Ensembl and ENA. High level overview and use cases. Denise Carvalho-Silva. Ensembl Outreach Team
|
|
|
- Barrie Gaines
- 5 years ago
- Views:
Transcription
1 Ensembl and ENA High level overview and use cases Denise Carvalho-Silva Ensembl Outreach Team On behalf of Ensembl and ENA teams European Molecular Biology Laboratories Euroepan Bioinformatics Institute SME Bioinformatics Forum Barcelona 8-9 October 2012
2 Outline Ensembl project: background and goals Data available Data access and Ensembl tools Use cases: Ensembl and ENA Ensembl Outreach and Support Acknowledgements
3 Ensembl project Launched in 1999: before the release of the draft of the human genome Joint project between the EBI and WTSI launched in March 2000
4 Goals Provide comprehensive annotation of genomes + many more Integrate the annotation with other biological data Make them all publicly available
5 Ensembl: an integration point 66 vertebrate genomes Release 68 July 2012
6 Annotation of non-vertebrate genomes Extends the use of Ensembl to other species Wider taxonomic range (v15, 354 genomes) 6 launched in 2009
7 Data available in Ensembl 68 Gene annotation for 66 vetebrate species Variation data for 19 species Comparative Genomics data for 69 species Regulation data for 16 species
8 Data access: browser sites pre.ensembl.org archive.ensembl.org
9 Data access: BioMart web interface to export Ensembl data no programming skills required DATASET FILTER ATTRIBUTES RESULTS
10 BioMart results Tables/sequences Export/
11 Data access: APIs and FTP Ensembl Database (open source): Perl-API, MySQL FTP download site
12 Ensembl Tools Assembly converter ID history converter Virtual Machine Region Report Variant Effect Predictor
13 Gene annotation Automatic pipeline Genome-wide determination + 63 species Manual curation Gene determination on a case-by-case by an annotator + gene lists 5 species
14 Gene annotation on the browser Exons are drawn as boxes. Filled boxes are translated (coding) exons, empty boxes are untranslated regions (UTRs). Havana (00_) Merged ( gold ) Ensembl (20_) Havana (00_) Merged ( gold ) gene set: identical annotation from Ensembl and Havana for human, mouse, zebrafish high confidence and quality
15 Biological Evidence International Nucleotide Sequence databases Protein sequence databases NCBI RefSeq RNAseq (transcriptomic) data
16 European Nucleotide Archive ENA provides a comprehensive, accessible and publicly available repository for nucleotide sequence data Data submission Data search/download
17 Use case 1 - ENA Retrieve and browse the mitochondrial genome of the cave bear (Ursus spelaeus). Mo Hassan
18 Use case 2 - Ensembl and ENA I have submitted a DNA sequence to ENA and got the ID AF Can I view this ID in Ensembl? Which gene is associated with? Which chromosome is the gene found on? What are the neighbouring genes? Is there a homologue to this gene in dog? Find the cdna alignment between the two genes Can I jump to ENA from Ensembl?
19 Use case 3 - Ensembl Our sequencing results identified a known SNP (rs ) in one of our samples in individuals from Barcelona (Spain). What is the major allele for this SNP? Is it the same in all 1000 Genomes super-populations? What is the ancestral allele? Is it conserved in vertebrates? Are there any phenotypes associated with this SNP? How many variants are associated with this phenotype? Which gene is associated to this phenotype?
20 Ensembl Outreach and Support Course online Tutorials YouTube channel Mailing lists Comments and questions?
21 Acknowledgements Funded by the Wellcome Trust, NIH-NHGRI, EU and EMBL
22 Ensembl Team Retreat 2012 Norwich, United Kingdom
23 Acknowledgements Clara Amid, Ewan Birney, Lawrence Bower, Ana Cerdeño- Tárraga, Ying Cheng, Iain Cleland, Nadeem Faruque, Richard Gibson, Neil Goodgame, Christopher Hunter, Mikyung Jang, Rasko Leinonen, Xin Liu, Arnaud Oisel, Nima Pakseresht, Sheila Plaister, Rajesh Radhakrishnan, Kethi Reddy, Stephane Rivière, Marc Rosello, Alexander Senf, Dimitriy Smirnov, Petra Ten Hoopen, Daniel Vaughan, Robert Vaughan, Vadim Zalunin and Guy Cochrane Funded by EMBL, EU, Wellcome Trust, BBSRC
24
Training materials.
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
Browsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Emily Perry Ensembl Outreach Project Leader EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
Ensembl Tools. EBI is an Outstation of the European Molecular Biology Laboratory.
Ensembl Tools EBI is an Outstation of the European Molecular Biology Laboratory. Questions? We ve muted all the mics Ask questions in the Chat box in the webinar interface I will check the Chat box periodically
Browsing Genes and Genomes with Ensembl
Training materials - - - - Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their
Training materials.
Training materials - Ensembl training materials are protected by a CC BY license - http://creativecommons.org/licenses/by/4.0/ - If you wish to re-use these materials, please credit Ensembl for their creation
Guided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
Annotating your variants: Ensembl Variant Effect Predictor (VEP) Helen Sparrow Ensembl EMBL-EBI 2nd November 2016
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
Browsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Victoria Newman Ensembl Outreach Officer EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
Ensembl: A New View of Genome Browsing
28 TECHNICAL NOTES EMBnet.news 15.3 Ensembl: A New View of Genome Browsing Giulietta M. Spudich and Xosé M. Fernández- Suárez European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxon, Cambs,
The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
In silico variant analysis: Challenges and Pitfalls
In silico variant analysis: Challenges and Pitfalls Fiona Cunningham Variation annotation coordinator EMBL-EBI www.ensembl.org Sequencing -> Variants -> Interpretation Structural variants SNP? In-dels
Gene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
Browsing Genomes with Ensembl
April Feb 2006 2007 Browsing Genomes with Ensembl Joint project Ensembl - Project EMBL European Bioinformatics Institute (EBI) Wellcome Trust Sanger Institute Produce accurate, automatic genome annotation
Genomics: Genome Browsing & Annota3on
Genomics: Genome Browsing & Annota3on Lecture 4 of 4 Introduc/on to BioMart Dr Colleen J. Saunders, PhD South African National Bioinformatics Institute/MRC Unit for Bioinformatics Capacity Development,
Types of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
The University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
Browsing Genomes with Ensembl Genomes
Browsing Genomes with Ensembl Genomes www.ensemblgenomes.org Coursebook http://www.ebi.ac.uk/~blaise/beca BECA- ILRI 16 th October 2013 Chat room: http://tinyurl.com/ensembl-nairobi TABLE OF CONTENTS Introduction
Introduc)on to Databases and Resources Biological Databases and Resources
Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs
ELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
European Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives
European Genome phenome Archive at the European Bioinformatics Institute Helen Parkinson Head of Molecular Archives What is EMBL-EBI? International, non-profit research institute Part of the European Molecular
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
1 st transplant user training workshop Versailles, 12th-13th November 2012
trans-national Infrastructure for Plant Genomic Science 1 st transplant user training workshop Versailles, 12th-13th November 2012 Paul Kersey, EMBL-EBI More people, less land Plant genome sequences, 2005
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
Briefly, this exercise can be summarised by the follow flowchart:
Workshop exercise Data integration and analysis In this exercise, we would like to work out which GWAS (genome-wide association study) SNP associated with schizophrenia is most likely to be functional.
Evolutionary Genetics. LV Lecture with exercises 6KP. Databases
Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP Databases HS2018 Bioinformatics - R R Assignment The Minimalistic Approach!2 Bioinformatics - R Possible Exam Questions for R: Q1: The function
Bioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
Overview of the next two hours...
Overview of the next two hours... Before tea Session 1, Browser: Introduction Ensembl Plants and plant variation data Hands-on Variation in the Ensembl browser Displaying your data in Ensembl After tea
Array-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
Aligning GENCODE and RefSeq transcripts By EMBL-EBI and NCBI
Aligning GENCODE and RefSeq transcripts By EMBL-EBI and NCBI Joannella Morales, Ph.D. LRG Project Manager jmorales@ebi.ac.uk contact@lrg-sequence.org https://www.lrg-sequence.org https://www.ensembl.org
to proteomics data in the PRIDE database
Interactive and computational access to proteomics data in the PRIDE database Daniel RIOS PRIDE software developer PRIDE team, Proteomics Services Group PANDA group European Bioinformatics Institute Hinxton,
Genetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
Chapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
ab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
NCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
Applied Bioinformatics
Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement
Sequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
The Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro
Comparative and Functional Genomics Comp Funct Genom 2003; 4: 71 74. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.235 Conference Review The Gene Ontology Annotation
Supplementary Information for:
Supplementary Information for: BISQUE: locus- and variant-specific conversion of genomic, transcriptomic, and proteomic database identifiers Michael J. Meyer 1,2,3,, Philip Geske 1,2,, and Haiyuan Yu 1,2,*
Protein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
Introduction to NGS analyses
Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1
Genomes with Ensembl. Dr. Giulietta Spudich CNIO, of 21
Genomes with Ensembl Dr. Giulietta Spudich CNIO, 2008 1 of 21 Overview of the day Introduction and website walk-through Hands on exercises (the browser) Introduction to BioMart (data mining) Variations
Two Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
ELIXIR: data for molecular biology and points of entry for marine scientists
ELIXIR: data for molecular biology and points of entry for marine scientists Guy Cochrane, EMBL-EBI EuroMarine 2018 General Assembly meeting 17-18 January 2018 www.elixir-europe.org Scales of molecular
Databases/Resources on the web
Databases/Resources on the web Jon K. Lærdahl jonkl@medisin.uio.no A lot of biological databases available on the web... MetaBase, the database of biological databases (1801 entries) - h p://metadatabase.org
Bioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
user s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
B I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
I nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen
SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen The tutorial is designed to take you through the steps necessary to access SNP data from the primary database resources:
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
Training materials.
Training materials - Ensembl training materials are protected by a CC BY license - http://creativecommons.org/licenses/by/4.0/ - If you wish to re-use these materials, please credit Ensembl for their creation
Analysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing
Interpreting Genome Data for Personalised Medicine. Professor Dame Janet Thornton EMBL-EBI
Interpreting Genome Data for Personalised Medicine Professor Dame Janet Thornton EMBL-EBI Deciphering a genome 3 billion bases 4 million variants 21,000 coding variants 10,000 non-synonymous variants 50-100
Overview of Health Informatics. ITI BMI-Dept
Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational
Gene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
Gene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government
G4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.
Data mining in Ensembl with BioMart Worked Example The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Which other genes related to human
Evidence of Purifying Selection in Humans. John Long Mentor: Angela Yen (Kellis Lab)
Evidence of Purifying Selection in Humans John Long Mentor: Angela Yen (Kellis Lab) Outline Background Genomes Expression Regulation Selection Goal Methods Progress Future Work Outline Background Genomes
Analysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
How to use Variant Effects Report
How to use Variant Effects Report A. Introduction to Ensembl Variant Effect Predictor B. Using RefSeq_v1 C. Using TGACv1 A. Introduction The Ensembl Variant Effect Predictor is a toolset for the analysis,
Computational Challenges in Life Sciences Research Infrastructures
Computational Challenges in Life Sciences Research Infrastructures Alvis Brazma European Bioinformatics Institute European Molecular Biology Laboratory European Bioinformatics Institute (EBI) EBI is in
White paper on de novo assembly in CLC Assembly Cell 4.0
White Paper White paper on de novo assembly in CLC Assembly Cell 4.0 June 7, 2016 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
What is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
INTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet
INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and
MAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES.
MAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES. Table of Contents Examples 1 Sample Analyses 5 Examples: Introduction to Examples While these examples can be followed
Investigating Inherited Diseases
Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise to inherited diseases.
Hands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
ChroMoS Guide (version 1.2)
ChroMoS Guide (version 1.2) Background Genome-wide association studies (GWAS) reveal increasing number of disease-associated SNPs. Since majority of these SNPs are located in intergenic and intronic regions
Niemann-Pick Type C Disease Gene Variation Database ( )
NPC-db (vs. 1.1) User Manual An introduction to the Niemann-Pick Type C Disease Gene Variation Database ( http://npc.fzk.de ) curated 2007/2008 by Dirk Dolle and Heiko Runz, Institute of Human Genetics,
Using VarSeq to Improve Variant Analysis Research
Using VarSeq to Improve Variant Analysis Research June 10, 2015 G Bryce Christensen Director of Services Questions during the presentation Use the Questions pane in your GoToWebinar window Agenda 1 Variant
Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures
Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures September 28, 2015 A 10,000 Foot View Genomics Data at NCBI Organizational
Tutorial section. VEGA, the genome browser with a difference
VEGA, the genome browser with a difference Keywords: vertebrate, annotation, database, manual, curation Abstract The Vertebrate Genome Annotation (Vega) database is a community resource for browsing manual
Introduction to Bioinformatics. What are the goals of the course? Who is taking this course? Different user needs, different approaches
Introduction to Bioinformatics Who is taking this course? Monday, November 19, 2012 Jonathan Pevsner pevsner@kennedykrieger.org Bioinformatics M.E:800.707 People with very diverse backgrounds in biology
BABELOMICS: Microarray Data Analysis
BABELOMICS: Microarray Data Analysis Madrid, 21 June 2010 Martina Marbà mmarba@cipf.es Bioinformatics and Genomics Department Centro de Investigación Príncipe Felipe (CIPF) (Valencia, Spain) DNA Microarrays
The EMBL-Bioinformatics and Data-Intensive Informatics
The EMBL-Bioinformatics and Data-Intensive Informatics Graham Cameron EMBL-EBI What is the EMBL-EBI? Non-profit organization Part of the European Molecular Biology Laboratory Based on the Wellcome Trust
Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September
Applied Bioinformatics
Applied Bioinformatics In silico and In clinico characterization of genetic variations Assistant Professor Department of Biomedical Informatics Center for Human Genetics Research ATCAAAATTATGGAAGAA ATCAAAATCATGGAAGAA
GREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
The i5k a pan-arthropoda Genome Database. Chris Childers and Monica Poelchau USDA-ARS, National Agricultural Library
The i5k Workspace@NAL: a pan-arthropoda Genome Database Chris Childers and Monica Poelchau USDA-ARS, National Agricultural Library Outline Background and overview Why join the i5k Workspace? What do we
Shannon pipeline plug-in: For human mrna splicing mutations CLC bio Genomics Workbench plug-in CLC bio Genomics Server plug-in Features and Benefits
Shannon pipeline plug-in: For human mrna splicing mutations CLC bio Genomics Workbench plug-in CLC bio Genomics Server plug-in Features and Benefits Cytognomix introduces a line of Shannon pipeline plug-ins
SNPchiMp v A database to disentangle the SNPchip jungle. Latest update: January 2014.
SNPchiMp v1.0.1 A database to disentangle the SNPchip jungle. Latest update: January 2014. dbsnp builds: 136 (for BTAU4.2) and 137 (for UMD3.1 and BTAU4.6) Please cite: Nicolazzi, E.L.*, Picciolini M.*,
Introduction to EMBL-EBI.
Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,
Variant prioritization in NGS studies: Annotation and Filtering "
Variant prioritization in NGS studies: Annotation and Filtering Colleen J. Saunders (PhD) DST/NRF Innovation Postdoctoral Research Fellow, South African National Bioinformatics Institute/MRC Unit for Bioinformatics
Deakin Research Online
Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM
Consistent annotation of gene expression arrays
METHODOLOGY ARTICLE Open Access Methodology article Consistent annotation of gene expression arrays Benoît Ballester, Nathan Johnson, Glenn Proctor and Paul Flicek* Abstract Background: Gene expression
Access to genes and genomes with. Ensembl. Worked Example & Exercises
Access to genes and genomes with Ensembl Worked Example & Exercises September 2006 1 CONTENTS WORKED EXAMPLE... 2 BROWSING ENSEMBL... 21 Exercises... 21 Answers... 22 BIOMART... 25 Exercises... 25 Answers...
Product Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
Ensembl: A Genomic Toolset for pigs, poultry, plants, pests, pathogens and pollinators. Paul Kersey
Ensembl: A Genomic Toolset for pigs, poultry, plants, pests, pathogens and pollinators Paul Kersey A brief history of genome sequencing 1995 Haemophilus influenzae 1.8 Mb 1996 Saccharomyces cerevisiae
ArrayExpress: Quick tour
Melissa Burke [1] Gene Expression Beginner 0.5 hour This quick tour provides an overview of EMBL-EBI s functional genomics database ArrayExpress. This course was updated in December 2015. An undergraduate-level