenerate site - fourfold degenerate site
Genetic code Codon: triple base pairs defining each amino acid. Why genetic code is triple? double code represents 4 2 = 16 different information triple code: 4 3 = 64 (two much to represent 20 amino acids)
More informationIntroduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the
Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics
More information2 nd year Medical Students - JU Bacterial genetics. Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S.
2 nd year Medical Students - JU Bacterial genetics Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S.T MSc, PhD/ UK Bacterial genetics ILOs: bacterial genome and replication
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More information1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.
Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various
More informationGenome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationWeb-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September
More informationNext Generation Sequencing
Next Generation Sequencing Complete Report Catalogue # and Service: IR16001 rrna depletion (human, mouse, or rat) IR11081 Total RNA Sequencing (80 million reads, 2x75 bp PE) Xxxxxxx - xxxxxxxxxxxxxxxxxxxxxx
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More informationBiol 478/595 Intro to Bioinformatics
Biol 478/595 Intro to Bioinformatics September M 1 Labor Day 4 W 3 MG Database Searching Ch. 6 5 F 5 MG Database Searching Hw1 6 M 8 MG Scoring Matrices Ch 3 and Ch 4 7 W 10 MG Pairwise Alignment 8 F 12
More information7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I
7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I For the last several lectures we have been looking at how one can manipulate prokaryotic genomes and how prokaryotic genes are regulated. In the next
More informationSupplementary Figure 1. Design of the control microarray. a, Genomic DNA from the
Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More information4/3/2013. DNA Synthesis Replication of Bacterial DNA Replication of Bacterial DNA
4/3/03 3 4 5 6 7 8 9 0 Chapter 8 Microbial Genetics Terminology Genetics: The study of what genes are, how they carry information, how information is expressed, and how genes are replicated Gene: A segment
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationMutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B
Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture DNA microarray hybridization
More informationIdentification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio
2013 Plant Management Network. Accepted for publication 21 December 2012. Published. Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio
More informationBiology 4100 Minor Assignment 1 January 19, 2007
Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on
More informationDNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule;
Evolution of knowledge about gene G. Mendel Hereditary factors W.Johannsen, 1909 G.W.Beadle, E.L.Tatum, 1945 Ingram, 1957 Actual concepts The gene hereditary unit located in chromosomes Hypotheses One
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationCHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract
CHAPTER FOUR Characterization of parasporal genes in Paenibacillus popilliae and Paenibacillus lentimorbus Abstract The parasporal gene, cry18aa1, was cloned and sequenced by Zhang et al. (4) from the
More informationBiosc10 schedule reminders
Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,
More informationGenetics. Chapter 9 - Microbial Genetics. Chromosome. Genes. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination
Chapter 9 - Microbial Genetics Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination Genetics Genome (The sum total of genetic material of a cell is referred to as the genome.) Chromosome
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationLecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know
Lecture 1. Basic Definitions and Nucleic Acids Basic Definitions you should already know apple DNA: Deoxyribonucleic Acid apple RNA: Ribonucleic Acid apple mrna: messenger RNA: contains the genetic information(coding
More informationGlossary of Commonly used Annotation Terms
Glossary of Commonly used Annotation Terms Akela a general use server for the annotation group as well as other groups throughout TIGR. Annotation Notebook a link from the gene list page that is associated
More informationChapter 15 The Human Genome Project and Genomics. Chapter 15 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning
Chapter 15 The Human Genome Project and Genomics Genomics Is the study of all genes in a genome Relies on interconnected databases and software to analyze sequenced genomes and to identify genes Impacts
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationBS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt
BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt Introduction to molecular biology Combining genetics, biochemistry, structural chemistry Information flow in biological systems: The Central Dogma
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationSequence Features Contributing to Chromosomal Rearrangements in Neisseria gonorrhoeae
Sequence Features Contributing to Chromosomal Rearrangements in Neisseria gonorrhoeae Russell Spencer-Smith, Eldho M. Varkey, Mark D. Fielder, Lori A. S. Snyder* Kingston University, School of Life Sciences,
More informationRESEARCH METHODOLOGY, BIOSTATISTICS AND IPR
MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy
More informationDownload the Lectin sequence output from
Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).
More informationStudying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationHigh throughput omics and BIOINFORMATICS
High throughput omics and BIOINFORMATICS Giuseppe D'Auria Seville, February 2009 Genomes from isolated bacteria $ $ $ $ $ $ $ $ $$ $ $ $ $ $ $ $ se q se uen q c se uen ing q c se uen ing qu c en ing c
More informationGenome Projects. Part III. Assembly and sequencing of human genomes
Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences
More informationDesign and use of synthetic regulatory small RNAs. to control gene expression in Escherichia coli
Supplementary Discussion Design and use of synthetic regulatory small RNAs to control gene expression in Escherichia coli Seung Min Yoo, Dokyun Na, & Sang Yup Lee * Metabolic and Biomolecular Engineering
More informationBME 110 Midterm Examination
BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource
More informationBioinformatic analysis of phage AB3, a phikmv-like virus infecting Acinetobacter baumannii
Bioinformatic analysis of phage AB3, a phikmv-like virus infecting Acinetobacter baumannii J. Zhang 1 *, X. Liu 1 * and X.-J. Li 2 1 Department of Geriatrics Medicine, The Third People s Hospital of Chongqing,
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationComparative Bioinformatics. BSCI348S Fall 2003 Midterm 1
BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to
More informationGenome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
More information2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs?
2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs? Answer: edna is made from mrna and not from trnas or rrnas because polyt primers are used to prime the first
More informationMechanisms of Genetic Variation. Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display.
16 Mechanisms of Genetic Variation Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Mutations: Their Chemical Basis and Effects Stable, heritable
More informationBacteria Reproduce Asexually via BINARY FISSION
An Introduction to Microbial Genetics Today: Intro to Microbial Genetics Lunch pglo! Bacteria Reproduce Asexually via BINARY FISSION But, Bacteria still undergo GENETIC RECOMBINATION (combining DNA from
More informationM.Sc. Biochemistry (Colleges) onwards BHARATHIAR UNUIVERSITY, COIMBATORE
Page 1 of 5 SCAA Dt. 24.04.2015 BHARATHIAR UNUIVERSITY, COIMBATORE 654 046. M.SC. BIOCHEMISTRY (Revised papers for the candidates admitted from the academic year 2015-16 onwards) Note: The revised syllabi
More informationThe use of bioinformatic analysis in support of HGT from plants to microorganisms. Meeting with applicants Parma, 26 November 2015
The use of bioinformatic analysis in support of HGT from plants to microorganisms Meeting with applicants Parma, 26 November 2015 WHY WE NEED TO CONSIDER HGT IN GM PLANT RA Directive 2001/18/EC As general
More informationIn vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features
In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features Yiliang Ding, Yin Tang, Chun Kit Kwok, Yu Zhang, Philip C. Bevilacqua & Sarah M. Assmann (2014) Seminar RNA Bioinformatics
More informationGene Prediction Group
Group Ben, Jasreet, Jeff, Jia, Kunal TACCTGAAAAAGCACATAATACTTATGCGTATCCGCCCTAAACACTGCCTTCTTTCTCAA AGAAGATGTCGCCGCTTTTCAACCGAACGATGTGTTCTTCGCCGTTTTCTCGGTAGTGCA TATCGATGATTCACGTTTCGGCAGTGCAGGCACCGGCGCATATTCAGGATACCGGACGCT
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationchapter eight: microbial genetics
chapter eight: microbial genetics the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material Hershey Chase, 1952
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationMap-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
More informationChapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationIdentification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio
2013 Plant Management Network. Accepted for publication 18 December 2012. Published. Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio John
More informationBENG 183 Trey Ideker. Genome Assembly and Physical Mapping
BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms
More informationChapter 15 THE HUMAN GENOME PROJECT AND GENOMICS
Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS Chapter Summary Mapping of human genes means identifying the chromosome and the position on that chromosome where a particular gene is located. Initially
More informationCurriculum Vitae. (last updated: ) Min-Soo Kim
Curriculum Vitae (last updated:2018-02-08) Min-Soo Kim Current Address Ph.D. Degree, Department of Biology, Kyung Hee University, 26 Kyungheedaero, Dondaemun-Gu, Seoul, 02447, Republic of Korea Tel:+82-2-961-2312
More informationBacterial Genetics. Stijn van der Veen
Bacterial Genetics Stijn van der Veen Differentiating bacterial species Morphology (shape) Composition (cell envelope and other structures) Metabolism & growth characteristics Genetics Differentiating
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationchapter eight: microbial genetics
chapter eight: microbial genetics Revised 9/15/2016 the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More information