Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
|
|
- Kelley McLaughlin
- 5 years ago
- Views:
Transcription
1 Ensembl workshop Thomas Randall, PhD bioinformatics.unc.edu handouts, papers, datasets
2 Ensembl is a joint project between EMBL - EBI and the Sanger Institute to develop a free software system which produces and maintains annotation on selected eukaryotic genomes.
3 Ensembl Release 54 (May 2009) new release approx every 2 months improvements in assembly/annotation of older genome builds new genome builds Importation of genome databases (Drosophila recently) Improvements/changes to interface and or new precompiled annotations, etc. OR
4 Ensembl vs UCSC Browser Based on same genome builds easier to view older builds in UCSC Some annotation tracks overlap, some do not Complementary should know both UCSC easier to upload and display custom tracks Ensembl more comprehensive, customizable downloading (BioMart) Visual display of Ensembl better (my opinion) UCSC more stable, upgrades done transparently Track IDs in both are very confusing Both linked to Galaxy ( large scale file manipulation toolkit
5 Annotation Addition of positional, functional, regulatory and evolutionary datasets to a raw assembled genome. Genes, exon-intron boundaries, protein products, mirnas, alternative splicing, transcriptional start sites, expression, orthologs, paralogs, repeats, structural features, syntenic relationships, ChIP-chip data... Based on experimental data, computational predictions, and pipelines that are a mix of both are used. Displayed as tracks one track = one form of annotation Constantly changing!
6 One gene = 4.9 transcripts (in vivo complications) ENCODE: Comprehensive annotation of 1% of the human genome Nature 447: 799
7 Many pre-compiled bioinformatics analyses orthologs in all other Ensembl genomes multiple sequence alignments of above mapping of publicly available genome wide data ChIPchip etc. (features) Variety of gene prediction pipelines available (Havana, Vega, Ensembl) in addition to experimentally derived annotations Extensive links out to other databases Annotation is a mix of experimental and computationally derived sources Quality of annotation available for specific genomes depends largely on level of research on a genome: human/mouse good, opossum mediocre to non-existent
8 Ensembl architecture used by others
9 Annotation differs between groups Ensembl Gene ID - Ensembl stable gene identifiers are mapped between releases. In case a gene model changes dramatically, the old stable identifier may be retired and a new one assigned. Vega: Vega genes (Ashurst, et al., 2005) represent a set of manually annotated genes. Finished genomic sequence is analysed on a clone-by-clone basis using a combination of similarity searches against DNA and protein databases, as well as a series of ab initio gene predictions (GENSCAN, GENEWISE). Gene structures are annotated on the basis of human interpretation of the combined supportive evidence generated during sequence analysis. Havana: Annotation produced by the Human And Vertebrate Analysis and Annotation (Havana) group at Sanger Institute is publicly available from various websites such as Vega, Ensembl, and UCSC. Our annotation puts special emphasis on splice variants and pseudogenes, two areas still underdeveloped in automated annotation systems, and poly-adenylation features. Also, where other systems concentrate on or are limited to protein coding genes, many Havana transcripts are annotated without a protein coding region. These transcripts may function as noncoding RNAs or they may be incomplete gene fragments for which we cannot yet determine the CDS. We require that all annotated gene structures (transcripts) are supported by transcriptional evidence, either from cdna, EST or protein sequences, and as such not all annotated transcripts are necessarily complete. UCSC: The UCSC Genes track shows gene predictions based on data from RefSeq, Genbank, CCDS and UniProt. This is a moderately conservative set of predictions, requiring the support of one GenBank RNA sequence plus at least one additional line of evidence. The RefSeq RNAs are an exception to this, requiring no additional evidence. The track includes both protein-coding and putative non-coding transcripts. Some of these non-coding transcripts may actually code for protein, but the evidence for the associated protein is weak at best. Compared to RefSeq, this gene set has generally about 10% more protein-coding genes, approximately five times as many putative non-coding genes, and about twice as many splice variants.
10 Gene Identifiers (in silico complications)
11 ID chaos
12 Genome Builds All genomes are in different states of completion Gaps are being filled, corrections are being made New techniques or ideas for improvements to assemblies Human Feb 2009 assembly = hg19 = GRCh37 Mar 2006 assembly = hg18 = NCBI36 May 2004 assembly = hg17 = NCBI35 July 2003 assembly = hg16 = NCBI34 NM_ (CFTR) hg18: chr hg17: chr hg16: chr Mouse July 2007 = mm9 = NCBI37 Feb 2006 = mm8 = NCBI36.. May 2004 = mm5 = NCBI33 NM_ (PEMT) hg18: chr hg17: chr hg16: chr
13 Genome Builds Chromosome specific change Between build 35&36, Human Most recent human release - Spring 2009 Most recent mouse release - Sumer 2009 chr1 chr2 chr3 chr4 chr5 chr6 chr7 chr8 chr9 chr10 chr11 chr12 chr13 chr14 chr15 chr16 chr17 chr18 chr19 chr20 chr21 chr22 chrx chry yes yes yes yes no yes yes no yes yes no yes no no no no no no no no no yes yes yes
14 Overview Navigation of site gene, location, variations Customizing annotations BLAT Exporting data Custom Tracks (importing data) BioMart (brief)
15 Help and Documentation page
16 Location tab Gene tab Navigation of Ensembl Many individual summaries Currently displayed summary
17 Each summary of data Is customizable Configure this page customize region based on annotations of interest
18 Customization of view based on different categories of annotation
19 Multi BlastView Blast and Blat Ensembl provides access to the BLAST and BLAT sequence similarity search algorithms via a single interface. It allows for simultaneous searches with up to 30 query sequences against multiple target species. BLAT Blast like alignment tool Both are faster than BLAST, good for short sequence alignments, near identity
20 BLAT Blast Like Alignment ~500 X faster than BLAST Tool Default alignment tool in Ensembl Manages the sequence database differently than BLAST Good for aligning small sequences, oligos Best for alignments of near identity used in resequencing projects to compare against a reference genome Both UCSC and Ensembl do BLAT Ensembl output links to underlying genomes Ensembl better Kent, 2002 Genome Res. 12: 656 Ensembl BLAST is slow
21 Exporting Data from Ensembl Use Export Gene Data function from the Gene tab Use Export information about region function from Location tab Use BioMart for exporting larger custom datasets Use Ensembl FTP download to grab raw genome wide data
22 Exporting from Gene tab Most useful for downloading sequence of entire gene with flanking region and desired features
23 Export options Choose type of sequence to export
24 There are several options for saving the file. One is to use Save page as. When the Save As Window appears, type in a filename and an extension such as.txt. The resulting file that is saved to your desktop can then be directly dragged into Vector NTI. Also, copy and paste into Word/Notepad
25 Exporting from Location tab
26 There are several options for saving the file. One is to use Save page as. When the Save As Window appears, type in the filename using.gb as extension. The resulting file that is saved to your desktop can then be directly dragged into Vector NTI with features.
27 Importing data Add/manage custom data Start at any Location tab Click on Add/manage Choose upload Close window to display as a track
28 BioMart example: Download coding regions for all genes on human chr22 Database: Ensembl 52, Homo sapiens genes Filters Region: chr22 Gene, ID list limit: HGNC symbol Attributes Data type: Sequences Header: turn off all Ensembl Attributes, Associated gene name Sequences: choose coding sequence Result: 955 ORFs in concatenated FASTA format
29 No tool is an island In genome queries, multiple tools required Interaction between tools is often the limiting factor ??? see PLOS Comp Biol 4 e121 for discussion on the interaction of these tools
ab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationUCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
More informationWeek 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
More informationThe Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
More informationGuided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
More informationAnnotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationGenomics: Genome Browsing & Annota3on
Genomics: Genome Browsing & Annota3on Lecture 4 of 4 Introduc/on to BioMart Dr Colleen J. Saunders, PhD South African National Bioinformatics Institute/MRC Unit for Bioinformatics Capacity Development,
More informationApplied Bioinformatics
Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement
More informationuser s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
More informationAligning GENCODE and RefSeq transcripts By EMBL-EBI and NCBI
Aligning GENCODE and RefSeq transcripts By EMBL-EBI and NCBI Joannella Morales, Ph.D. LRG Project Manager jmorales@ebi.ac.uk contact@lrg-sequence.org https://www.lrg-sequence.org https://www.ensembl.org
More informationAgenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
More informationBrowser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationThe human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.
Data mining in Ensembl with BioMart Worked Example The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Which other genes related to human
More informationChimp BAC analysis: Adapted by Wilson Leung and Sarah C.R. Elgin from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. Michael R.
Chimp BAC analysis: Adapted by Wilson Leung and Sarah C.R. Elgin from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. Michael R. Brent Prerequisites: BLAST exercise: Detecting and Interpreting Genetic
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More information9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
More informationBriefly, this exercise can be summarised by the follow flowchart:
Workshop exercise Data integration and analysis In this exercise, we would like to work out which GWAS (genome-wide association study) SNP associated with schizophrenia is most likely to be functional.
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationTraining materials.
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationIntroduction to Sequencher. Tom Randall Center for Bioinformatics
Introduction to Sequencher Tom Randall Center for Bioinformatics tarandal@email.unc.edu Introduction Importing, viewing and manipulating chromatographs Trimming chromatographs Assembly into contigs Editing
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationUsing the Genome Browser: A Practical Guide. Travis Saari
Using the Genome Browser: A Practical Guide Travis Saari What is it for? Problem: Bioinformatics programs produce an overwhelming amount of data Difficult to understand anything from the raw data Data
More informationWeb-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September
More informationIdentifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M.
Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Brent Prerequisites: A Simple Introduction to NCBI BLAST Resources: The GENSCAN
More informationINTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet
INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and
More informationAnnotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
More informationTutorial section. VEGA, the genome browser with a difference
VEGA, the genome browser with a difference Keywords: vertebrate, annotation, database, manual, curation Abstract The Vertebrate Genome Annotation (Vega) database is a community resource for browsing manual
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationIntroduction to NGS analyses
Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationOverview: GQuery Entrez human and amylase Search Pubmed Gene Gene: collected information about gene loci AMY1A Genomic context Summary
Visualizing Whole Genomes The UCSC Human Genome Browser: Hands-on Exercise What do you do with a whole genome sequence once it is complete? Most genome-wide analyses require having the data, but not necessarily
More informationSupplementary Online Material. the flowchart of Supplemental Figure 1, with the fraction of known human loci retained
SOM, page 1 Supplementary Online Material Materials and Methods Identification of vertebrate mirna gene candidates The computational procedure used to identify vertebrate mirna genes is summarized in the
More informationHUMAN GENOME BIOINFORMATICS. Tore Samuelsson, Dec 2009
HUMAN GENOME BIOINFORMATICS Tore Samuelsson, Dec 2009 The sequenced (gray filled) and unsequenced (white) portions of the human genome. Peter F.R. Little Genome Res. 2005; 15: 1759-1766 Human genome organisation
More informationBacterial Genome Annotation
Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control
More informationChimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
More informationBioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More informationBME 110 Midterm Examination
BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationRNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationTranscriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
More informationLab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009)
Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009) Prerequisites: BLAST Exercise: An In-Depth Introduction to NCBI BLAST Familiarity
More informationAaditya Khatri. Abstract
Abstract In this project, Chimp-chunk 2-7 was annotated. Chimp-chunk 2-7 is an 80 kb region on chromosome 5 of the chimpanzee genome. Analysis with the Mapviewer function using the NCBI non-redundant database
More informationIntroduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
More informationHands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
More informationAccess to genes and genomes with. Ensembl. Worked Example & Exercises
Access to genes and genomes with Ensembl Worked Example & Exercises September 2006 1 CONTENTS WORKED EXAMPLE... 2 BROWSING ENSEMBL... 21 Exercises... 21 Answers... 22 BIOMART... 25 Exercises... 25 Answers...
More informationBrowsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Emily Perry Ensembl Outreach Project Leader EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
More informationOutline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions
Outline Introduction to ab initio and evidence-based gene finding Overview of computational gene predictions Different types of eukaryotic gene predictors Common types of gene prediction errors Wilson
More informationTIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationKlinisk kemisk diagnostik BIOINFORMATICS
Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,
More informationMAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES.
MAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES. Table of Contents Examples 1 Sample Analyses 5 Examples: Introduction to Examples While these examples can be followed
More informationChimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang
Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang Ruth Howe Bio 434W April 1, 2010 INTRODUCTION De novo annotation is the process by which a finished genomic sequence is searched for
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationGenome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
More informationOverview of the next two hours...
Overview of the next two hours... Before tea Session 1, Browser: Introduction Ensembl Plants and plant variation data Hands-on Variation in the Ensembl browser Displaying your data in Ensembl After tea
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationSeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen
SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen The tutorial is designed to take you through the steps necessary to access SNP data from the primary database resources:
More informationTranscription Start Sites Project Report
Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationEnsembl Tools. EBI is an Outstation of the European Molecular Biology Laboratory.
Ensembl Tools EBI is an Outstation of the European Molecular Biology Laboratory. Questions? We ve muted all the mics Ask questions in the Chat box in the webinar interface I will check the Chat box periodically
More informationAnnotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
More informationMethods and Algorithms for Gene Prediction
Methods and Algorithms for Gene Prediction Chaochun Wei 韦朝春 Sc.D. ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Shanghai Jiao Tong University Shanghai Center for Bioinformation Technology 5/12/2011 K-J-C
More informationSmall Exon Finder User Guide
Small Exon Finder User Guide Author Wilson Leung wleung@wustl.edu Document History Initial Draft 01/09/2011 First Revision 08/03/2014 Current Version 12/29/2015 Table of Contents Author... 1 Document History...
More informationAnalysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.
More informationAn Introduction to the package geno2proteo
An Introduction to the package geno2proteo Yaoyong Li January 24, 2018 Contents 1 Introduction 1 2 The data files needed by the package geno2proteo 2 3 The main functions of the package 3 1 Introduction
More informationThe first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks.
Open Seqmonk Launch SeqMonk The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks. SeqMonk Analysis Page 1 Create
More informationBIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1
BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1 Bioinformatics Databases http://bioboot.github.io/bioinf525_w17/module1/#1.1 Dr. Barry Grant Jan 2017 Overview: The purpose of this lab session is
More informationEnsembl: A New View of Genome Browsing
28 TECHNICAL NOTES EMBnet.news 15.3 Ensembl: A New View of Genome Browsing Giulietta M. Spudich and Xosé M. Fernández- Suárez European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxon, Cambs,
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationAssemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz
Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Table of Contents Supplementary Note 1: Unique Anchor Filtering Supplementary Figure
More informationComparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs.
Page 1 REMINDER: BMI 214 Industry Night Comparative Genomics Russ B. Altman BMI 214 CS 274 Location: Here (Thornton 102), on TV too. Time: 7:30-9:00 PM (May 21, 2002) Speakers: Francisco De La Vega, Applied
More informationAgenda. Annotation of Drosophila. Muller element nomenclature. Annotation: Adding labels to a sequence. GEP Drosophila annotation projects 01/03/2018
Agenda Annotation of Drosophila January 2018 Overview of the GEP annotation project GEP annotation strategy Types of evidence Analysis tools Web databases Annotation of a single isoform (walkthrough) Wilson
More informationAnnotating Fosmid 14p24 of D. Virilis chromosome 4
Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome
More informationDNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences
DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences Huiqing Liu Hao Han Jinyan Li Limsoon Wong Institute for Infocomm Research, 21 Heng Mui Keng Terrace,
More informationHomework 4. Due in class, Wednesday, November 10, 2004
1 GCB 535 / CIS 535 Fall 2004 Homework 4 Due in class, Wednesday, November 10, 2004 Comparative genomics 1. (6 pts) In Loots s paper (http://www.seas.upenn.edu/~cis535/lab/sciences-loots.pdf), the authors
More informationGenome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
More informationTraining materials.
Training materials - Ensembl training materials are protected by a CC BY license - http://creativecommons.org/licenses/by/4.0/ - If you wish to re-use these materials, please credit Ensembl for their creation
More informationRNA-Seq Analysis. August Strand Genomics, Inc All rights reserved.
RNA-Seq Analysis August 2014 Strand Genomics, Inc. 2014. All rights reserved. Contents Introduction... 3 Sample import... 3 Quantification... 4 Novel exon... 5 Differential expression... 12 Differential
More informationNCBI & Other Genome Databases. BME 110/BIOL 181 CompBio Tools
NCBI & Other Genome Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2011 Admin Reading Dummies Ch 3 Assigned Review: "The impact of next-generation sequencing technology on genetics" by E.
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationBrowsing Genomes with Ensembl
April Feb 2006 2007 Browsing Genomes with Ensembl Joint project Ensembl - Project EMBL European Bioinformatics Institute (EBI) Wellcome Trust Sanger Institute Produce accurate, automatic genome annotation
More informationEnsembl and ENA. High level overview and use cases. Denise Carvalho-Silva. Ensembl Outreach Team
Ensembl and ENA High level overview and use cases Denise Carvalho-Silva Ensembl Outreach Team On behalf of Ensembl and ENA teams European Molecular Biology Laboratories Euroepan Bioinformatics Institute
More informationRegulation of eukaryotic transcription:
Promoter definition by mass genome annotation data: in silico primer extension EMBNET course Bioinformatics of transcriptional regulation Jan 28 2008 Christoph Schmid Regulation of eukaryotic transcription:
More informationIntroduc)on to Databases and Resources Biological Databases and Resources
Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationGo to Bottom Left click WashU Epigenome Browser. Click
Now you are going to look at the Human Epigenome Browswer. It has a more sophisticated but weirder interface than the UCSC Genome Browser. All the data that you will view as tracks is in reality just files
More informationEvolutionary Genetics. LV Lecture with exercises 6KP. Databases
Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP Databases HS2018 Bioinformatics - R R Assignment The Minimalistic Approach!2 Bioinformatics - R Possible Exam Questions for R: Q1: The function
More information