HUMAN GENES 3/1/2009 STRUCTURE LOCATION FUNCTIONS
|
|
- Miles Flynn
- 5 years ago
- Views:
Transcription
1 HUMAN GENES STRUCTURE LOCATION FUNCTIONS Definition: - a polynucleotide fragment of DNA which encodes synthesis of a specific macromolecule polypeptide or RNA; - a fragment of chromosome which controls phenotypic expression of a trait (morphologic, biochemical or physiologic). Organization: GENE represents a mixture of regulatory and coding sequences; (a) proximal regulatory sequences: promoter; enhancer, silencer. (b) distal regulatory sequences: terminator; site of polyadenilation. (c) coding region: exons; introns. Gene location: - In a specific position (locus) of DNA molecule; - Separated by noncoding sequences - spacers. Borders: - There are no physical borders; - There are only functional borders related to initiation and termination of transcription. 1
2 Length of genes: average 3000bp. ex.: β globine gene 1, 5 kb insulin gene 1, 7 kb catalase gene 34 kb dystrophin gene 2,5 Mb Number of genes: About pairs of genes, 2% of genome, for 50% function is known Chromosome No of genes Length, Mb Chromosome No of genes Length, Mb Chromosome X Y No of genes Length, Mb Classification of human genes by their lenght Distribution of human genes by their length Type Short genes Medium genes Long genes Gigantic genes Supergigantic genes Examples Length of gene, kb Length of mrna, kb No of introns α-globine 0,8 0,5 2 β-globine 1,5 0,6 2 Insulin 1,7 0,4 2 IX th factor of blood coagulation 34,0 2,8 7 Catalase 34,0 1,6 12 Phenilalanindehidroginase VIII th factor of blood coagulation 90 2, , Thireoglobine ~300,0 8,7 36 Dystrophine ~2000,0 16,0 60 Length, kb % of total number < 10 23, , , , ,7 > 500 1,2 Peculiarities of structural human genes - Have a very complex structure: * may have more then one promoter or sites for initiation of transcription; * may have more initiation and STOP codons; * contain regulatory complexes; * mrna may be result of alternative splicing; Peculiarities of structural human genes - Are characterized by precise and complex space and temporal expression : * depending on type of cell; * depending on stage of development; * depending on interaction with internal and external factors. 2
3 Full length Short length Peculiarities of dystrophin gene expression Types Length of mrna, kb Muscle 14 Location of promoter 5' untranscribed end Brain 14 Intron 1 Expression Heart, Skeletal muscles Cortex Hippocampus Brain 14 Intron 1 Purkinje cells 1-Dp71 4,5-4,8 Intron 63 All, except muscles 2-Dp116 5,5 Intron 56 Peripheral nerves 3-Dp40 2,2 All, except muscles Dp140 7,5 Intron44 Neurons in embryo Dp260 Retina Functions of genes: - keep, transmit, express genetic information about : - synthesis of one or several polypeptides; - formation of one or several traits: Levels of gene expression: Rh gene: alleles D (Rh+) and d (Rh-) 1 st level molecular synthesis of a polypeptide 2 nd level cellular synthesis of a functional protein which ensures: formation of cellular structure a metabolic pathway a signaling pathway, etc. 3 rd level organism morphologic, physiologic or biochemical trait Locus 1p Function ensure blood group Rh Important for donor-recipient compatibility during blood transfusion and mother-child Levels of expression of Rh+: I molecular synthesis of acyl-protein Rh II cellular presence of Ag D (Rh) on surface of erythrocytes III organism Rh-pozitiv blood group Levels of expression of Rh-: I molecular absence of Rh acyl-protein II cellular absence of Ag D (Rh) on surface of erythrocytes III organism Rh-negativ blood group PAH gene : alleles >200 Locus 12q.24.1 Function encodes enzyme phenilalanin-hydroxilase responsible for transformation Phe Tyr Important because mutation in gene determine phenilketonuria autosomal recessive disease, with somatic and mental retardation Levels of expression of PAH: I molecular synthesis of phenilalanin-hydroxilase II cellular transformation of Phe in Tyr synthesis of melanin, neural transporters etc. III organism normal pigmentation, normal SNC 3
4 FBN1 gene: alleles >400 Locus - 15q21.1 Function encodes synthesis of fibrillin 1 Important because mutations may induce Marfan syndrome Levels of expression of FBN1: I molecular synthesis of fibrillin 1 II cellular formation of extracellular matrix III organism resistance of conjunctive tissue Consequences of mutations in FBN1 Molecular effect abnormal fibrillin 1 Cellular effect abnormal extracellular matrix Effect at organism level peleiotropy, decreasing of conjunctive tissue in several systems. Bones Blood vessels Ocular Dilatarea rădăcinei aortei Arachnodactylia Normal function of valves MS: dilatation of aorta Aneurism Properties of genes: Replication and repair Specificity Dosage Stability Interaction with envirnment Pleiotropy Variability Properties of genes: 1. Replication, repair 4
5 2. Specificity: - encodes a specific molecule; - encodes a specific trait; 3. Dosage in phenotype a specific quantity of final product is synthesed; 4. Stability during multiple generations: - But may be unstable genes genes for Ig.; genes for receptors, genes for interaction with environment. 5. Genes have permanent interaction with environment (internal genetic nad external non-genetic): - Factors may change gene expression;!!! The same trait may have different expression in different persons depending on environment. 7. Variability Genes may have several molecular forms polyallelism: 6. Pleiotropy Primary pleiotropy (ex. Marfan syndrome) is determined by multiple action of protein; Secondary pleiotropy (ex. anemia HbS) determined by secondary consequences of effects of mutant protein. - mutations changed sequence new variants of gene alleles Ex. AB0 system a pair of loci on chromosome 9 with different alleles A1, A2, B şi O - Multiple alleles determine several variants of the trait; - A trait controlled by several alleles polymorphic trait; - 25% of human genes have multiple alleles. Classification of human genes Classification of human genes 2. Depending on place of activity: 1. Depending on final product: 1 st class genes for rrna 2 nd class genes for mrna and proteins 3 rd class genes for trna and rrna active in all cells active in specific tissues 3. Depending on stage of development permanently active active during prenatal development active during pubertal development active only in adults 5
6 4. Depending on interaction with environment stabile genes instable genes Require specific condition for expression (Hb S); Silent genes gene for collinesterase during anesthesia with specific drugs respiratory break; Genes with individual specific expression; * There are genes with non-complete penetration. 5. Depending on level of expression: normomorphic isomorphic hypomorphic hypermorphic amorphic neomorphic 6. Depending on number of copies per genome; single-copy genes repetitive genes 7. Depending on the function of final products: - Enzymes - 31,2%; - Modulators of protein synthesis - 13, 6 % - Receptors; - Transcription factors; - Proteins of intracellular and extracellular matrix; - Membrane transporters; - Signaling proteins; - Hormones; - Ig. 50% Location of genes: - genes are located on chromosomes; - each gene has a specific location locus: in identical loci of homologus chromosomes allele genes; in different loci non-allele genes; -Genes of a chromosome linkage group; -Genes of o chromosome located very close represent haplotype, a group of genes which may have common regulatory regions effect of position; Location of genes: - Distribution of genes is randomized: there are chromosomes with high or low density; there are fragments of chromosomes with high or low density; - Some genes are members of repetitive or non - repetitive families; 6
7 - Genes located in autososmes are responsible for autosomal traits, are inherited not depending on gender; - Genes located on gonosomes are responsible for sex-linked traits which are inherited specifically by genders: X-linked traits; Y-linked traits (holandric) Allele and non-allele genes Allele genes: Genele alele: - Located in identical loci in homologous chromosomes; - Responsible for a trait or alternative variants of the trait; -May have several alleles polyalellism; - a person may contain 2 alleles or 1 allele genes on X or Y in men; - în cazul heterozigoţiei (gene alele diferite) se manifestă alela cu o activitate mai mare: - sunt alele cu activitate moderată normomorfe; - sunt alele cu activitate mărită hipermorfe; - sunt alele cu activitate mică hipomorfe; - sunt alele neactive amorfe; - sunt alele cu funcţie nouă neomorfe. - efectul fenotipic al genei depinde de genotip, de interacţiunile alelice, interacţiunile nealelice şi factorii de mediu; Allele genes: -Segregate during meiosis, -During fecundation are distributed randomly and ensure segregation of traits Mendel s laws; -Each person has one maternal and one paternal allele; if alleles are identical homozygote ; if alleles are different - heterozygote. - AA or aa homozygote - Aa heterozygote - X A Y or X a Y hemizygote Non-allele genes: - Located in different loci; - Are responsible for different traits; - Are inherited: linked if are located on the same chromosome (linkage group or haplotype); independently if they are located on diffeent chromosomes; - Their expression is: independent; may be effect of position; may be non-allele interactions; may cooperate in complex traits. 7
8 Genetic map distribution of genes in chromosome, relative distance depends on % of recombination (crossing-over); 1% c-o = 1cM 8
DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule;
Evolution of knowledge about gene G. Mendel Hereditary factors W.Johannsen, 1909 G.W.Beadle, E.L.Tatum, 1945 Ingram, 1957 Actual concepts The gene hereditary unit located in chromosomes Hypotheses One
More informationToday s lecture: Types of mutations and their impact on protein function
Today s lecture: Types of mutations and their impact on protein function Mutations can be classified by their effect on the DNA sequence OR the encoded protein 1 From my Lecture 4 (10/1): Classification
More informationPhysical Anthropology 1 Milner-Rose
Physical Anthropology 1 Milner-Rose Chapter 3 Genetics: Reproducing Life and Producing Variation Our Origins By Clark Spencer Larsen Natural Selection operates on the levels of the 1. living, behaving
More informationBranches of Genetics
Branches of Genetics 1. Transmission genetics Classical genetics or Mendelian genetics 2. Molecular genetics chromosomes, DNA, regulation of gene expression recombinant DNA, biotechnology, bioinformatics,
More informationChapter 2. Alleles at a Single Locus. Introduction
Chapter 2 Alleles at a Single Locus Figure 2-1 A flower called Camellia showing co-dominance of the red and white alleles of flower colour. (Flickr- darwin cruz-cc BY 2.0) Introduction mutation is any
More informationOverview of Human Genetics
Overview of Human Genetics 1 Structure and function of nucleic acids. 2 Structure and composition of the human genome. 3 Mendelian genetics. Lander et al. (Nature, 2001) MAT 394 (ASU) Human Genetics Spring
More informationThe gene. Fig. 1. The general structure of gene
The gene is the basic unit of heredity and carries the genetic information for a given protein and/or RNA molecule. In biochemical terms a gene represents a fragment of deoxyribonucleic acid (DNA), which
More informationUnit 1 Human cells. 1. Division and differentiation in human cells
Unit 1 Human cells 1. Division and differentiation in human cells Stem cells Describe the process of differentiation. Explain how differentiation is brought about with reference to genes. Name the two
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationUNIT MOLECULAR GENETICS AND BIOTECHNOLOGY
UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY Standard B-4: The student will demonstrate an understanding of the molecular basis of heredity. B-4.1-4,8,9 Effective June 2008 All Indicators in Standard B-4
More informationCIE Biology A-level Topic 16: Inherited change
CIE Biology A-level Topic 16: Inherited change Notes Meiosis is a form of cell division that gives rise to genetic variation. The main role of meiosis is production of haploid gametes as cells produced
More informationA primer on the structure and function of genes
A primer on the structure and function of genes What is the definition of a gene? GENE: the genetic element which is transmitted from parent to offspring during the process of reproduction that influences
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationCollege- and Career Readiness Standards for Science Genetics
College- and Career Readiness Genetics Mississippi 2018 GEN.1 Structure and Function of DNA GEN.1A Students will demonstrate that all cells contain genetic material in the form of DNA. GEN.1A.1 Model the
More informationBICD100 Midterm (10/27/10) KEY
BICD100 Midterm (10/27/10) KEY 1. Variation in tail length is characteristic of some dog breeds, such as Pembroke Welsh Corgis, which sometimes show a bob tail (short tail) phenotype (see illustration
More informationIntroduction to Genome Biology
Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure
More informationCentral Dogma of genetics: DNA -> Transcription -> RNA -> Translation > Protein
Genetics Midterm 1 Chapter 1: Purines: Adenine (double bond), Guanine (Triple Bond) Pyrimidines: Thymine (double bond), Cytosine (Triple Bond), Uracil Central Dogma of genetics: DNA -> Transcription ->
More informationGENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique.
Introduction: GENETICS 3M = first look at genetics (study of inheritance, discovery of chromosomes, genes, dominant and recessive alleles and the DNA molecule within chromosomes) 2D = not much in fact,
More informationJumping Into Your Gene Pool: Understanding Genetic Test Results
Jumping Into Your Gene Pool: Understanding Genetic Test Results Susan A. Berry, MD Professor and Director Division of Genetics and Metabolism Department of Pediatrics University of Minnesota Acknowledgment
More informationBefore starting, write your name on the top of each page Make sure you have all pages
Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will
More informationPOPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the
POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)
More informationMolecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
More informationHow about the genes? Biology or Genes? DNA Structure. DNA Structure DNA. Proteins. Life functions are regulated by proteins:
Biology or Genes? Biological variation Genetics This is what we think of when we say biological differences Race implies genetics Physiology Not all physiological variation is genetically mediated Tanning,
More informationIntroduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland
Introduction to Basic Human Genetics Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Training Course in Sexual and Reproductive Health Research Geneva
More informationDNA & Protein Synthesis. The source and the process!
DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information
More informationAP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene
AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with
More informationIntroduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the
Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics
More informationLecture 2: Biology Basics Continued. Fall 2018 August 23, 2018
Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,
More informationHuman Genetics. Final examination Practical Part
1. Define the terms. Give examples: Gene imprinting Aneuploidy Balanced chromosomal aberration Unbalanced chromosomal aberration Reproduction disorder Anticipation HDNB Genetic disease Cancerogenesis Monofactoriale
More informationPractical Part. 1. Define the terms. Give examples:
Practical Part Human Genetics. Final examination 2015 1. Define the terms. Give examples: Allele Allele heterogeneity Amorphic gene Aneuploid gamete Aneuploide clone Aneuploidy Anticipation Autosomal gene
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationGenetics & Human Inheritance
Genetics & Human Inheritance BIO 105 Chapter 20 Vocabulary Alleles alternate forms of a gene Trait some characteristic Homozygous individuals that contain two copies of the same allele Heterozygous individuals
More informationGenetics and Human Inheritance
BIOLOGY OF HUMANS Concepts, Applications, and Issues Fifth Edition Judith Goodenough Betty McGuire 20 Genetics and Human Inheritance Lecture Presentation Anne Gasc Hawaii Pacific University and University
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationLecture 2: Biology Basics Continued
Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationDESIGNER GENES SAMPLE TOURNAMENT
DESIGNER GENES SAMPLE TOURNAMENT PART ONE- GENETICS PROBLEMS In dogs, the inheritance of hair color involves a gene (B) for black hair and a gene (b) for brown hair. A dominant (C) is also involved. It
More informationChapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and
More informationDNA AND PROTEIN SYSNTHESIS
DNA AND PROTEIN SYSNTHESIS DNA AND PROTEIN SYSNTHESIS DNA PROTEIN What structures are found in the nucleus? What is a gene? Gene: a portion of DNA that contains the codes (instructions) for one protein.
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationGenomics and Biotechnology
Genomics and Biotechnology Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase RETROVIRUSES Cell Free Protein
More information9/3/2009. DNA RNA Proteins. DNA Genetic program RNAs Ensure synthesis of proteins Proteins Ensure all cellular functions Carbohydrates (sugars) Energy
Structure Properties Functions of the cell Chemical organization of the cell Based on molecular substrate : DNA contains information RNA ensures protein synthesis Proteins ensure vitality Relations between
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationBasic Concepts of Human Genetics
Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes
More informationSolution key. c) Consider the following perturbations in different components of this signaling pathway in cells.
Solution key Question 1 During a summer hike you suddenly spy a grizzly bear. This triggers a fight or flight response activating the signaling pathway that is shown on last Page. a) Circle the best option.
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationHuman Chromosomes Section 14.1
Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families
More informationUnderstanding Genes & Mutations. John A Phillips III May 16, 2005
Understanding Genes & Mutations John A Phillips III May 16, 2005 Learning Objectives Understand gene structure Become familiar with genetic & mutation databases Be able to find information on genetic variation
More informationAP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene
AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with
More informationObserving Patterns in Inherited Traits. Chapter 11
Observing Patterns in Inherited Traits Chapter 11 Impacts, Issues: The Color of Skin Like most human traits, skin color has a genetic basis; more than 100 gene products affect the synthesis and deposition
More informationAGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1
AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationBST227 Introduction to Statistical Genetics
Introduction to Statistical Genetics BIO 227 Lecture 1 Introduction and Overview of Genetic http BST227 Introduction to Statistical Genetics Lecture 1: Introduction and Overview of Genetic Disease http://aryeelab.org/bst227
More information! Allele Interactions
Chapter 4!Extensions to Mendelian Genetics! Allele Interactions 1 INTRODUCTION Mendelian inheritance describes inheritance patterns that obey two laws Law of segregation Law of independent assortment Simple
More informationHuether and McCance: Understanding Pathophysiology, 5 th Edition
Huether and McCance: Understanding Pathophysiology, 5 th Edition Chapter 02: Genes and Genetic Diseases Test Bank MULTIPLE CHOICE 1. A nurse recalls the basic components of DNA are: a. Pentose sugars and
More informationGenetics Transcription Translation Replication
Genetics Transcription Translation Replication 1. Which statement best describes the relationship between an allele and a gene? A. An allele is a variation of a gene that can be expressed as a phenotype.
More informationChapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity
Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationIntroduction to genome biology Sandrine Dudoit and Robert Gentleman
Introduction to genome biology Sandrine Dudoit and Robert Gentleman University of California, Berkeley Outline Cells and cell division DNA structure and replication Proteins Central dogma: transcription,
More informationGENETICS. +he is considered the +he developed the of genetics that still apply today
GENETICS MENDELIAN GENETICS *A Historical Representation of Mendel s Work ---Who was Gregor Mendel? +he is considered the +he developed the of genetics that still apply today ---How did Mendel describe
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationHuman Molecular Genetics Assignment 3 (Week 3)
Human Molecular Genetics Assignment 3 (Week 3) Q1. Which one of the following is an effect of a genetic mutation? a. Prevent the synthesis of a normal protein. b. Alters the function of the resulting protein
More informationCHAPTER 5 Principle of Genetics Review
CHAPTER 5 Principle of Genetics Review I. Mendel s Investigations Gregor Johann Mendel Hybridized peas 1856-1864 Formulated Principles of Heredity published in 1866 II. Chromosomal Basis of Inheritance
More informationMolecular basis of genetic variation
Molecular basis of genetic variation Trygve Bakken Department of Neurosciences University of California, San Diego presented by Thomas Nichols, PhD Department of Statistics & Warwick Manufacturing Group
More informationBIOSTAT516 Statistical Methods in Genetic Epidemiology Autumn 2005 Handout1, prepared by Kathleen Kerr and Stephanie Monks
Rationale of Genetic Studies Some goals of genetic studies include: to identify the genetic causes of phenotypic variation develop genetic tests o benefits to individuals and to society are still uncertain
More informationYou are genetically unique
BNF 5106 - Lecture 1 Genetics, Genes, Genetic codes, and Mutations You are genetically unique Since each parent has 23 pairs of chromosomes, the probability that each parent gives twice the same chromosomes
More informationBiology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005
1 Biology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005 Honor Pledge: I have neither given nor received any unauthorized help on this exam: Name Printed: Signature: 1. (2 pts) If you see the following
More informationFORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence
FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after
More informationIntroduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland
Introduction to Basic Human Genetics Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Training Course in Sexual and Reproductive Health Research Geneva
More informationReview Quizzes Chapters 11-16
Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationAP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?
The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationMolecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name:
Molecular Genetics FNAL page 1 of 7 1. (5 points) Here is the sequence of the template strand of a DNA fragment: GAAGTACGACGAGTTCGACCTTCTCGCGAGCGCA Which of the following would be the complementary, nontemplate,
More informationWhat would this eye color phenomenon be called?
Name: School: Total Score: / 50 1 1. Which nitrogenous bases present in DNA are purines, and which are pyrimidines? What is the main difference between a purine and a pyrimidine? (2 points) 2. To the right
More informationDifferences between prokaryotes & eukaryotes. Gene function
GENE REGULATION Differences between prokaryotes & eukaryotes Gene function Description of Prokaryotic Chromosome and E.coli Review Differences between Prokaryotic & Eukaryotic Chromosomes Four differences
More informationBiology Evolution Dr. Kilburn, page 1 Mutation and genetic variation
Biology 203 - Evolution Dr. Kilburn, page 1 In this unit, we will look at the mechanisms of evolution, largely at the population scale. Our primary focus will be on natural selection, but we will also
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationBIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D. Steve Thompson:
BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 DNA transcription and regulation We ve seen how the principles
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationEdexcel (B) Biology A-level
Edexcel (B) Biology A-level Topic 8: Origins of Genetic Variation Notes Meiosis is reduction division. The main role of meiosis is production of haploid gametes as cells produced by meiosis have half the
More informationProtein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
More informationName AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009
MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationProofreading and Correction
How about a mistake? Just as we make mistakes, so can the replication process Wrong bases may be inserted into the new DNA Nucleotide bases may be damaged (ie. By radiation) When this happens, mutations
More informationGoal 3. Friday, May 10, 13
Goal 3 Bio.3.1 Explain how traits are determined by the structure and function of DNA. Bio.3.2 Understand how the environment, and/or the interaction of alleles, influences the expression of genetic traits.
More informationBeyond Mendel s Laws of Inheritance
Chapter 14. Beyond Mendel s Laws of Inheritance 1 Extending Mendelian genetics Mendel worked with a simple system peas are genetically simple most traits are controlled by a single gene each gene has only
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationMitochondrial analysis in Forensic Scienses
Mitochondrial analysis in Forensic Scienses 2011 Classification of human genome Genome 3.2 Gb Genic and related (25 %) Coding and regulatory (1.5 %) Non-coding (23.5% - introns, pseudogenes) Extragenic
More informationUnit 2: Biological basis of life, heredity, and genetics
Unit 2: Biological basis of life, heredity, and genetics 1 Issues with Darwin's Evolutionary Theory??? 2 Cells - General Composition Organelles - substructures in the cell which do different things involved
More informationQ.2: Write whether the statement is true or false. Correct the statement if it is false.
Solved Exercise Biology (II) Q.1: Fill In the blanks. i. is the basic unit of biological information. ii. A sudden change in the structure of a gene is called. iii. is the chance of an event to occur.
More informationWould expect variation to disappear Variation in traits persists (Example: freckles show up in unfreckled parents offspring!)
Genetics Early Ideas about Heredity People knew that sperm and eggs transmitted information about traits Blending theory mother and father s traits blended together Problem: Would expect variation to disappear
More informationBasic Concepts of Human Genetics
Basic oncepts of Human enetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. ne pair is called sex chromosomes
More informationChapter 9. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination
Chapter 9 Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination 1 Flow of Genetics NA replication (DNA => DNA; RNA => RNA) Replication Reverse transcription (RNA => DNA) Gene Expression
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular
More informationCOMPETITOR NAMES: TEAM NAME: TEAM NUMBER:
COMPETITOR NAMES: TEAM NAME: TEAM NUMBER: Section 1:Crosses In a fictional species of mice, with species name Mus SciOlyian, fur color is controlled by a single autosomal gene. The allele for brown fur
More informationTest Bank for Molecular Cell Biology 7th Edition by Lodish
Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques
More information