Gene Prediction Group

Transcription

1 Group Ben, Jasreet, Jeff, Jia, Kunal TACCTGAAAAAGCACATAATACTTATGCGTATCCGCCCTAAACACTGCCTTCTTTCTCAA AGAAGATGTCGCCGCTTTTCAACCGAACGATGTGTTCTTCGCCGTTTTCTCGGTAGTGCA TATCGATGATTCACGTTTCGGCAGTGCAGGCACCGGCGCATATTCAGGATACCGGACGCT ACGGACATCGGCGTTACGGCATCGGTCATGCCGGTGCAATGGACACGGTTGCTTTGGCGG CGGGCAATATTTTATTGGGCAACGACGAAGGCACGGCCGCAATCGAAATCGCTTTGGGCG CCGTTGCCGCCGCCGATTTGGGCAGGCTGGCACAGGTGCGCTTCGGCAGCAAAGTCAAAT TCAAAATAATCGGCTTGAAAGAAGCCACCGCCCTGCGGCGCAAAAACCAAGTCTATCTGA ACCAAATACGGAGAATCACCCATGAAGCAGGTTGAACGGCGAAATAGGCAAAGCCGCTGC CCGGCAGGGTGCTGTATTTCGCCGCTTCGATAATCGAATCTTTGGAGTAGAAGCCGGAGA AGAACGGCGTACCGATCAGCGACAAATTGCCGATCAGCATAGTCAGCCAAGTAATCGGCA GGGCGGTAATCGCACCAATCACCATGATGACAGAC

2 Pipeline getorf GLIMMER3 GeneMark.hmm Clustering by Stop Codon Calculating BLAST support Obtaining consensus & Assigning Scores contigs.fna EasyGene GFF/FASTA Format trnascan-se RNAmmer IS Finder Filtering Results

3 Prediction Versions Assembly Prediction Changes Initial predictions Enhanced GLIMMER3 predictions. Included trna and rrna predictions Included high-quality IS elements Calculating support for gene predictions by BLAST. Implemented detailed scoring system. Including lower quality insertion sequences. Using parameter file when running the script Generating genome-level coordinates for GFF and FASTA files Using new version of assembly.

4 BLAST support of ab initio gene predictions The BLAST overlap ratio is calculated: Predicted CDS BLAST hits Length of overlap Length of predicted gene

5 BLAST support of ab initio gene predictions For each prediction, we calculated the overlap ratio between this particular prediction and each BLAST hit, and took the maximum ratio as the indicator of prediction confidence level Predictions fell into one of three groups All 3 ab initio programs predict the gene 2 out of 3 programs predict the gene One program predicts the gene We generated the distributions of the BLAST-prediction overlap ratio for each group

6 Frequency BLAST Overlap Ratio All Allthree Three Not well supported by BLAST Supported by BLAST Overlap Ratio Threshold = 0.8

7 Frequency Frequency Frequency Easygene_Gene Mark BLAST Overlap Ratio Gene Mark_Glimmer Overlap Ratio More Easygene_Glimmer Overlap Ratio More Overlap Ratio More

8 Gene Mark More Overlap Ratio Frequency Glimmer More Overlap Ratio Frequency Easygene More Overlap Ratio Frequency BLAST Overlap Ratio

9 Scoring strategy Score Predicted by n Programs Same Start Predicted Support by BLAST? (threshold = 0.8) Predictions by Score / / / / / / /2 or 2/ /2 or 2/2 2 1 n/a 6 3% 7 2% 8 21% 5 1% 4 6% 9 4% 3 2 5% 3% 10 55%

10 Consensus s 2,181 consensus genes were predicted Why is this number different from the number of genes we have been working with (2,108)? Genes with a score of 2 are included 73 (score 2) = 2181 genes How many genes would we expect to find? In bacterial genomes there is approximately 1 gene for every 1 kb. Length of our genome: 2,205,143 bp 2,205,143 / 1,000 = 2,205 expected genes

11 trnas (transfer RNAs) Definition: transfer RNAs are ribonucleic acids which are used during peptide synthesis to transfer amino acids to the active site of the ribosome. Predictions were made using trnascan-se A matrix representing the Bacterial code was needed: Image:

12 trnas (transfer RNAs) 65 trnas were found How do we know if our trna predictions make sense? Logically we would expect to find trnas for all of the amino acids used during protein synthesis. What did we find? trnas were found for all 20 amino acids: trnas Found Image:

13 rrnas (ribosomal RNAs) Definition: ribosomal RNAs are ribonucleic acids which code for particular subunits of the ribosome. Types of prokaryotic rrnas: 5S and 23S: compose the 50S subunit 16S: part of the 30S subunit, binds to the Shine-Delgarno sequence Logically, in Prokaryotes, rrnas are typically found in the same operon. What was the distribution of the rrnas in our strain of N. meningitidis?

14 Distribution of rrnas 12 rrnas were found Four clusters (putative operons) of rrnas were found. Each cluster contains the three rrnas: 5S, 23S, 16S The average distances between the rrnas was: 5S to 23S: 98 nt 23S to 16S: nt The average distance between all other genes was: nt

15 rrnas Do our rrna predictions make sense? It is expected that the 3 end of our 16S rrnas binds to the Shine-Delgarno sequence. Do our 16S rrnas contain the anti-shine-delgarno sequence? Alignment was viewed in MEGA: Yes, all four 16S rrnas contained the anti-shine-delgarno sequence at position 737 in the alignment.

16 IS Elements Definition: IS elements, or Insertion Sequences, are mobile genetic elements which have the ability to insert themselves into different genomes. IS Finder is a database of known IS elements. BLAST was used to determine where known IS Elements are found in our genome (extrinsic). Image:

17 More Frequency High Quality IS Elements Running BLAST to find IS Elements E-value: 10e-10 Percent coverage of the matching IS element is calculated for each hit Thresholds for IS Elements were set: No threshold: 869 IS elements 50%: 53 IS elements 90%: 17 IS elements Many matching IS elements with very little overlap. The set of 53 IS elements is used in the database Fraction of IS Element Coverage

18 Comparison of Predictions to a Reference Genome (Z2491) Feature Our Strain (4.0) Z2491 CDS trnas n/a rrnas n/a IS Elements n/a n/a

19 High-throughput Automation Can quickly generate new predictions, given a new assembly. One Perl script 11 modules, 3381 lines of code Predictions can be run on a different species without changing the code (parameter file).