ACCEPTED. Korean patient isolate in an effort to understand the prevalence, antibiotic resistance, and

Size: px
Start display at page:

Download "ACCEPTED. Korean patient isolate in an effort to understand the prevalence, antibiotic resistance, and"

Transcription

1 JB Accepts, published online ahead of print on June 00 J. Bacteriol. doi:./jb.00-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved The Complete Genome Sequence of Neisseria gonorrhoeae NCCP Gyung Tae Chung 1, Jeong Sik Yoo 1, Hee Bok Oh 1, Yeong Seon Lee 1, Sun Ho Cha, Sang Jun Kim, Cheon Kwon Yoo * Centers for Infectious Diseases, National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul 1-01, Korea 1, GenoTech Corporation - Jang-Dong, Yuseong-Gu, Daejeon 0-, Korea, and Division of Biosafety Evaluation and Control, National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul 1-01, Korea Neisseria gonorrhoeae is an obligate human pathogen that is the etiological agent of gonorrhea. We explored variations in genes of a multidrug-resistant N. gonorrhoeae Korean patient isolate in an effort to understand the prevalence, antibiotic resistance, and importance of horizontal gene transfer within this important, naturally competent organism. Here we report the complete annotated genome sequence of N. gonorrhoeae strain NCCP. Downloaded from on July 1, 01 by guest *Corresponding Author: Cheon Kwon Yoo ckyoo@nih.go.kr Tel: --0-1

2 Fax: Short title: Genome sequence of N. gonorrhoeae Keywords: N. gonorrhoeae, genome sequence Neisseria gonorrhoeae NCCP was isolated from a vaginal smear of a Korean patient. This strain fit the pattern of antimicrobial resistance that is prevalent in Korea, namely chromosome-mediated resistance to penicillin and tetracycline, and a ciprofloxacin MICof 1 mg/l. The complete genome sequence of NCCP was determined by whole-genome shotgun sequencing. Two genome libraries were generated by random shearing of genomic DNA; one was a fosmid library with mean insert size kb (CopyControl Fosmid library production kit, Epicentre, Madison, WI), and the other was a smaller insert library of 1~ kb. Automated DNA sequencing chromatograms were analyzed by the Phred/Phrap/Consed software package ( Gap closure and additional sequencing of low- Downloaded from on July 1, 01 by guest 1 coverage regions were accomplished via primer walking of gap-spanning clones and direct 1 sequencing of PCR products. In particular, the order of 1 contigs was predicted by 1 comparison with the genome sequence of N. gonorrhoeae FA0 (strain AE00) and

3 1 1 then confirmed by PCR. To solve problems with misassembled regions caused by repetitive sequences and to close remaining sequence gaps, we used long PCR along with six fosmid clones. Their relationships were reassembled manually based on location information for paired-end reads using Consed. The completed genome sequence had -fold sequence coverage with an error rate of 0.1 per,000 bases. Open reading frame (ORF) prediction and annotation were performed using GLIMMER () and BLAST. Functional assignment of genes was performed by searching translated ORFs against the COG () and KEGG () databases. The genome of NCCP consists of one circler chromosome (,,0 bp), encoding, predicted ORFs, and one plasmid (,1 bp) encoding 1 predicted ORFs. The estimated coding density over the entire genome is %, and the average G+C content is.%, values that are similar to those of strain FA0. The strain NCCP genome encodes trnas and four copies of 1S-S-S ribosomal RNA operons. Downloaded from on July 1, 01 by guest 1 Genome structure comparisons between NCCP and FA0 were performed using 1 the programs ACT () and MUMMER (). Genome colinearity between these strains is 1 interrupted by NCCP-specific and FA0-specific regions as well as by several

4 1 1 inversions and translocations. The strain NCCP genome is, bp larger than that of FA0, and the overall genome sequence identity is.%. This difference in genome size is caused by a gonococcal genetic island (GGI) in the NCCP. The GGI is present in 0% of gonococcal isolates and encodes a type IV secretion system (). The GGI of NCCP encodes 1 predicted ORFs (AY00) and is similar to the GGI of N. gonorrhoeae strain MSA ( kb). The GGI sequence similarity between these two strains is.%. As with other Neisseria sp., NCCP genome contains hundreds of repetitive sequence elements. We analyzed these repetitive elements using EMBOSS () and Nicolas method (1). The most abundant repeat type is the DNA uptake sequence ('-gccgtctgaa-'), comprising 1, copies throughout the genome. The next abundant repeat type is neisseria intergenic mosaic elements (RS: 1 copies, and drs: 1 copies). (). The NCCP genome also contains copies of Correia elements. (1) Downloaded from on July 1, 01 by guest 1

5 Nucleotide sequence accession number. The complete genome sequence of N. gonorrhoeae NCCP has been assigned GenBank accession number CP Funding for the sequencing project was provided by the National Institute of Health, Ministry of Health and Welfare, Republic of Korea. REFFERENCES 1. Buisine, N., C. M. Tang, and R. Chalmers. 00. Transposon-like Correia elements: structure, distribution and genetic exchange between pathogenic Neisseria sp. FEBS Letters. : -. Carver, T. J., K. M. Rutherford, M. Berriman, M. A. Rajandream, B. G. Barrell, and J. Parkhill. 00. ACT: the Artemis Comparison Tool. Bioinformatics. 1:-.. Delcher, A. L., D. Harmon, S. Kasif, O. White, and S. L. Salzberg. 1. Improved microbial gene identification with GLIMMER. Nucleic Acid Res. :-1.. Hamilton H. L., N. M. Dominguez, K. J. Schwartz, K. T. Hackett, and J. P. Dillard. 00. Neisseria gonorrhoeae secretes chromosomal DNA via a novel type IV secretion system. Molecular Microbiology. : -.. Kanehisa, M., S. Goto, S. Kawashima, Y. Okuno, and M. Hattori. 00. The KEGG resource for deciphering the genome. Nucleic Acid Res. :D-D0.. Kurtz S., A. Phillippy, A. L. Delcher, M. Smoot., M. Shumway, C. Antonescu, and S. L. Salzberg. 00. Versatile and open software for comparing large genomes. Genome Biology. :R1. Downloaded from on July 1, 01 by guest

6 . Liu, S. V., N. J. Saunders, A. Jeffries, and R. F. Rest. 00. Genome analysis and strain comparison of Correia repeats and Correia repeat-enclosed elements in pathogenic Neisseria. J. Bacteriol. 1:1-1.. Rice, P., I. Longden, and A. Bleasby EMBOSS: the European molecular biology open software suite. Trends Genet. 1: -. Tatusov, R. L., D. A. Natale, I. V. Garkavtsev, T. A. Tatusova, U. T. Shankavaram, B. S. Rao, B. Kiryutin, M. Y. Galperin, N. D. Fedorova, and E. V. Koonin The COG database: new developments in phylogenetic classification of proteins from complete genomes. Nucleic Acid Res. :-. Downloaded from on July 1, 01 by guest

Complete Genome Sequence of Bifidobacterium longum subsp. longum KACC 91563

Complete Genome Sequence of Bifidobacterium longum subsp. longum KACC 91563 JB Accepts, published online ahead of print on 8 July 2011 J. Bacteriol. doi:10.1128/jb.05620-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Probiotic Strain Isolated from the Vagina of Healthy Women

Probiotic Strain Isolated from the Vagina of Healthy Women JB Accepts, published online ahead of print on 1 April 2011 J. Bacteriol. doi:10.1128/jb.00358-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Complete Genome Sequence of the Polycyclic Aromatic Hydrocarbon-Degrading. Bacterium Alteromonas sp. Strain SN2

Complete Genome Sequence of the Polycyclic Aromatic Hydrocarbon-Degrading. Bacterium Alteromonas sp. Strain SN2 JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi:10.1128/jb.05252-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Complete Genome Sequence of Pathogenic Bacterium

Complete Genome Sequence of Pathogenic Bacterium JB Accepts, published online ahead of print on 25 March 2011 J. Bacteriol. doi:10.1128/jb.00301-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Genome sequence of Acinetobacter baumannii MDR-TJ

Genome sequence of Acinetobacter baumannii MDR-TJ JB Accepts, published online ahead of print on 11 March 2011 J. Bacteriol. doi:10.1128/jb.00226-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Complete genome sequence of Clostridium acetobutylicum. DSM 1731, a solvent producing strain with multi-replicon

Complete genome sequence of Clostridium acetobutylicum. DSM 1731, a solvent producing strain with multi-replicon JB Accepts, published online ahead of print on 8 July 2011 J. Bacteriol. doi:10.1128/jb.05596-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Genome sequence of Enterobacter mori type strain LMG 25706, a

Genome sequence of Enterobacter mori type strain LMG 25706, a JB Accepts, published online ahead of print on 20 May 2011 J. Bacteriol. doi:10.1128/jb.05200-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Title: Genome sequence of lineage III Listeria monocytogenes strain HCC23

Title: Genome sequence of lineage III Listeria monocytogenes strain HCC23 JB Accepts, published online ahead of print on 20 May 2011 J. Bacteriol. doi:10.1128/jb.05236-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

This is the accepted version of this conference paper: Buckingham, Lawrence and Hogan, James and Mann, Scott

This is the accepted version of this conference paper: Buckingham, Lawrence and Hogan, James and Mann, Scott QUT Digital Repository: http://eprints.qut.edu.au/ This is the accepted version of this conference paper: Buckingham, Lawrence and Hogan, James and Mann, Scott and Wirges, Sally (2010) BLAST Atlas : a

More information

Corynebacterium pseudotuberculosis genome sequencing: Final Report

Corynebacterium pseudotuberculosis genome sequencing: Final Report Summary To provide an invaluable resource to assist in the development of diagnostics and vaccines against caseous lymphadenitis (CLA), the sequencing of the genome of a virulent, United Kingdom Corynebacterium

More information

Molecular Biology: DNA sequencing

Molecular Biology: DNA sequencing Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

Computational Biology 2. Pawan Dhar BII

Computational Biology 2. Pawan Dhar BII Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Genome Analysis. Bacterial genome projects

Genome Analysis. Bacterial genome projects Genome Analysis Bacterial Genome sequencing does this help us in the investigation of adaptive responses/regulatory systems? Genome Sequencing Projects strategy & methods annotation Comparative genomics

More information

JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi: /jb

JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi: /jb JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi:10.1128/jb.05345-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Functional annotation of metagenomes

Functional annotation of metagenomes Functional annotation of metagenomes Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction Functional analysis Objectives:

More information

Antimicrobial Agents and Chemotherapy New Data Letter

Antimicrobial Agents and Chemotherapy New Data Letter AAC Accepted Manuscript Posted Online 15 August 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.01519-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 Antimicrobial Agents

More information

Bio-Reagent Services. Custom Gene Services. Gateway to Smooth Molecular Biology! Your Innovation Partner in Drug Discovery!

Bio-Reagent Services. Custom Gene Services. Gateway to Smooth Molecular Biology! Your Innovation Partner in Drug Discovery! Bio-Reagent Services Custom Gene Services Gateway to Smooth Molecular Biology! Gene Synthesis Mutagenesis Mutant Libraries Plasmid Preparation sirna and mirna Services Large-scale DNA Sequencing GenPool

More information

Mate-pair library data improves genome assembly

Mate-pair library data improves genome assembly De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate

More information

A Robust Method for Finding the Automated Best Matched Genes Based on Grouping Similar Fragments of Large-Scale References for Genome Assembly

A Robust Method for Finding the Automated Best Matched Genes Based on Grouping Similar Fragments of Large-Scale References for Genome Assembly S S symmetry Article A Robust Method for Finding the Automated Best Matched Genes Based on Grouping Similar Fragments of Large-Scale References for Genome Assembly Jaehee Jung 1, Jong Im Kim 2, Young-Sik

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist

More information

Detection of Mobile Genetic Elements (MGEs) in Bacterial Genomes

Detection of Mobile Genetic Elements (MGEs) in Bacterial Genomes Detection of Mobile Genetic Elements (MGEs) in Bacterial Genomes PhD student: Zheng WANG Supervisor: Professor Margaret IP Department of Microbiology, CUHK Date: 3rd Dec, 2013 Contents Introduction Methodology

More information

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06 Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift

More information

Bioinformatics Course AA 2017/2018 Tutorial 2

Bioinformatics Course AA 2017/2018 Tutorial 2 UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it

More information

JB Accepts, published online ahead of print on 26 February 2010 J. Bacteriol. doi: /jb

JB Accepts, published online ahead of print on 26 February 2010 J. Bacteriol. doi: /jb JB Accepts, published online ahead of print on 26 February 2010 J. Bacteriol. doi:10.1128/jb.00109-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Bacterial Genetics. Prof. Dr. Asem Shehabi Faculty of Medicine University of Jordan

Bacterial Genetics. Prof. Dr. Asem Shehabi Faculty of Medicine University of Jordan Bacterial Genetics Prof. Dr. Asem Shehabi Faculty of Medicine University of Jordan Bacterial Genes-1 All patterns of growth, metabolism, essential cellular structures, biological characteristics of bacteria

More information

Complete nucleotide sequence of pld-tex-kl, a 66-kb plasmid of Legionella dumoffii TEX-KL strain

Complete nucleotide sequence of pld-tex-kl, a 66-kb plasmid of Legionella dumoffii TEX-KL strain Complete nucleotide sequence of pld-tex-kl, a 66-kb plasmid of Legionella dumoffii TEX-KL strain Plasmid, 2007 Tian Qin a,*, Hideki Hirakawa b, Ken-ichiro Iida a, Kenshiro Oshima c, Masahira Hattori c,d,

More information

Bioinformatics Sequence And Genome Analysis David W Mount

Bioinformatics Sequence And Genome Analysis David W Mount Bioinformatics Sequence And Genome Analysis David W Mount We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer,

More information

Applied bioinformatics in genomics

Applied bioinformatics in genomics Applied bioinformatics in genomics Productive bioinformatics in a genome sequencing center Heiko Liesegang Warschau 2005 The omics pyramid: 1. 2. 3. 4. 5. Genome sequencing Genome annotation Transcriptomics

More information

Molecular Biology Services. Make Research Easy

Molecular Biology Services. Make Research Easy Molecular Biology Services Make Research Easy Gene-on-Demand Technology Platform Any gene conceivable in any vector you desire GenScript s Gene-on-Demand technology platform combines patented OptimumGene

More information

Protein Synthesis: From Gene RNA Protein Trait

Protein Synthesis: From Gene RNA Protein Trait Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Degenerate site - twofold degenerate site - fourfold degenerate site

Degenerate site - twofold degenerate site - fourfold degenerate site Genetic code Codon: triple base pairs defining each amino acid. Why genetic code is triple? double code represents 4 2 = 16 different information triple code: 4 3 = 64 (two much to represent 20 amino acids)

More information

Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the

Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics

More information

2 nd year Medical Students - JU Bacterial genetics. Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S.

2 nd year Medical Students - JU Bacterial genetics. Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S. 2 nd year Medical Students - JU Bacterial genetics Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S.T MSc, PhD/ UK Bacterial genetics ILOs: bacterial genome and replication

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.

1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you. Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various

More information

Genome research in eukaryotes

Genome research in eukaryotes Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Complete Report Catalogue # and Service: IR16001 rrna depletion (human, mouse, or rat) IR11081 Total RNA Sequencing (80 million reads, 2x75 bp PE) Xxxxxxx - xxxxxxxxxxxxxxxxxxxxxx

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Biol 478/595 Intro to Bioinformatics

Biol 478/595 Intro to Bioinformatics Biol 478/595 Intro to Bioinformatics September M 1 Labor Day 4 W 3 MG Database Searching Ch. 6 5 F 5 MG Database Searching Hw1 6 M 8 MG Scoring Matrices Ch 3 and Ch 4 7 W 10 MG Pairwise Alignment 8 F 12

More information

7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I

7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I 7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I For the last several lectures we have been looking at how one can manipulate prokaryotic genomes and how prokaryotic genes are regulated. In the next

More information

Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the

Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

4/3/2013. DNA Synthesis Replication of Bacterial DNA Replication of Bacterial DNA

4/3/2013. DNA Synthesis Replication of Bacterial DNA Replication of Bacterial DNA 4/3/03 3 4 5 6 7 8 9 0 Chapter 8 Microbial Genetics Terminology Genetics: The study of what genes are, how they carry information, how information is expressed, and how genes are replicated Gene: A segment

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B

Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture DNA microarray hybridization

More information

Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio

Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio 2013 Plant Management Network. Accepted for publication 21 December 2012. Published. Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio

More information

Biology 4100 Minor Assignment 1 January 19, 2007

Biology 4100 Minor Assignment 1 January 19, 2007 Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on

More information

DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule;

DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule; Evolution of knowledge about gene G. Mendel Hereditary factors W.Johannsen, 1909 G.W.Beadle, E.L.Tatum, 1945 Ingram, 1957 Actual concepts The gene hereditary unit located in chromosomes Hypotheses One

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

CHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract

CHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract CHAPTER FOUR Characterization of parasporal genes in Paenibacillus popilliae and Paenibacillus lentimorbus Abstract The parasporal gene, cry18aa1, was cloned and sequenced by Zhang et al. (4) from the

More information

Biosc10 schedule reminders

Biosc10 schedule reminders Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,

More information

Genetics. Chapter 9 - Microbial Genetics. Chromosome. Genes. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination

Genetics. Chapter 9 - Microbial Genetics. Chromosome. Genes. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination Chapter 9 - Microbial Genetics Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination Genetics Genome (The sum total of genetic material of a cell is referred to as the genome.) Chromosome

More information

MCB 102 University of California, Berkeley August 11 13, Problem Set 8

MCB 102 University of California, Berkeley August 11 13, Problem Set 8 MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without

More information

Lecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know

Lecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know Lecture 1. Basic Definitions and Nucleic Acids Basic Definitions you should already know apple DNA: Deoxyribonucleic Acid apple RNA: Ribonucleic Acid apple mrna: messenger RNA: contains the genetic information(coding

More information

Glossary of Commonly used Annotation Terms

Glossary of Commonly used Annotation Terms Glossary of Commonly used Annotation Terms Akela a general use server for the annotation group as well as other groups throughout TIGR. Annotation Notebook a link from the gene list page that is associated

More information

Chapter 15 The Human Genome Project and Genomics. Chapter 15 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning

Chapter 15 The Human Genome Project and Genomics. Chapter 15 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning Chapter 15 The Human Genome Project and Genomics Genomics Is the study of all genes in a genome Relies on interconnected databases and software to analyze sequenced genomes and to identify genes Impacts

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt

BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt Introduction to molecular biology Combining genetics, biochemistry, structural chemistry Information flow in biological systems: The Central Dogma

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

Sequence Features Contributing to Chromosomal Rearrangements in Neisseria gonorrhoeae

Sequence Features Contributing to Chromosomal Rearrangements in Neisseria gonorrhoeae Sequence Features Contributing to Chromosomal Rearrangements in Neisseria gonorrhoeae Russell Spencer-Smith, Eldho M. Varkey, Mark D. Fielder, Lori A. S. Snyder* Kingston University, School of Life Sciences,

More information

RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR

RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy

More information

Download the Lectin sequence output from

Download the Lectin sequence output from Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).

More information

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

High throughput omics and BIOINFORMATICS

High throughput omics and BIOINFORMATICS High throughput omics and BIOINFORMATICS Giuseppe D'Auria Seville, February 2009 Genomes from isolated bacteria $ $ $ $ $ $ $ $ $$ $ $ $ $ $ $ $ se q se uen q c se uen ing q c se uen ing qu c en ing c

More information

Genome Projects. Part III. Assembly and sequencing of human genomes

Genome Projects. Part III. Assembly and sequencing of human genomes Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences

More information

Design and use of synthetic regulatory small RNAs. to control gene expression in Escherichia coli

Design and use of synthetic regulatory small RNAs. to control gene expression in Escherichia coli Supplementary Discussion Design and use of synthetic regulatory small RNAs to control gene expression in Escherichia coli Seung Min Yoo, Dokyun Na, & Sang Yup Lee * Metabolic and Biomolecular Engineering

More information

BME 110 Midterm Examination

BME 110 Midterm Examination BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource

More information

Bioinformatic analysis of phage AB3, a phikmv-like virus infecting Acinetobacter baumannii

Bioinformatic analysis of phage AB3, a phikmv-like virus infecting Acinetobacter baumannii Bioinformatic analysis of phage AB3, a phikmv-like virus infecting Acinetobacter baumannii J. Zhang 1 *, X. Liu 1 * and X.-J. Li 2 1 Department of Geriatrics Medicine, The Third People s Hospital of Chongqing,

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1 BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to

More information

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.

More information

2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs?

2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs? 2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs? Answer: edna is made from mrna and not from trnas or rrnas because polyt primers are used to prime the first

More information

Mechanisms of Genetic Variation. Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display.

Mechanisms of Genetic Variation. Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 16 Mechanisms of Genetic Variation Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Mutations: Their Chemical Basis and Effects Stable, heritable

More information

Bacteria Reproduce Asexually via BINARY FISSION

Bacteria Reproduce Asexually via BINARY FISSION An Introduction to Microbial Genetics Today: Intro to Microbial Genetics Lunch pglo! Bacteria Reproduce Asexually via BINARY FISSION But, Bacteria still undergo GENETIC RECOMBINATION (combining DNA from

More information

M.Sc. Biochemistry (Colleges) onwards BHARATHIAR UNUIVERSITY, COIMBATORE

M.Sc. Biochemistry (Colleges) onwards BHARATHIAR UNUIVERSITY, COIMBATORE Page 1 of 5 SCAA Dt. 24.04.2015 BHARATHIAR UNUIVERSITY, COIMBATORE 654 046. M.SC. BIOCHEMISTRY (Revised papers for the candidates admitted from the academic year 2015-16 onwards) Note: The revised syllabi

More information

The use of bioinformatic analysis in support of HGT from plants to microorganisms. Meeting with applicants Parma, 26 November 2015

The use of bioinformatic analysis in support of HGT from plants to microorganisms. Meeting with applicants Parma, 26 November 2015 The use of bioinformatic analysis in support of HGT from plants to microorganisms Meeting with applicants Parma, 26 November 2015 WHY WE NEED TO CONSIDER HGT IN GM PLANT RA Directive 2001/18/EC As general

More information

In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features

In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features Yiliang Ding, Yin Tang, Chun Kit Kwok, Yu Zhang, Philip C. Bevilacqua & Sarah M. Assmann (2014) Seminar RNA Bioinformatics

More information

Gene Prediction Group

Gene Prediction Group Group Ben, Jasreet, Jeff, Jia, Kunal TACCTGAAAAAGCACATAATACTTATGCGTATCCGCCCTAAACACTGCCTTCTTTCTCAA AGAAGATGTCGCCGCTTTTCAACCGAACGATGTGTTCTTCGCCGTTTTCTCGGTAGTGCA TATCGATGATTCACGTTTCGGCAGTGCAGGCACCGGCGCATATTCAGGATACCGGACGCT

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

chapter eight: microbial genetics

chapter eight: microbial genetics chapter eight: microbial genetics the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material Hershey Chase, 1952

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

More information

Chapter 20 DNA Technology & Genomics. If we can, should we?

Chapter 20 DNA Technology & Genomics. If we can, should we? Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant

More information

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger

More information

Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio

Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio 2013 Plant Management Network. Accepted for publication 18 December 2012. Published. Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio John

More information

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms

More information

Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS

Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS Chapter Summary Mapping of human genes means identifying the chromosome and the position on that chromosome where a particular gene is located. Initially

More information

Curriculum Vitae. (last updated: ) Min-Soo Kim

Curriculum Vitae. (last updated: ) Min-Soo Kim Curriculum Vitae (last updated:2018-02-08) Min-Soo Kim Current Address Ph.D. Degree, Department of Biology, Kyung Hee University, 26 Kyungheedaero, Dondaemun-Gu, Seoul, 02447, Republic of Korea Tel:+82-2-961-2312

More information

Bacterial Genetics. Stijn van der Veen

Bacterial Genetics. Stijn van der Veen Bacterial Genetics Stijn van der Veen Differentiating bacterial species Morphology (shape) Composition (cell envelope and other structures) Metabolism & growth characteristics Genetics Differentiating

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

chapter eight: microbial genetics

chapter eight: microbial genetics chapter eight: microbial genetics Revised 9/15/2016 the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material

More information

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design. Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research

More information