HUMAN GENES 3/1/2009 STRUCTURE LOCATION FUNCTIONS

Size: px
Start display at page:

Download "HUMAN GENES 3/1/2009 STRUCTURE LOCATION FUNCTIONS"

Transcription

1 HUMAN GENES STRUCTURE LOCATION FUNCTIONS Definition: - a polynucleotide fragment of DNA which encodes synthesis of a specific macromolecule polypeptide or RNA; - a fragment of chromosome which controls phenotypic expression of a trait (morphologic, biochemical or physiologic). Organization: GENE represents a mixture of regulatory and coding sequences; (a) proximal regulatory sequences: promoter; enhancer, silencer. (b) distal regulatory sequences: terminator; site of polyadenilation. (c) coding region: exons; introns. Gene location: - In a specific position (locus) of DNA molecule; - Separated by noncoding sequences - spacers. Borders: - There are no physical borders; - There are only functional borders related to initiation and termination of transcription. 1

2 Length of genes: average 3000bp. ex.: β globine gene 1, 5 kb insulin gene 1, 7 kb catalase gene 34 kb dystrophin gene 2,5 Mb Number of genes: About pairs of genes, 2% of genome, for 50% function is known Chromosome No of genes Length, Mb Chromosome No of genes Length, Mb Chromosome X Y No of genes Length, Mb Classification of human genes by their lenght Distribution of human genes by their length Type Short genes Medium genes Long genes Gigantic genes Supergigantic genes Examples Length of gene, kb Length of mrna, kb No of introns α-globine 0,8 0,5 2 β-globine 1,5 0,6 2 Insulin 1,7 0,4 2 IX th factor of blood coagulation 34,0 2,8 7 Catalase 34,0 1,6 12 Phenilalanindehidroginase VIII th factor of blood coagulation 90 2, , Thireoglobine ~300,0 8,7 36 Dystrophine ~2000,0 16,0 60 Length, kb % of total number < 10 23, , , , ,7 > 500 1,2 Peculiarities of structural human genes - Have a very complex structure: * may have more then one promoter or sites for initiation of transcription; * may have more initiation and STOP codons; * contain regulatory complexes; * mrna may be result of alternative splicing; Peculiarities of structural human genes - Are characterized by precise and complex space and temporal expression : * depending on type of cell; * depending on stage of development; * depending on interaction with internal and external factors. 2

3 Full length Short length Peculiarities of dystrophin gene expression Types Length of mrna, kb Muscle 14 Location of promoter 5' untranscribed end Brain 14 Intron 1 Expression Heart, Skeletal muscles Cortex Hippocampus Brain 14 Intron 1 Purkinje cells 1-Dp71 4,5-4,8 Intron 63 All, except muscles 2-Dp116 5,5 Intron 56 Peripheral nerves 3-Dp40 2,2 All, except muscles Dp140 7,5 Intron44 Neurons in embryo Dp260 Retina Functions of genes: - keep, transmit, express genetic information about : - synthesis of one or several polypeptides; - formation of one or several traits: Levels of gene expression: Rh gene: alleles D (Rh+) and d (Rh-) 1 st level molecular synthesis of a polypeptide 2 nd level cellular synthesis of a functional protein which ensures: formation of cellular structure a metabolic pathway a signaling pathway, etc. 3 rd level organism morphologic, physiologic or biochemical trait Locus 1p Function ensure blood group Rh Important for donor-recipient compatibility during blood transfusion and mother-child Levels of expression of Rh+: I molecular synthesis of acyl-protein Rh II cellular presence of Ag D (Rh) on surface of erythrocytes III organism Rh-pozitiv blood group Levels of expression of Rh-: I molecular absence of Rh acyl-protein II cellular absence of Ag D (Rh) on surface of erythrocytes III organism Rh-negativ blood group PAH gene : alleles >200 Locus 12q.24.1 Function encodes enzyme phenilalanin-hydroxilase responsible for transformation Phe Tyr Important because mutation in gene determine phenilketonuria autosomal recessive disease, with somatic and mental retardation Levels of expression of PAH: I molecular synthesis of phenilalanin-hydroxilase II cellular transformation of Phe in Tyr synthesis of melanin, neural transporters etc. III organism normal pigmentation, normal SNC 3

4 FBN1 gene: alleles >400 Locus - 15q21.1 Function encodes synthesis of fibrillin 1 Important because mutations may induce Marfan syndrome Levels of expression of FBN1: I molecular synthesis of fibrillin 1 II cellular formation of extracellular matrix III organism resistance of conjunctive tissue Consequences of mutations in FBN1 Molecular effect abnormal fibrillin 1 Cellular effect abnormal extracellular matrix Effect at organism level peleiotropy, decreasing of conjunctive tissue in several systems. Bones Blood vessels Ocular Dilatarea rădăcinei aortei Arachnodactylia Normal function of valves MS: dilatation of aorta Aneurism Properties of genes: Replication and repair Specificity Dosage Stability Interaction with envirnment Pleiotropy Variability Properties of genes: 1. Replication, repair 4

5 2. Specificity: - encodes a specific molecule; - encodes a specific trait; 3. Dosage in phenotype a specific quantity of final product is synthesed; 4. Stability during multiple generations: - But may be unstable genes genes for Ig.; genes for receptors, genes for interaction with environment. 5. Genes have permanent interaction with environment (internal genetic nad external non-genetic): - Factors may change gene expression;!!! The same trait may have different expression in different persons depending on environment. 7. Variability Genes may have several molecular forms polyallelism: 6. Pleiotropy Primary pleiotropy (ex. Marfan syndrome) is determined by multiple action of protein; Secondary pleiotropy (ex. anemia HbS) determined by secondary consequences of effects of mutant protein. - mutations changed sequence new variants of gene alleles Ex. AB0 system a pair of loci on chromosome 9 with different alleles A1, A2, B şi O - Multiple alleles determine several variants of the trait; - A trait controlled by several alleles polymorphic trait; - 25% of human genes have multiple alleles. Classification of human genes Classification of human genes 2. Depending on place of activity: 1. Depending on final product: 1 st class genes for rrna 2 nd class genes for mrna and proteins 3 rd class genes for trna and rrna active in all cells active in specific tissues 3. Depending on stage of development permanently active active during prenatal development active during pubertal development active only in adults 5

6 4. Depending on interaction with environment stabile genes instable genes Require specific condition for expression (Hb S); Silent genes gene for collinesterase during anesthesia with specific drugs respiratory break; Genes with individual specific expression; * There are genes with non-complete penetration. 5. Depending on level of expression: normomorphic isomorphic hypomorphic hypermorphic amorphic neomorphic 6. Depending on number of copies per genome; single-copy genes repetitive genes 7. Depending on the function of final products: - Enzymes - 31,2%; - Modulators of protein synthesis - 13, 6 % - Receptors; - Transcription factors; - Proteins of intracellular and extracellular matrix; - Membrane transporters; - Signaling proteins; - Hormones; - Ig. 50% Location of genes: - genes are located on chromosomes; - each gene has a specific location locus: in identical loci of homologus chromosomes allele genes; in different loci non-allele genes; -Genes of a chromosome linkage group; -Genes of o chromosome located very close represent haplotype, a group of genes which may have common regulatory regions effect of position; Location of genes: - Distribution of genes is randomized: there are chromosomes with high or low density; there are fragments of chromosomes with high or low density; - Some genes are members of repetitive or non - repetitive families; 6

7 - Genes located in autososmes are responsible for autosomal traits, are inherited not depending on gender; - Genes located on gonosomes are responsible for sex-linked traits which are inherited specifically by genders: X-linked traits; Y-linked traits (holandric) Allele and non-allele genes Allele genes: Genele alele: - Located in identical loci in homologous chromosomes; - Responsible for a trait or alternative variants of the trait; -May have several alleles polyalellism; - a person may contain 2 alleles or 1 allele genes on X or Y in men; - în cazul heterozigoţiei (gene alele diferite) se manifestă alela cu o activitate mai mare: - sunt alele cu activitate moderată normomorfe; - sunt alele cu activitate mărită hipermorfe; - sunt alele cu activitate mică hipomorfe; - sunt alele neactive amorfe; - sunt alele cu funcţie nouă neomorfe. - efectul fenotipic al genei depinde de genotip, de interacţiunile alelice, interacţiunile nealelice şi factorii de mediu; Allele genes: -Segregate during meiosis, -During fecundation are distributed randomly and ensure segregation of traits Mendel s laws; -Each person has one maternal and one paternal allele; if alleles are identical homozygote ; if alleles are different - heterozygote. - AA or aa homozygote - Aa heterozygote - X A Y or X a Y hemizygote Non-allele genes: - Located in different loci; - Are responsible for different traits; - Are inherited: linked if are located on the same chromosome (linkage group or haplotype); independently if they are located on diffeent chromosomes; - Their expression is: independent; may be effect of position; may be non-allele interactions; may cooperate in complex traits. 7

8 Genetic map distribution of genes in chromosome, relative distance depends on % of recombination (crossing-over); 1% c-o = 1cM 8

DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule;

DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule; Evolution of knowledge about gene G. Mendel Hereditary factors W.Johannsen, 1909 G.W.Beadle, E.L.Tatum, 1945 Ingram, 1957 Actual concepts The gene hereditary unit located in chromosomes Hypotheses One

More information

Today s lecture: Types of mutations and their impact on protein function

Today s lecture: Types of mutations and their impact on protein function Today s lecture: Types of mutations and their impact on protein function Mutations can be classified by their effect on the DNA sequence OR the encoded protein 1 From my Lecture 4 (10/1): Classification

More information

Physical Anthropology 1 Milner-Rose

Physical Anthropology 1 Milner-Rose Physical Anthropology 1 Milner-Rose Chapter 3 Genetics: Reproducing Life and Producing Variation Our Origins By Clark Spencer Larsen Natural Selection operates on the levels of the 1. living, behaving

More information

Branches of Genetics

Branches of Genetics Branches of Genetics 1. Transmission genetics Classical genetics or Mendelian genetics 2. Molecular genetics chromosomes, DNA, regulation of gene expression recombinant DNA, biotechnology, bioinformatics,

More information

Chapter 2. Alleles at a Single Locus. Introduction

Chapter 2. Alleles at a Single Locus. Introduction Chapter 2 Alleles at a Single Locus Figure 2-1 A flower called Camellia showing co-dominance of the red and white alleles of flower colour. (Flickr- darwin cruz-cc BY 2.0) Introduction mutation is any

More information

Overview of Human Genetics

Overview of Human Genetics Overview of Human Genetics 1 Structure and function of nucleic acids. 2 Structure and composition of the human genome. 3 Mendelian genetics. Lander et al. (Nature, 2001) MAT 394 (ASU) Human Genetics Spring

More information

The gene. Fig. 1. The general structure of gene

The gene. Fig. 1. The general structure of gene The gene is the basic unit of heredity and carries the genetic information for a given protein and/or RNA molecule. In biochemical terms a gene represents a fragment of deoxyribonucleic acid (DNA), which

More information

Unit 1 Human cells. 1. Division and differentiation in human cells

Unit 1 Human cells. 1. Division and differentiation in human cells Unit 1 Human cells 1. Division and differentiation in human cells Stem cells Describe the process of differentiation. Explain how differentiation is brought about with reference to genes. Name the two

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Crash-course in genomics

Crash-course in genomics Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is

More information

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY Standard B-4: The student will demonstrate an understanding of the molecular basis of heredity. B-4.1-4,8,9 Effective June 2008 All Indicators in Standard B-4

More information

CIE Biology A-level Topic 16: Inherited change

CIE Biology A-level Topic 16: Inherited change CIE Biology A-level Topic 16: Inherited change Notes Meiosis is a form of cell division that gives rise to genetic variation. The main role of meiosis is production of haploid gametes as cells produced

More information

A primer on the structure and function of genes

A primer on the structure and function of genes A primer on the structure and function of genes What is the definition of a gene? GENE: the genetic element which is transmitted from parent to offspring during the process of reproduction that influences

More information

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.

More information

College- and Career Readiness Standards for Science Genetics

College- and Career Readiness Standards for Science Genetics College- and Career Readiness Genetics Mississippi 2018 GEN.1 Structure and Function of DNA GEN.1A Students will demonstrate that all cells contain genetic material in the form of DNA. GEN.1A.1 Model the

More information

BICD100 Midterm (10/27/10) KEY

BICD100 Midterm (10/27/10) KEY BICD100 Midterm (10/27/10) KEY 1. Variation in tail length is characteristic of some dog breeds, such as Pembroke Welsh Corgis, which sometimes show a bob tail (short tail) phenotype (see illustration

More information

Introduction to Genome Biology

Introduction to Genome Biology Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure

More information

Central Dogma of genetics: DNA -> Transcription -> RNA -> Translation > Protein

Central Dogma of genetics: DNA -> Transcription -> RNA -> Translation > Protein Genetics Midterm 1 Chapter 1: Purines: Adenine (double bond), Guanine (Triple Bond) Pyrimidines: Thymine (double bond), Cytosine (Triple Bond), Uracil Central Dogma of genetics: DNA -> Transcription ->

More information

GENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique.

GENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique. Introduction: GENETICS 3M = first look at genetics (study of inheritance, discovery of chromosomes, genes, dominant and recessive alleles and the DNA molecule within chromosomes) 2D = not much in fact,

More information

Jumping Into Your Gene Pool: Understanding Genetic Test Results

Jumping Into Your Gene Pool: Understanding Genetic Test Results Jumping Into Your Gene Pool: Understanding Genetic Test Results Susan A. Berry, MD Professor and Director Division of Genetics and Metabolism Department of Pediatrics University of Minnesota Acknowledgment

More information

Before starting, write your name on the top of each page Make sure you have all pages

Before starting, write your name on the top of each page Make sure you have all pages Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will

More information

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)

More information

Molecular Genetics of Disease and the Human Genome Project

Molecular Genetics of Disease and the Human Genome Project 9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit

More information

How about the genes? Biology or Genes? DNA Structure. DNA Structure DNA. Proteins. Life functions are regulated by proteins:

How about the genes? Biology or Genes? DNA Structure. DNA Structure DNA. Proteins. Life functions are regulated by proteins: Biology or Genes? Biological variation Genetics This is what we think of when we say biological differences Race implies genetics Physiology Not all physiological variation is genetically mediated Tanning,

More information

Introduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland

Introduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Introduction to Basic Human Genetics Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Training Course in Sexual and Reproductive Health Research Geneva

More information

DNA & Protein Synthesis. The source and the process!

DNA & Protein Synthesis. The source and the process! DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information

More information

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with

More information

Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the

Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics

More information

Lecture 2: Biology Basics Continued. Fall 2018 August 23, 2018

Lecture 2: Biology Basics Continued. Fall 2018 August 23, 2018 Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,

More information

Human Genetics. Final examination Practical Part

Human Genetics. Final examination Practical Part 1. Define the terms. Give examples: Gene imprinting Aneuploidy Balanced chromosomal aberration Unbalanced chromosomal aberration Reproduction disorder Anticipation HDNB Genetic disease Cancerogenesis Monofactoriale

More information

Practical Part. 1. Define the terms. Give examples:

Practical Part. 1. Define the terms. Give examples: Practical Part Human Genetics. Final examination 2015 1. Define the terms. Give examples: Allele Allele heterogeneity Amorphic gene Aneuploid gamete Aneuploide clone Aneuploidy Anticipation Autosomal gene

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Genetics & Human Inheritance

Genetics & Human Inheritance Genetics & Human Inheritance BIO 105 Chapter 20 Vocabulary Alleles alternate forms of a gene Trait some characteristic Homozygous individuals that contain two copies of the same allele Heterozygous individuals

More information

Genetics and Human Inheritance

Genetics and Human Inheritance BIOLOGY OF HUMANS Concepts, Applications, and Issues Fifth Edition Judith Goodenough Betty McGuire 20 Genetics and Human Inheritance Lecture Presentation Anne Gasc Hawaii Pacific University and University

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

Lecture 2: Biology Basics Continued

Lecture 2: Biology Basics Continued Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

DESIGNER GENES SAMPLE TOURNAMENT

DESIGNER GENES SAMPLE TOURNAMENT DESIGNER GENES SAMPLE TOURNAMENT PART ONE- GENETICS PROBLEMS In dogs, the inheritance of hair color involves a gene (B) for black hair and a gene (b) for brown hair. A dominant (C) is also involved. It

More information

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and

More information

DNA AND PROTEIN SYSNTHESIS

DNA AND PROTEIN SYSNTHESIS DNA AND PROTEIN SYSNTHESIS DNA AND PROTEIN SYSNTHESIS DNA PROTEIN What structures are found in the nucleus? What is a gene? Gene: a portion of DNA that contains the codes (instructions) for one protein.

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Genomics and Biotechnology

Genomics and Biotechnology Genomics and Biotechnology Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase RETROVIRUSES Cell Free Protein

More information

9/3/2009. DNA RNA Proteins. DNA Genetic program RNAs Ensure synthesis of proteins Proteins Ensure all cellular functions Carbohydrates (sugars) Energy

9/3/2009. DNA RNA Proteins. DNA Genetic program RNAs Ensure synthesis of proteins Proteins Ensure all cellular functions Carbohydrates (sugars) Energy Structure Properties Functions of the cell Chemical organization of the cell Based on molecular substrate : DNA contains information RNA ensures protein synthesis Proteins ensure vitality Relations between

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

Basic Concepts of Human Genetics

Basic Concepts of Human Genetics Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes

More information

Solution key. c) Consider the following perturbations in different components of this signaling pathway in cells.

Solution key. c) Consider the following perturbations in different components of this signaling pathway in cells. Solution key Question 1 During a summer hike you suddenly spy a grizzly bear. This triggers a fight or flight response activating the signaling pathway that is shown on last Page. a) Circle the best option.

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Human Chromosomes Section 14.1

Human Chromosomes Section 14.1 Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families

More information

Understanding Genes & Mutations. John A Phillips III May 16, 2005

Understanding Genes & Mutations. John A Phillips III May 16, 2005 Understanding Genes & Mutations John A Phillips III May 16, 2005 Learning Objectives Understand gene structure Become familiar with genetic & mutation databases Be able to find information on genetic variation

More information

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with

More information

Observing Patterns in Inherited Traits. Chapter 11

Observing Patterns in Inherited Traits. Chapter 11 Observing Patterns in Inherited Traits Chapter 11 Impacts, Issues: The Color of Skin Like most human traits, skin color has a genetic basis; more than 100 gene products affect the synthesis and deposition

More information

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

BST227 Introduction to Statistical Genetics

BST227 Introduction to Statistical Genetics Introduction to Statistical Genetics BIO 227 Lecture 1 Introduction and Overview of Genetic http BST227 Introduction to Statistical Genetics Lecture 1: Introduction and Overview of Genetic Disease http://aryeelab.org/bst227

More information

! Allele Interactions

! Allele Interactions Chapter 4!Extensions to Mendelian Genetics! Allele Interactions 1 INTRODUCTION Mendelian inheritance describes inheritance patterns that obey two laws Law of segregation Law of independent assortment Simple

More information

Huether and McCance: Understanding Pathophysiology, 5 th Edition

Huether and McCance: Understanding Pathophysiology, 5 th Edition Huether and McCance: Understanding Pathophysiology, 5 th Edition Chapter 02: Genes and Genetic Diseases Test Bank MULTIPLE CHOICE 1. A nurse recalls the basic components of DNA are: a. Pentose sugars and

More information

Genetics Transcription Translation Replication

Genetics Transcription Translation Replication Genetics Transcription Translation Replication 1. Which statement best describes the relationship between an allele and a gene? A. An allele is a variation of a gene that can be expressed as a phenotype.

More information

Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity

Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Introduction to genome biology Sandrine Dudoit and Robert Gentleman

Introduction to genome biology Sandrine Dudoit and Robert Gentleman Introduction to genome biology Sandrine Dudoit and Robert Gentleman University of California, Berkeley Outline Cells and cell division DNA structure and replication Proteins Central dogma: transcription,

More information

GENETICS. +he is considered the +he developed the of genetics that still apply today

GENETICS. +he is considered the +he developed the of genetics that still apply today GENETICS MENDELIAN GENETICS *A Historical Representation of Mendel s Work ---Who was Gregor Mendel? +he is considered the +he developed the of genetics that still apply today ---How did Mendel describe

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

Human Molecular Genetics Assignment 3 (Week 3)

Human Molecular Genetics Assignment 3 (Week 3) Human Molecular Genetics Assignment 3 (Week 3) Q1. Which one of the following is an effect of a genetic mutation? a. Prevent the synthesis of a normal protein. b. Alters the function of the resulting protein

More information

CHAPTER 5 Principle of Genetics Review

CHAPTER 5 Principle of Genetics Review CHAPTER 5 Principle of Genetics Review I. Mendel s Investigations Gregor Johann Mendel Hybridized peas 1856-1864 Formulated Principles of Heredity published in 1866 II. Chromosomal Basis of Inheritance

More information

Molecular basis of genetic variation

Molecular basis of genetic variation Molecular basis of genetic variation Trygve Bakken Department of Neurosciences University of California, San Diego presented by Thomas Nichols, PhD Department of Statistics & Warwick Manufacturing Group

More information

BIOSTAT516 Statistical Methods in Genetic Epidemiology Autumn 2005 Handout1, prepared by Kathleen Kerr and Stephanie Monks

BIOSTAT516 Statistical Methods in Genetic Epidemiology Autumn 2005 Handout1, prepared by Kathleen Kerr and Stephanie Monks Rationale of Genetic Studies Some goals of genetic studies include: to identify the genetic causes of phenotypic variation develop genetic tests o benefits to individuals and to society are still uncertain

More information

You are genetically unique

You are genetically unique BNF 5106 - Lecture 1 Genetics, Genes, Genetic codes, and Mutations You are genetically unique Since each parent has 23 pairs of chromosomes, the probability that each parent gives twice the same chromosomes

More information

Biology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005

Biology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005 1 Biology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005 Honor Pledge: I have neither given nor received any unauthorized help on this exam: Name Printed: Signature: 1. (2 pts) If you see the following

More information

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after

More information

Introduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland

Introduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Introduction to Basic Human Genetics Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Training Course in Sexual and Reproductive Health Research Geneva

More information

Review Quizzes Chapters 11-16

Review Quizzes Chapters 11-16 Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off? The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Molecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name:

Molecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name: Molecular Genetics FNAL page 1 of 7 1. (5 points) Here is the sequence of the template strand of a DNA fragment: GAAGTACGACGAGTTCGACCTTCTCGCGAGCGCA Which of the following would be the complementary, nontemplate,

More information

What would this eye color phenomenon be called?

What would this eye color phenomenon be called? Name: School: Total Score: / 50 1 1. Which nitrogenous bases present in DNA are purines, and which are pyrimidines? What is the main difference between a purine and a pyrimidine? (2 points) 2. To the right

More information

Differences between prokaryotes & eukaryotes. Gene function

Differences between prokaryotes & eukaryotes. Gene function GENE REGULATION Differences between prokaryotes & eukaryotes Gene function Description of Prokaryotic Chromosome and E.coli Review Differences between Prokaryotic & Eukaryotic Chromosomes Four differences

More information

Biology Evolution Dr. Kilburn, page 1 Mutation and genetic variation

Biology Evolution Dr. Kilburn, page 1 Mutation and genetic variation Biology 203 - Evolution Dr. Kilburn, page 1 In this unit, we will look at the mechanisms of evolution, largely at the population scale. Our primary focus will be on natural selection, but we will also

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D. Steve Thompson:

BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D. Steve Thompson: BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 DNA transcription and regulation We ve seen how the principles

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Edexcel (B) Biology A-level

Edexcel (B) Biology A-level Edexcel (B) Biology A-level Topic 8: Origins of Genetic Variation Notes Meiosis is reduction division. The main role of meiosis is production of haploid gametes as cells produced by meiosis have half the

More information

Protein Synthesis: From Gene RNA Protein Trait

Protein Synthesis: From Gene RNA Protein Trait Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains

More information

Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009

Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009 MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose

More information

Winter Quarter Midterm Exam

Winter Quarter Midterm Exam 1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned

More information

Proofreading and Correction

Proofreading and Correction How about a mistake? Just as we make mistakes, so can the replication process Wrong bases may be inserted into the new DNA Nucleotide bases may be damaged (ie. By radiation) When this happens, mutations

More information

Goal 3. Friday, May 10, 13

Goal 3. Friday, May 10, 13 Goal 3 Bio.3.1 Explain how traits are determined by the structure and function of DNA. Bio.3.2 Understand how the environment, and/or the interaction of alleles, influences the expression of genetic traits.

More information

Beyond Mendel s Laws of Inheritance

Beyond Mendel s Laws of Inheritance Chapter 14. Beyond Mendel s Laws of Inheritance 1 Extending Mendelian genetics Mendel worked with a simple system peas are genetically simple most traits are controlled by a single gene each gene has only

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Mitochondrial analysis in Forensic Scienses

Mitochondrial analysis in Forensic Scienses Mitochondrial analysis in Forensic Scienses 2011 Classification of human genome Genome 3.2 Gb Genic and related (25 %) Coding and regulatory (1.5 %) Non-coding (23.5% - introns, pseudogenes) Extragenic

More information

Unit 2: Biological basis of life, heredity, and genetics

Unit 2: Biological basis of life, heredity, and genetics Unit 2: Biological basis of life, heredity, and genetics 1 Issues with Darwin's Evolutionary Theory??? 2 Cells - General Composition Organelles - substructures in the cell which do different things involved

More information

Q.2: Write whether the statement is true or false. Correct the statement if it is false.

Q.2: Write whether the statement is true or false. Correct the statement if it is false. Solved Exercise Biology (II) Q.1: Fill In the blanks. i. is the basic unit of biological information. ii. A sudden change in the structure of a gene is called. iii. is the chance of an event to occur.

More information

Would expect variation to disappear Variation in traits persists (Example: freckles show up in unfreckled parents offspring!)

Would expect variation to disappear Variation in traits persists (Example: freckles show up in unfreckled parents offspring!) Genetics Early Ideas about Heredity People knew that sperm and eggs transmitted information about traits Blending theory mother and father s traits blended together Problem: Would expect variation to disappear

More information

Basic Concepts of Human Genetics

Basic Concepts of Human Genetics Basic oncepts of Human enetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. ne pair is called sex chromosomes

More information

Chapter 9. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination

Chapter 9. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination Chapter 9 Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination 1 Flow of Genetics NA replication (DNA => DNA; RNA => RNA) Replication Reverse transcription (RNA => DNA) Gene Expression

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular

More information

COMPETITOR NAMES: TEAM NAME: TEAM NUMBER:

COMPETITOR NAMES: TEAM NAME: TEAM NUMBER: COMPETITOR NAMES: TEAM NAME: TEAM NUMBER: Section 1:Crosses In a fictional species of mice, with species name Mus SciOlyian, fur color is controlled by a single autosomal gene. The allele for brown fur

More information

Test Bank for Molecular Cell Biology 7th Edition by Lodish

Test Bank for Molecular Cell Biology 7th Edition by Lodish Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques

More information