De novo assembly in RNA-seq analysis.
|
|
|
- Joleen Barrett
- 5 years ago
- Views:
Transcription
1 De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012
2 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct transcripts Exon-exon-junction detection (genome annotation) Alternative splicing/isoforms SNP detection...
3 Motivation Two assembly approaches Genome-guided (alignment to reference genome) Genome-independent (de novo assembly)
4 Motivation Two assembly approaches Genome-guided (alignment to reference genome) Genome-independent (de novo assembly) Why de novo assembly? No reference genome available for species Genomic sequence Incomplete (even reference genomes!) Fragmented Altered
5 QC & preprocessing De novo assembly workflow QC & postprocessing Garber et al. (2011). Nat. Methods 8,
6 QC & preprocessing De novo assembly workflow QC & postprocessing Garber et al. (2011). Nat. Methods 8,
7 Input data Coverage requirements highly dependent Transcriptome size Paired-end/single-end Normalized RNA-seq library Used in literature ~52.6 million 76-base read pairs mouse ~100x coverage Pool RNA-seq data from different samples Roche 454 data Integrate directly Sample paired-end data
8 Input data Normalization of cdna libraries might improve assembly
9 Input data Normalization of cdna libraries might improve assembly Gene expression information gets lost
10 Preprocessing Remove clonality & contamination Sequencing errors have higher impact in de novo assembly FastQC BioConductor & R Tools for the analysis and comprehension of highthroughput genomic data FASTX-Toolkit Tools for Short-Reads FASTA/FASTQ files preprocessing TagDust Eliminate artifactual reads from next-generation sequencing data sets ALLPATHS-LG Error correction phase of ALLPATHS-LG assembler Supported by Trinity de novo assembler DecGPU Distributed short read Error Correction on GPUs ConDeTri A Content Dependent Read Trimmer for Illumina Data
11 Preprocessing Remove clonality & contamination Sequencing errors have higher impact in de novo assembly FastQC BioConductor & R Tools for the analysis and comprehension of highthroughput genomic data FASTX-Toolkit Tools for Short-Reads FASTA/FASTQ files preprocessing TagDust Eliminate artifactual reads from next-generation sequencing data sets ALLPATHS-LG Error correction phase of ALLPATHS-LG assembler Supported by Trinity de novo assembler DecGPU Distributed short read Error Correction on GPUs ConDeTri A Content Dependent Read Trimmer for Illumina Data
12 QC & preprocessing De novo assembly workflow QC & postprocessing Garber et al. (2011). Nat. Methods 8,
13 Assembly step Challenges Uneven coverage Different abundance of transcripts Splice isoforms Short contigs Overlapping genes Splice isoforms vs. paralogs Sequencing errors vs. polymorphisms Most solutions are de-bruijn graph-based Construct k-mers Build de-bruijn graph Traverse the graph
14 Assembly strategy k-mer construction Create all substrings of length k from the reads read read Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
15 Assembly strategy k-mer construction Create all substrings of length k from the reads read read Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
16 Assembly strategy k-mer construction Create all substrings of length k from the reads read read Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
17 Assembly strategy k-mer construction Create all substrings of length k from the reads read read Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
18 Assembly strategy k-mer construction Create all substrings of length k from the reads read read Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
19 Assembly strategy k-mer construction Generate de Bruijn graph read Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
20 Assembly strategy k-mer construction Generate de Bruijn graph read Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
21 Assembly strategy de Bruijn-graph Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
22 Assembly strategy de Bruijn-graph Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
23 Assembly strategy k-mer construction Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
24 Assembly strategy k-mer construction Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
25 Assembly strategy de Bruijn-graph Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
26 Assembly strategy splice isoforms Martin, J. A., and Wang, Z. (2011). Nature Reviews Genetics 12,
27 Software An (incomplete) selection Trinity (single k-mer) Broad Institute and Hebrew University of Jerusalem Trans-ABySS (multiple k-mers) Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency Velvet-Oases (single & multiple k-mers) EMBL-EBI / MPI for Molecular Genomics SOAPdenovo-Trans Beijing Genomics Institute CLC pipeline (not free) CLCbio
28 K-mer settings - Oases Schulz et al. (2012). Bioinformatics 28,
29 Assembly vs. reference Zhao et al. (2011). BMC Bioinformatics 12 Suppl 1, S2.
30 Example assembly Zhao et al. (2011). BMC Bioinformatics 12 Suppl 1, S2.
31 Memory usage Zhao et al. (2011). BMC Bioinformatics 12 Suppl 1, S2.
32 Trinity Inchworm Sequencing error correction Assemble candidate contigs Chrysalis Build de Bruijn transcript graphs from candidate contigs Butterfly Resolve alternatively spliced and paralogous transcripts k-mer length fixed to 25 Can incorporate results from reference-based analysis Grabherr et al. (2011). Nature Biotechnology.
33 Trinity Inchworm Sequencing error correction Assemble candidate contigs Chrysalis Build de Bruijn transcript graphs from candidate contigs Butterfly Resolve alternatively spliced and paralogous transcripts k-mer length fixed to 25 Can incorporate results from reference-based analysis Grabherr et al. (2011). Nature Biotechnology.
34 Trinity Inchworm Sequencing error correction Assemble candidate contigs Chrysalis Build de Bruijn transcript graphs from candidate contigs Butterfly Resolve alternatively spliced and paralogous transcripts k-mer length fixed to 25 Can incorporate results from reference-based analysis Grabherr et al. (2011). Nature Biotechnology.
35 QC & preprocessing De novo assembly workflow QC & postprocessing Garber et al. (2011). Nat. Methods 8,
36 Postprocessing & Post Qualilty Control Postprocessing Remove fragments Construct CDS & protein sequences Quality measures Map back reads to assembly Percentage mapped Accuracy on base level Comparison to existing data (UniProt/GenBank) Comparison to reference (if available) Robertson et al. (2010). Nat. Methods 7, Grabherr et al. (2011). Nat. Biotechnol.
37 Experiences Solanum Dulcamara transcriptome assembly (Ivo Rieu, Radboud University Nijmegen, article to be submitted) RNA-seq samples 17 mixed tissue samples Illumina Hiseq2000 and Roche 454 Preprocessing Basic quality filtering performed in CLCbio (default settings, remove reads <50bp) Error correction with decgpu» 578 million high quality single end reads (34 billion nucleotides, about 1000x coverage)
38 Experiences Assembly Trinity minimal k-mer coverage of 2 default k-mer size of 25 85hrs on 40core/512GB server (the server was not fully utilized during assembly process) 32,157 contigs with more than 500 nucleotides
39 Summary De novo assemblers are prone to miss lowly expressed transcripts Multi k-mer approaches can improve assembly results Pool RNA-seq reads from different samples Assembler overview Assembler Running time Memory requirements Trinity ++ + Velvet-Oases ++ Trans-ABySS - SOAPdenovo -
40 Follow up analyses Gene expression / differential expression Alternative splicing/isoforms SNP detection... Only with reference Exon-exon-junction detection (genome annotation)
41 Questions?
de novo Transcriptome Assembly Nicole Cloonan 1 st July 2013, Winter School, UQ
de novo Transcriptome Assembly Nicole Cloonan 1 st July 2013, Winter School, UQ de novo transcriptome assembly de novo from the Latin expression meaning from the beginning In bioinformatics, we often use
Introduction to RNA sequencing
Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence
Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data
Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data Introduction The US Food and Drug Administration (FDA) has coordinated the Sequencing Quality Control project (SEQC/MAQC-III)
ChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
Eucalyptus gene assembly
Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted
RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)
RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their
SCIENCE CHINA Life Sciences. Comparative analysis of de novo transcriptome assembly
SCIENCE CHINA Life Sciences SPECIAL TOPIC February 2013 Vol.56 No.2: 156 162 RESEARCH PAPER doi: 10.1007/s11427-013-4444-x Comparative analysis of de novo transcriptome assembly CLARKE Kaitlin 1, YANG
ChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
Analysis of RNA-seq Data
Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,
Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
RNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
de novo paired-end short reads assembly
1/54 de novo paired-end short reads assembly Rayan Chikhi ENS Cachan Brittany Symbiose, Irisa, France 2/54 THESIS FOCUS Graph theory for assembly models Indexing large sequencing datasets Practical implementation
Transcriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing
Transcriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
De novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
Mapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
RNA-Seq analysis workshop
RNA-Seq analysis workshop Zhangjun Fei Boyce Thompson Institute for Plant Research USDA Robert W. Holley Center for Agriculture and Health Cornell University Outline Background of RNA-Seq Application of
Sequence Analysis 2RNA-Seq
Sequence Analysis 2RNA-Seq Lecture 10 2/21/2018 Instructor : Kritika Karri kkarri@bu.edu Transcriptome Entire set of RNA transcripts in a given cell for a specific developmental stage or physiological
NOW GENERATION SEQUENCING. Monday, December 5, 11
NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000
SCIENCE CHINA Life Sciences
SCIENCE CHINA Life Sciences SPECIAL TOPIC February 2013 Vol.56 No.2: 143 155 RESEARCH PAPER doi: 10.1007/s11427-013-4442-z Comparative study of de novo assembly and genome-guided assembly strategies for
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
Genomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
De novo genome assembly with next generation sequencing data!! "
De novo genome assembly with next generation sequencing data!! " Jianbin Wang" HMGP 7620 (CPBS 7620, and BMGN 7620)" Genomics lectures" 2/7/12" Outline" The need for de novo genome assembly! The nature
Introduction of RNA-Seq Analysis
Introduction of RNA-Seq Analysis Jiang Li, MS Bioinformatics System Engineer I Center for Quantitative Sciences(CQS) Vanderbilt University September 21, 2012 Goal of this talk 1. Act as a practical resource
Assessing De-Novo Transcriptome Assemblies
Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,
RNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
Mapping Next Generation Sequence Reads. Bingbing Yuan Dec. 2, 2010
Mapping Next Generation Sequence Reads Bingbing Yuan Dec. 2, 2010 1 What happen if reads are not mapped properly? Some data won t be used, thus fewer reads would be aligned. Reads are mapped to the wrong
Sequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
Outline. The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing
Illumina Assembly 1 Outline The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing 2 Illumina Sequencing Paired end Illumina
Genomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
RNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
Supplementary Materials for De-novo transcript sequence reconstruction from RNA-Seq: reference generation and analysis with Trinity
Supplementary Materials for De-novo transcript sequence reconstruction from RNA-Seq: reference generation and analysis with Trinity Sections: S1. Evaluation of transcriptome assembly completeness S2. Comparison
RNA-Seq Module 2 From QC to differential gene expression.
RNA-Seq Module 2 From QC to differential gene expression. Ying Zhang Ph.D, Informatics Analyst Research Informatics Support System (RISS) MSI Apr. 24, 2012 RNA-Seq Tutorials Tutorial 1: Introductory (Mar.
NGS part 2: applications. Tobias Österlund
NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
Introduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
De novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Minghui Wang Bioinformatics Facility Cornell University DNA Sequencing Platforms Illumina sequencing (100 to 300 bp reads) Overlapping reads ~180bp fragment
Consensus Ensemble Approaches Improve De Novo Transcriptome Assemblies
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Computer Science and Engineering: Theses, Dissertations, and Student Research Computer Science and Engineering, Department
De novo assembly of human genomes with massively parallel short read sequencing. Mikk Eelmets Journal Club
De novo assembly of human genomes with massively parallel short read sequencing Mikk Eelmets Journal Club 06.04.2010 Problem DNA sequencing technologies: Sanger sequencing (500-1000 bp) Next-generation
Background Wikipedia Lee and Mahadavan, JCB, 2009 History (Platform Comparison) P Park, Nature Review Genetics, 2009 P Park, Nature Reviews Genetics, 2009 Rozowsky et al., Nature Biotechnology, 2009
Analysis of RNA-seq Data. Bernard Pereira
Analysis of RNA-seq Data Bernard Pereira The many faces of RNA-seq Applications Discovery Find new transcripts Find transcript boundaries Find splice junctions Comparison Given samples from different experimental
Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
RNA-Seq analysis workshop. Zhangjun Fei
RNA-Seq analysis workshop Zhangjun Fei Outline Background of RNA-Seq Application of RNA-Seq (what RNA-Seq can do?) Available sequencing platforms and strategies and which one to choose RNA-Seq data analysis
Haploid Assembly of Diploid Genomes
Haploid Assembly of Diploid Genomes Challenges, Trials, Tribulations 13 October 2011 İnanç Birol Assembly By Short Sequencing IEEE InfoVis 2009 2 3 in Literature ~40 citations on tool comparisons ~20 citations
The Impacts of Read Length and Transcriptome Complexity for De Novo
The Impacts of Read Length and Transcriptome Complexity for De Novo Assembly: A Simulation Study Zheng Chang., Zhenjia Wang., Guojun Li* School of Mathematics, Shandong University, Jinan, Shandong, China
Next Generation Sequencing
Next Generation Sequencing Complete Report Catalogue # and Service: IR16001 rrna depletion (human, mouse, or rat) IR11081 Total RNA Sequencing (80 million reads, 2x75 bp PE) Xxxxxxx - xxxxxxxxxxxxxxxxxxxxxx
Assembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster
Assembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster Aobakwe Matshidiso Supervisor: Prof Chrissie Rey Co-Supervisor: Prof Scott Hazelhurst Next Generation Sequencing
Long and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
DNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs
DNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs Nadia Pisanti University of Pisa & Leiden University Outline New Generation Sequencing (NGS), and the importance of detecting
Deep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis
De Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
Genetic variation of an apomictic dandelion lineage studied through de novo transcriptome assembly
Genetic variation of an apomictic dandelion lineage studied through de novo transcriptome assembly M.Sc. Thesis Nikolaos Pappas January 2015 Genetic variation of an apomictic dandelion lineage studied
Methods for Analysis of RNA-Seq data. Hugues Richard
Methods for Analysis of RNA-Seq data. Hugues Richard RNA-Seq protocol (no strand information) M. Schulz Biological Experiment bag of transcript positions GTGAAAAAA ATGGAAAAA ATGAAGAAAAA Nucleus Total RNA
10/06/2014. RNA-Seq analysis. With reference assembly. Cormier Alexandre, PhD student UMR8227, Algal Genetics Group
RNA-Seq analysis With reference assembly Cormier Alexandre, PhD student UMR8227, Algal Genetics Group Summary 2 Typical RNA-seq workflow Introduction Reference genome Reference transcriptome Reference
De novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell University Data generation Sequencing Platforms Short reads: Illumina Long reads: PacBio; Oxford Nanopore Contiging/Scaffolding
RNASEQ WITHOUT A REFERENCE
RNASEQ WITHOUT A REFERENCE Experimental Design Assembly in Non-Model Organisms And other (hopefully useful) Stuff Meg Staton mstaton1@utk.edu University of Tennessee Knoxville, TN I. Project Design Things
Introduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
DNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer.
DNA Preparation and QC Extraction DNA was extracted from whole blood or flash frozen post-mortem tissue using a DNA mini kit (QIAmp #51104 and QIAmp#51404, respectively) following the manufacturer s recommendations.
Course Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
SOAPdenovo-Trans: De novo transcriptome assembly with short RNA-Seq reads
Sequence analysis : De novo transcriptome assembly with short RNA-Seq reads Yinlong Xie 1,2,3,, Gengxiong Wu 1,, Jingbo Tang 1,4,, Ruibang Luo 1,2,6,, Jordan Patterson 5, Shanlin Liu 1, Weihua Huang 1,
CBC Data Therapy. Metatranscriptomics Discussion
CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu
Form for publishing your article on BiotechArticles.com this document to
Your Article: Article Title (3 to 12 words) Article Summary (In short - What is your article about Just 2 or 3 lines) Category Transcriptomics sequencing and lncrna Sequencing Analysis: Quality Evaluation
De novo sequence assembly
2015.6.12 De novo sequence assembly 徐唯哲 Paul Wei Che HSU 中央研究院分子生物研究所研究助技師 Assistant Research Specialist Bioinformatics Service Core, Institute of Molecular Biology, Academia Sinica, Taiwan, R.O.C. Bioinformatics
State of the art de novo assembly of human genomes from massively parallel sequencing data
State of the art de novo assembly of human genomes from massively parallel sequencing data Yingrui Li, 1 Yujie Hu, 1,2 Lars Bolund 1,3 and Jun Wang 1,2* 1 BGI-Shenzhen, Shenzhen, Guangdong 518083, China
How to deal with your RNA-seq data?
How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop
Assembly of Ariolimax dolichophallus using SOAPdenovo2
Assembly of Ariolimax dolichophallus using SOAPdenovo2 Charles Markello, Thomas Matthew, and Nedda Saremi Image taken from Banana Slug Genome Project, S. Weber SOAPdenovo Assembly Tool Short Oligonucleotide
Purpose of sequence assembly
Sequence Assembly Purpose of sequence assembly Reconstruct long DNA/RNA sequences from short sequence reads Genome sequencing RNA sequencing for gene discovery But not for transcript quantification Variant
De novo transcriptome assembly Does anybody even need it?
De novo transcriptome assembly Does anybody even need it? Andrey Prjibelski Center for Algorithmic Biotechnology SPbSU Outline 1.Who assembles transcriptomes de novo? 2.How do assemblers work? 3.What is
RNA-seq Data Analysis
Lecture 3. Clustering; Function/Pathway Enrichment analysis RNA-seq Data Analysis Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Lecture 1. Map RNA-seq read to genome Lecture
Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis
Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens Mitchell Holland, Noblis Agenda Introduction Whole Genome Sequencing Analysis Pipeline Sequence Alignment SNPs and
High throughput sequencing technologies
High throughput sequencing technologies and NGS applications Mei-yeh Lu 呂美曄 High Throughput Sequencing Core Manager g g p q g g Academia Sinica 6/30/2011 Outlines Evolution of sequencing technologies Sanger
Analytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
Yellow-bellied marmot genome. Gabriela Pinho Graduate Student Blumstein & Wayne Labs EEB - UCLA
Yellow-bellied marmot genome Gabriela Pinho Graduate Student Blumstein & Wayne Labs EEB - UCLA Why do we need an annotated genome?.. Daniel T. Blumstein Kenneth B. Armitage 1962 2002 Samples & measurements
Machine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
RNA-Seq de novo assembly training
RNA-Seq de novo assembly training Training session aims Give you some keys elements to look at during read quality check. Transcriptome assembly is not completely a strait forward process : Multiple strategies
Single Cell Transcriptomics scrnaseq
Single Cell Transcriptomics scrnaseq Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Purpose The sequencing of
Compute- and Data-Intensive Analyses in Bioinformatics"
Compute- and Data-Intensive Analyses in Bioinformatics" Wayne Pfeiffer SDSC/UCSD August 8, 2012 Questions for today" How big is the flood of data from high-throughput DNA sequencers? What bioinformatics
Next Generation Sequencing. Tobias Österlund
Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
CBC Data Therapy. Metagenomics Discussion
CBC Data Therapy Metagenomics Discussion General Workflow Microbial sample Generate Metaomic data Process data (QC, etc.) Analysis Marker Genes Extract DNA Amplify with targeted primers Filter errors,
TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR)
tru TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR) Anton Bankevich Center for Algorithmic Biotechnology, SPbSU Sequencing costs 1. Sequencing costs do not follow Moore s law
Introduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014
Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454
Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data
Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data Jan Hellemans 7th international qpcr & NGS Event - Freising March 24 th, 2015 Therapeutics lncrna oncology
DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
High-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler
High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences
Concepts and methods in genome assembly and annotation
BCM-2002 Concepts and methods in genome assembly and annotation B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. What is genome assembly?
RNA-Seq Analysis. Simon Andrews, Laura v
RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+
Contact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
Introduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
Supplementary Information Supplementary Figures
Supplementary Information Supplementary Figures Figure S. The number of reads mapped to the and models for 76 human plasmablasts (AW-AW dataset) using bowtie reconstructed from (A) (B) (C) IMGT_mapped
RNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
Bioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet May 2013 Standard sequence library generation Illumina
High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
![Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G](/thumbs/95/123686269.jpg "Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G")
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
Why QC? Next-Generation Sequencing: Quality Control. Illumina data format. Fastq format:
Why QC? Next-Generation Sequencing: Quality Control BaRC Hot Topics January 2017 Bioinformatics and Research Computing Whitehead Institute Do you want to include the reads with low quality base calls?
Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
Next-Generation Sequencing: Quality Control
Next-Generation Sequencing: Quality Control Bingbing Yuan BaRC Hot Topics January 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Why QC? Do you want to