De novo genome assembly with next generation sequencing data!! "
|
|
- Bennett Dustin Terry
- 6 years ago
- Views:
Transcription
1 De novo genome assembly with next generation sequencing data!! " Jianbin Wang" HMGP 7620 (CPBS 7620, and BMGN 7620)" Genomics lectures" 2/7/12" Outline" The need for de novo genome assembly! The nature of next generation sequencing data! The concepts and methods" The take home lessons" 1
2 The need for de novo genome assembly! The nature of next generation sequencing data! The concepts and methods" The takes" Why/When do we need de novo genome assembly? Lots of interesting organisms don t have their genome sequences available! They have to be done using NGS de novo assembly! Within species, each individual has its own genome! For one individual, different cells may have genome alterations! 2
3 5/29/12 New genomes" Within species" 3
4 Within an individual" The need for de novo genome assembly! The nature of next generation sequencing data! The concepts and methods" The takes" 4
5 The Nature of NGS Data" Higher parallel operation/yield! Much lower cost per base! Shorter (unfortunately)! 454: bp! Illumina: bp! Sanger sequencing: bp! ABI SOLiD: bp! Platform-based characteristic errors! Illumina paired-end vs. mate pair sequencing" Paired-end! Mate pair! 5
6 The need for de novo genome assembly! The nature of next generation sequencing data! The concepts and methods" The takes" De novo genome assembly concepts" Whole genome shortgun" sequencing" Genomic DNA! Genomic reads! Mate pair De novo assembly" Paired-end! Contig1! Contig2! Contig3! Contig4! Scaffold! Gaps! 6
7 Some vocabulary" Coverage (C)! C = 4" C k = 2" (k = 10)" C k = 3" (k = 5)" Kmer coverage (C k )! N50, N90!! Contig" N50 = 18,063 bp" N50 number = 4,175" N90 = 3,548 bp" N90 number = 16,950" Contig number Methods: Overlap-layout-consensus" Pair-wise sequence alignments (computationally expensive)! Construction an overlap graph to produce the reads layout! Multiple sequence alignments and generate consensus! Illumina! Examples: Phrap, Celera, Arachne, CAP, PCAP, Newbler,! 7
8 Methods: Eulerian path/de Bruijn graph" Kmer hash table! de Bruijn graph/ Eulerian path search! Examples: Euler, Velvet, Allpath, Abyss, SOAPdenovo,...! AGATGATTCG!! AGA! GAT! ATG! TGA! GAT! ATT! TTC! TCG! Illumina! Differences between an overlap graph and a de Bruijn graph" Schatz et. al 2010! 8
9 Methods - challenge" Repetitive sequence! DNA polymorphisms/sequencing errors! Non-uniform coverage (worse in Sanger sequencing)! Computational complexity of processing large volume of data! Reduced the complexity of the data" Sub-assembly (grouped assembly)! Repeat-masking! Reference based! 9
10 Additional Scaffolding" Related-genome as reference! cdnas/transcriptomes! Conserved proteins! Paired-end information! Reference genome - - cdna conserved protein! Contig1! Contig2! Contig3! Contig4! - - Scaffold! Genome assessment - coverage" Reads coverage/reads used! Physical coverage! Functional coverage! cdnas! Small RNAs!! 10
11 Genome assessment - continuity" Consistency to available genetic maps! Paired-end discrepancy! mrna/cdna intactness! The need for de novo genome assembly! The nature of next generation sequencing data! The concepts and methods" The takes! 11
12 12
13 De novo genome assembly on NGS data" is feasible! is still a very hard problem! algorithm matters, but more important is the source of DNA and quality of the library! reference genome or other higher-order genetic map is of great value! put it into the biological context! References/Additional reading" Schatz, M. C., A. L. Delcher, et al. (2010). "Assembly of large genomes using second-generation sequencing." Genome research 20(9): ! Earl, D., K. Bradnam, et al. (2011). "Assemblathon 1: a competitive assessment of de novo short read assembly methods." Genome research 21 (12): ! Salzberg, S. L., A. M. Phillippy, et al. (2012). "GAGE: A critical evaluation of genome assemblies and assembly algorithms." Genome research.! Treangen, T. J. and S. L. Salzberg (2012). "Repetitive DNA and nextgeneration sequencing: computational challenges and solutions." Nature reviews. Genetics 13(1): ! 13
De novo assembly of human genomes with massively parallel short read sequencing. Mikk Eelmets Journal Club
De novo assembly of human genomes with massively parallel short read sequencing Mikk Eelmets Journal Club 06.04.2010 Problem DNA sequencing technologies: Sanger sequencing (500-1000 bp) Next-generation
More informationOutline. The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing
Illumina Assembly 1 Outline The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing 2 Illumina Sequencing Paired end Illumina
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationNext Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park
Next Generation Sequences & Chloroplast Assembly 8 June, 2012 Jongsun Park Table of Contents 1 History of Sequencing Technologies 2 Genome Assembly Processes With NGS Sequences 3 How to Assembly Chloroplast
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Minghui Wang Bioinformatics Facility Cornell University DNA Sequencing Platforms Illumina sequencing (100 to 300 bp reads) Overlapping reads ~180bp fragment
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell University Data generation Sequencing Platforms Short reads: Illumina Long reads: PacBio; Oxford Nanopore Contiging/Scaffolding
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationshort read genome assembly Sorin Istrail CSCI1820 Short-read genome assembly algorithms 3/6/2014
1 short read genome assembly Sorin Istrail CSCI1820 Short-read genome assembly algorithms 3/6/2014 2 Genomathica Assembler Mathematica notebook for genome assembly simulation Assembler can be found at:
More informationGenome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015
Genome Assembly J Fass UCD Genome Center Bioinformatics Core Friday September, 2015 From reads to molecules What s the Problem? How to get the best assemblies for the smallest expense (sequencing) and
More informationDe novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
More informationde novo paired-end short reads assembly
1/54 de novo paired-end short reads assembly Rayan Chikhi ENS Cachan Brittany Symbiose, Irisa, France 2/54 THESIS FOCUS Graph theory for assembly models Indexing large sequencing datasets Practical implementation
More informationIntroduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014
Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454
More informationLecture 14: DNA Sequencing
Lecture 14: DNA Sequencing Study Chapter 8.9 10/17/2013 COMP 465 Fall 2013 1 Shear DNA into millions of small fragments Read 500 700 nucleotides at a time from the small fragments (Sanger method) DNA Sequencing
More information10/20/2009 Comp 590/Comp Fall
Lecture 14: DNA Sequencing Study Chapter 8.9 10/20/2009 Comp 590/Comp 790-90 Fall 2009 1 DNA Sequencing Shear DNA into millions of small fragments Read 500 700 nucleotides at a time from the small fragments
More informationAssembly and Validation of Large Genomes from Short Reads Michael Schatz. March 16, 2011 Genome Assembly Workshop / Genome 10k
Assembly and Validation of Large Genomes from Short Reads Michael Schatz March 16, 2011 Genome Assembly Workshop / Genome 10k A Brief Aside 4.7GB / disc ~20 discs / 1G Genome X 10,000 Genomes = 1PB Data
More informationA Short Sequence Splicing Method for Genome Assembly Using a Three- Dimensional Mixing-Pool of BAC Clones and High-throughput Technology
Send Orders for Reprints to reprints@benthamscience.ae 210 The Open Biotechnology Journal, 2015, 9, 210-215 Open Access A Short Sequence Splicing Method for Genome Assembly Using a Three- Dimensional Mixing-Pool
More informationNOW GENERATION SEQUENCING. Monday, December 5, 11
NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000
More informationNext Generation Sequencing Technologies
Next Generation Sequencing Technologies Julian Pierre, Jordan Taylor, Amit Upadhyay, Bhanu Rekepalli Abstract: The process of generating genome sequence data is constantly getting faster, cheaper, and
More informationDe novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
More informationCSE182-L16. LW statistics/assembly
CSE182-L16 LW statistics/assembly Silly Quiz Who are these people, and what is the occasion? Genome Sequencing and Assembly Sequencing A break at T is shown here. Measuring the lengths using electrophoresis
More informationGenome Assembly, part II. Tandy Warnow
Genome Assembly, part II Tandy Warnow How to apply de Bruijn graphs to genome assembly Phillip E C Compeau, Pavel A Pevzner & Glenn Tesler A mathematical concept known as a de Bruijn graph turns the formidable
More informationOutline. DNA Sequencing. Whole Genome Shotgun Sequencing. Sequencing Coverage. Whole Genome Shotgun Sequencing 3/28/15
Outline Introduction Lectures 22, 23: Sequence Assembly Spring 2015 March 27, 30, 2015 Sequence Assembly Problem Different Solutions: Overlap-Layout-Consensus Assembly Algorithms De Bruijn Graph Based
More informationA Roadmap to the De-novo Assembly of the Banana Slug Genome
A Roadmap to the De-novo Assembly of the Banana Slug Genome Stefan Prost 1 1 Department of Integrative Biology, University of California, Berkeley, United States of America April 6th-10th, 2015 Outline
More informationRepetitive DNA sequence assembly
Repetitive DNA sequence assembly by Yongqing Jiang Bachelor of IT (Honours) Submitted in fulfilment of the requirements for the degree of Doctor of Philosophy Deakin University November, 2017 Acknowledgements
More informationNEXT GENERATION SEQUENCING. Farhat Habib
NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp
More informationGenome Assembly With Next Generation Sequencers
Genome Assembly With Next Generation Sequencers Personal Genomics Institute 3 May, 2011 Jongsun Park Table of Contents 1 Central Dogma and Omics Studies 2 History of Sequencing Technologies 3 Genome Assembly
More informationDe novo sequence assembly
2015.6.12 De novo sequence assembly 徐唯哲 Paul Wei Che HSU 中央研究院分子生物研究所研究助技師 Assistant Research Specialist Bioinformatics Service Core, Institute of Molecular Biology, Academia Sinica, Taiwan, R.O.C. Bioinformatics
More informationGenome Assembly Background and Strategy
Genome Assembly Background and Strategy February 6th, 2017 BIOL 7210 - Faction I (Outbreak) - Genome Assembly Group Yanxi Chen Carl Dyson Zhiqiang Lin Sean Lucking Chris Monaco Shashwat Deepali Nagar Jessica
More informationGENOME ASSEMBLY FINAL PIPELINE AND RESULTS
GENOME ASSEMBLY FINAL PIPELINE AND RESULTS Faction 1 Yanxi Chen Carl Dyson Sean Lucking Chris Monaco Shashwat Deepali Nagar Jessica Rowell Ankit Srivastava Camila Medrano Trochez Venna Wang Seyed Alireza
More informationYellow-bellied marmot genome. Gabriela Pinho Graduate Student Blumstein & Wayne Labs EEB - UCLA
Yellow-bellied marmot genome Gabriela Pinho Graduate Student Blumstein & Wayne Labs EEB - UCLA Why do we need an annotated genome?.. Daniel T. Blumstein Kenneth B. Armitage 1962 2002 Samples & measurements
More informationState of the art de novo assembly of human genomes from massively parallel sequencing data
State of the art de novo assembly of human genomes from massively parallel sequencing data Yingrui Li, 1 Yujie Hu, 1,2 Lars Bolund 1,3 and Jun Wang 1,2* 1 BGI-Shenzhen, Shenzhen, Guangdong 518083, China
More informationGenome Sequencing and Assembly
Genome Sequencing and Assembly History of Sequencing What was the first fully sequenced nucleic acid? Yeast trna (alanine trna) Robert Holley 1965 Image: Wikipedia History of Sequencing Sequencing began
More informationHaploid Assembly of Diploid Genomes
Haploid Assembly of Diploid Genomes Challenges, Trials, Tribulations 13 October 2011 İnanç Birol Assembly By Short Sequencing IEEE InfoVis 2009 2 3 in Literature ~40 citations on tool comparisons ~20 citations
More informationCloG: a pipeline for closing gaps in a draft assembly using short reads
CloG: a pipeline for closing gaps in a draft assembly using short reads Xing Yang, Daniel Medvin, Giri Narasimhan Bioinformatics Research Group (BioRG) School of Computing and Information Sciences Miami,
More informationAlignment and Assembly
Alignment and Assembly Genome assembly refers to the process of taking a large number of short DNA sequences and putting them back together to create a representation of the original chromosomes from which
More informationAssembly. Ian Misner, Ph.D. Bioinformatics Crash Course. Bioinformatics Core
Assembly Ian Misner, Ph.D. Bioinformatics Crash Course Multiple flavors to choose from De novo No prior sequence knowledge required Takes what you have and tries to build the best contigs/scaffolds possible
More informationA shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationde novo metagenome assembly
1 de novo metagenome assembly Rayan Chikhi CNRS Univ. Lille 1 Formation metagenomique de novo metagenomics 2 de novo metagenomics Goal: biological sense out of sequencing data Techniques: 1. de novo assembly
More informationMapping. Main Topics Sept 11. Saving results on RCAC Scaffolding and gap closing Assembly quality
Mapping Main Topics Sept 11 Saving results on RCAC Scaffolding and gap closing Assembly quality Saving results on RCAC Core files When a program crashes, it will produce a "coredump". these are very large
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationEfficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads. Supplemental Materials
Efficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads Supplemental Materials 1. Supplemental Methods... 3 1.1 Algorithm Detail... 3 1.1.1 k-mer coverage distribution
More informationRapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing
Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing "#$%&'()*+,"(-*."#$%&/.,"*01*0.,(%-*.&0("2*01*3,$,45,"-*4#66&*71** 3"#)(82,"-*2&9:)($*)1*"(03&"2-*#)66(*.(8$6#*;
More informationPERGA: A Paired-End Read Guided De Novo Assembler for Extending Contigs Using SVM and Look Ahead Approach
Title for Extending Contigs Using SVM and Look Ahead Approach Author(s) Zhu, X; Leung, HCM; Chin, FYL; Yiu, SM; Quan, G; Liu, B; Wang, Y Citation PLoS ONE, 2014, v. 9 n. 12, article no. e114253 Issued
More informationHigh-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler
High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationConcepts and methods in genome assembly and annotation
BCM-2002 Concepts and methods in genome assembly and annotation B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. What is genome assembly?
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationAssembly of Ariolimax dolichophallus using SOAPdenovo2
Assembly of Ariolimax dolichophallus using SOAPdenovo2 Charles Markello, Thomas Matthew, and Nedda Saremi Image taken from Banana Slug Genome Project, S. Weber SOAPdenovo Assembly Tool Short Oligonucleotide
More informationWorkflow of de novo assembly
Workflow of de novo assembly Experimental Design Clean sequencing data (trim adapter and low quality sequences) Run assembly software for contiging and scaffolding Evaluation of assembly Several iterations:
More informationABSTRACT. Genome Assembly:
ABSTRACT Title of dissertation: Genome Assembly: Novel Applications by Harnessing Emerging Sequencing Technologies and Graph Algorithms Sergey Koren, Doctor of Philosophy, 2012 Dissertation directed by:
More informationGenome Sequencing-- Strategies
Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that
More informationNGS developments in tomato genome sequencing
NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC
More informationABSTRACT COMPUTATIONAL METHODS TO IMPROVE GENOME ASSEMBLY AND GENE PREDICTION. David Kelley, Doctor of Philosophy, 2011
ABSTRACT Title of dissertation: COMPUTATIONAL METHODS TO IMPROVE GENOME ASSEMBLY AND GENE PREDICTION David Kelley, Doctor of Philosophy, 2011 Dissertation directed by: Professor Steven Salzberg Department
More informationBIOINFORMATICS ORIGINAL PAPER
BIOINFORMATICS ORIGINAL PAPER Vol. 27 no. 21 2011, pages 2957 2963 doi:10.1093/bioinformatics/btr507 Genome analysis Advance Access publication September 7, 2011 : fast length adjustment of short reads
More informationUC Riverside UC Riverside Electronic Theses and Dissertations
UC Riverside UC Riverside Electronic Theses and Dissertations Title Algorithms for Reference Assisted Genome and Transcriptome Assemblies Permalink https://escholarship.org/uc/item/8v56k19t Author Bao,
More informationGenome Assembly and Annotation of Isochrysis Galbana
Genome Assembly and Annotation of Isochrysis Galbana By: Yi Wang Institution: California State University San Marcos Date: May 14, 2014 Abstract Isochrysis Galbana is a species of cocoolithophores, which
More informationHuman Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction
More informationLectures 18, 19: Sequence Assembly. Spring 2017 April 13, 18, 2017
Lectures 18, 19: Sequence Assembly Spring 2017 April 13, 18, 2017 1 Outline Introduction Sequence Assembly Problem Different Solutions: Overlap-Layout-Consensus Assembly Algorithms De Bruijn Graph Based
More informationGenome Assembly. Microbial Single Cell Genomics Workshop 2010 Sergey Koren JCVI, CBCB at UMD
Genome Assembly Microbial Single Cell Genomics Workshop 2010 Sergey Koren JCVI, CBCB at UMD Introduction Platform: 3730 Model length reads bases ABI 3730 800 96 80K Applied Biosystems 3730xl DNA amplification
More informationBioinformatic analysis of Illumina sequencing data for comparative genomics Part I
Bioinformatic analysis of Illumina sequencing data for comparative genomics Part I Dr David Studholme. 18 th February 2014. BIO1033 theme lecture. 1 28 February 2014 @davidjstudholme 28 February 2014 @davidjstudholme
More informationLecture 18: Single-cell Sequencing and Assembly. Spring 2018 May 1, 2018
Lecture 18: Single-cell Sequencing and Assembly Spring 2018 May 1, 2018 1 SINGLE-CELL SEQUENCING AND ASSEMBLY 2 Single-cell Sequencing Motivation: Vast majority of environmental bacteria are unculturable
More informationTowards Accurate De Novo Assembly for Genomes with Repeats
Towards Accurate De Novo Assembly for Genomes with Repeats Doina Bucur University of Twente, The Netherlands d.bucur@utwente.nl Abstract De novo genome assemblers designed for short k- mer length or using
More informationFrom Infection to Genbank
From Infection to Genbank How a pathogenic bacterium gets its genome to NCBI Torsten Seemann VLSCI - Life Sciences Computation Centre - Genomics Theme - Lab Meeting - Friday 27 April 2012 The steps 1.
More informationThe MaSuRCA genome Assembler Aleksey Zimin 1,*, Guillaume Marçais 1, Daniela Puiu 2, Michael Roberts 1, Steven L. Salzberg 2, and James A.
Bioinformatics Advance Access published August 29, 2013 Genome Analysis The MaSuRCA genome Assembler Aleksey Zimin 1,*, Guillaume Marçais 1, Daniela Puiu 2, Michael Roberts 1, Steven L. Salzberg 2, and
More informationNext-generation sequencing technologies
Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More informationPurpose of sequence assembly
Sequence Assembly Purpose of sequence assembly Reconstruct long DNA/RNA sequences from short sequence reads Genome sequencing RNA sequencing for gene discovery But not for transcript quantification Variant
More informationGenome Assembly Software for Different Technology Platforms. PacBio Canu Falcon. Illumina Soap Denovo Discovar Platinus MaSuRCA.
Genome Assembly Software for Different Technology Platforms PacBio Canu Falcon 10x SuperNova Illumina Soap Denovo Discovar Platinus MaSuRCA Experimental design using Illumina Platform Estimate genome size:
More informationAnalysis of RNA-seq Data
Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,
More informationCSCI2950-C DNA Sequencing and Fragment Assembly
CSCI2950-C DNA Sequencing and Fragment Assembly Lecture 2: Sept. 7, 2010 http://cs.brown.edu/courses/csci2950-c/ DNA sequencing How we obtain the sequence of nucleotides of a species 5 3 ACGTGACTGAGGACCGTG
More informationDe novo genome assembly. Dr Torsten Seemann
De novo genome assembly Dr Torsten Seemann IMB Winter School - Brisbane Mon 1 July 2013 Introduction Ideal world I would not need to give this talk! Human DNA Non-existent USB3 device AGTCTAGGATTCGCTA
More informationGenome Assembly: Background and Strategy
Genome Assembly: Background and Strategy Monday, February 8, 2016 BIOL 7210: Genome Assembly Group Aroon Chande, Cheng Chen, Alicia Francis, Alli Gombolay, Namrata Kalsi, Ellie Kim, Tyrone Lee, Wilson
More informationImproving Genome Assemblies without Sequencing
Improving Genome Assemblies without Sequencing Michael Schatz April 25, 2005 TIGR Bioinformatics Seminar Assembly Pipeline Overview 1. Sequence shotgun reads 2. Call Bases 3. Trim Reads 4. Assemble phred/tracetuner/kb
More informationCompute- and Data-Intensive Analyses in Bioinformatics"
Compute- and Data-Intensive Analyses in Bioinformatics" Wayne Pfeiffer SDSC/UCSD August 8, 2012 Questions for today" How big is the flood of data from high-throughput DNA sequencers? What bioinformatics
More informationEfficient Algorithms for Prokaryotic Whole Genome Assembly and Finishing
Old Dominion University ODU Digital Commons Computer Science Theses & Dissertations Computer Science Fall 2015 Efficient Algorithms for Prokaryotic Whole Genome Assembly and Finishing Abhishek Biswas Old
More informationRNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)
RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their
More informationBuilding and Improving Reference Genome Assemblies
Building and Improving Reference Genome Assemblies This paper reviews the problems and algorithms of assembling a complete genome from millions of short DNA sequencing reads. By K a ry n M e lt z St e
More informationAssembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster
Assembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster Aobakwe Matshidiso Supervisor: Prof Chrissie Rey Co-Supervisor: Prof Scott Hazelhurst Next Generation Sequencing
More informationCopyright (c) 2008 Daniel Huson. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation
Assembly of the Human Genome Daniel Huson Informatics Research Copyright (c) 2008 Daniel Huson. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation
More informationGenome Assembly CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2018
Genome Assembly CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2018 Overview What is genome assembly? Steps in a genome assembly Planning an assembly project QC assessment of assemblies
More informationReevaluating Assembly Evaluations with Feature Response Curves: GAGE and Assemblathons Francesco Vezzi 1,, Giuseppe Narzisi 2, Bud Mishra 2,3,4
1 Reevaluating Assembly Evaluations with Feature Response Curves: GAGE and Assemblathons Francesco Vezzi 1,, Giuseppe Narzisi 2, Bud Mishra 2,3,4 1 School of Computer Science and Communication, KTH Royal
More informationWhy are we here? Introduction
Why are we here? Introduction Genome assembly Original DNA Fragments Sequenced ends Fragments Contigs Scaffold A correct assembly The right motifs, the correct number of times, in correct order and position.
More informationGenomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
More informationThe Basics of Understanding Whole Genome Next Generation Sequence Data
The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next
More informationBackground Wikipedia Lee and Mahadavan, JCB, 2009 History (Platform Comparison) P Park, Nature Review Genetics, 2009 P Park, Nature Reviews Genetics, 2009 Rozowsky et al., Nature Biotechnology, 2009
More informationAssemblathon Summary Report
Assemblathon Summary Report An overview of UC Davis results from Assemblathon 1: 2010/2011 Written by Keith Bradnam with results, analysis, and other contributions from Ian Korf, Joseph Fass, Aaron Darling,
More informationIt is not the strongest of the species that survive, nor the most intelligent, but the one most responsive to change
Generation of transcriptome resources in rubber in response to Corynespora cassiicola causing Corynespora leaf disease for gene discovery and marker identification using NGS platform C. Bindu Roy and T.
More informationTranscriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data
Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data Introduction The US Food and Drug Administration (FDA) has coordinated the Sequencing Quality Control project (SEQC/MAQC-III)
More informationGenome Assembly. Background and Approach 28 Jan Jillian Walker Diana Williams
Genome Assembly Background and Approach 28 Jan 2015 Jillian Walker Diana Williams Ke Qi Xin Wu Bhanu Gandham Anuj Gupta Taylor Griswold Yuanbo Wang Sung Im Maxine Harlemon Nicholas Kovacs ObjecOves Evaluate
More informationIDBA-UD: A de Novo Assembler for Single-Cell and Metagenomic Sequencing Data with Highly Uneven Depth
Category IDBA-UD: A de Novo Assembler for Single-Cell and Metagenomic Sequencing Data with Highly Uneven Depth Yu Peng 1, Henry C.M. Leung 1, S.M. Yiu 1 and Francis Y.L. Chin 1,* 1 Department of Computer
More informationCOPE: An accurate k-mer based pair-end reads connection tool to facilitate genome assembly
Bioinformatics Advance Access published October 8, 2012 COPE: An accurate k-mer based pair-end reads connection tool to facilitate genome assembly Binghang Liu 1,2,, Jianying Yuan 2,, Siu-Ming Yiu 1,3,
More informationIllumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme
Illumina (Solexa) Current market leader Based on sequencing by synthesis Current read length 100-150bp Paired-end easy, longer matepairs harder Error ~0.1% Mismatch errors dominate Throughput: 4 Tbp in
More informationNext-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationSCIENCE CHINA Life Sciences. Comparative analysis of de novo transcriptome assembly
SCIENCE CHINA Life Sciences SPECIAL TOPIC February 2013 Vol.56 No.2: 156 162 RESEARCH PAPER doi: 10.1007/s11427-013-4444-x Comparative analysis of de novo transcriptome assembly CLARKE Kaitlin 1, YANG
More informationGenome Assembly Workshop Titles and Abstracts
Genome Assembly Workshop Titles and Abstracts TUESDAY, MARCH 15, 2011 08:15 AM Richard Durbin, Wellcome Trust Sanger Institute A generic sequence graph exchange format for assembly and population variation
More informationGenScale Scalable, Optimized and Parallel Algorithms for Genomics. Dominique LAVENIER
GenScale Scalable, Optimized and Parallel Algorithms for Genomics Dominique LAVENIER Context New Sequencing Technologies - NGS Exponential growth of genomic data Drastic decreasing of costs Emergence of
More informationDe Novo Co-Assembly Of Bacterial Genomes From Multiple Single Cells
Wayne State University Wayne State University Theses 1-1-2014 De Novo Co-Assembly Of Bacterial Genomes From Multiple Single Cells Narjes Sadat Movahedi Tabrizi Wayne State University, Follow this and additional
More information