Clonality testing Potentials & Problems
|
|
- Kristian Cain
- 6 years ago
- Views:
Transcription
1 Clonality testing Potentials & Problems For the Biomed 2 group Han van Krieken Nijmegen, the Netherlands EAHP 2010, Uppsala
2 Introduction Clonality testing needs to be based on knowledge of immunology Poly- vs oligo- vs monoclonal Restricted repertoires Sensitivity issues Interpretation in a pathology setting Not a black and white test Knowledge of the pathology is needed
3 IGH locus 14q32 IGH VH DH JH n s C n D to J joining V to DJ joining Transcription 7 Precursor mrna RNA splicing Mature mrna V DJ C Open Reading Frame Ig Heavy chain protein PJTA Groenen PhD, Dept of Pathology
4 BIOMED-2 Concerted Action BMH4-CT : PCR-based clonality studies PCR targets for diagnostic clonality studies Ig genes: IGH: VH-JH and DH-JH IGK: Vκ-Jκ and ΚDE IGL: Vλ-Jλ TCR genes TCRB: Vβ-Jβ and Dβ-Jβ TCRG: Vγ-Jγ TCRD: Vδ-Jδ, Dδ-Dδ, Dδ-Jδ, and Vδ-Dδ Chromosome aberrations: t(14;18): BCL2-IGH (JH) t(11;14): BCL1-IGH (JH) PJTA Groenen PhD, Dept of Pathology
5 BIOMED-2 multiplex PCR analysis Gene Rearrangement Upstream primers Downstream primers No. of tubes IGH VH-JH (3x) VH-JH (3x) IGK Vκ-Jκ Kde 1 7 (6+1) 1 IGL Vλ-Jλ TCRB Vβ-Jβ 2 23 (2x) 13 Dβ-Jβ TCRG Vγ-Jγ 4 2 (2x) 2 TCRD Vδ Jδ etc 7 5
6 BIOMED-2 Concerted Action BMH4-CT : PCR-based clonality studies PCR GeneScan analysis of IGH tube A: VH-J Hrearrangements VH DH JH 6 VH -FR1 primers (V H family primers) J H primer * CTGTGCAAGAGCGGGCTATGGTTCAGGGAGTTATGGCTACTACGGTATGGACGTCTGG CTGTGCAAGAGGACGAAACAGTAACTGCCTACTACTACTACGGTATGGACGTCTGG CTGTGCAAGAGAGATAGTATAGCAGCTCGTACAACTGGTTCGACTCCTGG CTGTGCAAGAGATCCGGGCAGCTCGTTTTGCTTTTGATATCTGG CTGTGCAAGAGCCTCTCTCCACTGGGATGGGGGGCTACTGG CTGTGCAAGAGCAGCAGCTCGGCCCCCTTTGACTACTGG CTGTGCAAGAG GACTTTGGATGCTTTTGATATCTGG CTGTGCAAGAGGGTGGGAGCTACTAGACTACTGG CTGTGCAAGGGTAGCTAAACCTTTGACTACTGG CTGTGCAATATCTACTTTGACTACTGG PJTA Groenen PhD, Dept of Pathology
7 Heteroduplex analysis T D (1290) T M (1294) Monoclonal Polyclonal IGL 300 bp 200 bp 100 bp Size and conformation PJTA Groenen PhD, Dept of Pathology
8 Complementarity of Ig targets for clonality detection in B-cell malignancies IGH IGK all IGH DH-JH VH-JH DH-JH VH-JH Vκ-Jκ Kde Vκ-Jκ + IGK + Kde * +DH-JH + Kde MCL (n=54) 100% 11% 100% 94% 75% 100% 100% 78% B-CLL/SLL (n=56) 100% 43% 100% 96% 61% 100% 100% 73% FL (n=109) 84% 19% 86% 63% 59% 84% 100% 64% MZL (n=41) 88% 51% 95% 68% 54% 83% 100% 68% DLBCL (n=109) 79% 30% 85% 61% 58% 80% 98% 72% TOTAL (n=369) 88% 28% 91% 73% 60% 88% 99% 70% * Combination of two Ig gene rearrangements without somatic mutations BIOMED-2 B-cell malignancy report: PAS Evans et al, Leukemia 2007
9 Specific Ig/TCR gene patterns in B-cell malignancies (Virtually) all B-cell malignancies have IGH rearrangements; Incomplete DH-JH rearrangements occur in 30-40% of cases, except of MCL (~10%) and FCL (~20%), most of which contain BCL1-IGH or BCL2-IGH rearrangements on the second allele; All Igλ + B-cell malignancies have IGK deletions on at least one allele (80% have biallelic deletions); Igκ + B-cell malignancies rarely contain IGL rearrangements (<5%), but 30% have IGK deletions on one allele; TCR gene rearrangements occur in 5 to 15% of mature B-cell malignancies and in 80 to 90% of immature B-cell malignancies (precursor-b-all). 9
10 Complementarity of TCR targets for clonality detection in T-cell malignancies TCRB TCRG TCRB Vβ-Jβ Dβ-Jβ Vβ-Jβ Vγ-Jγ + TCRG + Dβ-Jβ T-PLL (n=33) 94% 47% 100% 94% 100% T-LGL (n=28) 86% 62% 96% 96% 100% PTCL-U (n=47) 85% 67% 98% 94% 100% AILT (n=37) 70% 61% 89% 92% 95% ALCL (n=43) 70% 48% 74% 74% 79%* TOTAL (n=188) 80% 58% 91% 89% 94%* (99%) * 20% to 25 % of anaplastic large cell lymphomas do not have TCR gene rearrangements (null-alcl) BIOMED-2 T-cell malignancy report: M. Brüggemann Leukemia 2007
11 Specific TCR/Ig gene rearrangements in T-cell malignancies Virtually all TCRαβ + T-cell malignancies have TCRG gene rearrangements and ~20% have TCRD gene rearrangements on one allele. A large part of TCRγδ + T-cell malignancies (30 to 40%) contain TCRB gene rearrangements, particularly incomplete Dβ-Jβ rearrangements. Approximately 5 to 20% of T-cell malignancies contain IGH gene rearrangements, including incomplete DH-JH rearrangements. IGK or IGL gene rearrangements are generally rare (<5%) in T-cell malignancies. Conclusion: TCR/Ig gene rearrangements are not lineage specific, even not for TCRαβ versus TCRγδ lineage. 11
12 Conclusions concerning BIOMED-2 multiplex tubes Unprecedentedly high level of clonality detection based on: primers recognise majority of functional gene segments (multiplexing of multiple primers) introduction of incomplete rearrangements: DH-JH and Dβ-Jβ usage of unmutated targets: DH-JH and IGK-Kde complementarity of Ig/TCR targets (e.g. IGH and IGK; TCRB andtcrg ) Clonal results in more than one tube! Minimal sets of BIOMED-2 multiplex tubes: suspected B-cell proliferation: VH-JH and IGK (5 tubes) suspected T-cell proliferation: TCRB and TCRG (5 tubes) TCRγδ + T-cell proliferation: TCRG and TCRD (3 tubes) 12
13 BIOMED-2 clonality strategy Suspected B-cell proliferations Suspected lymphoid proliferations of unknown origin (B or T) Suspected T-cell proliferations TCR γδ+ proliferations or immature T-cells IGH VH-JH 3 tubes preferably with IGK Vκ-Jκ IGK Kde 2 tubes clonality (generally multiple clonal results) TCRB Vβ-Jβ TCRB Dβ-Jβ 3 tubes preferably with TCRG 2 tubes no clonality TCRG but still suspected 2 tubes and IGK DH-J H and IGL TCRD 2 tubes clonality 1 tube no clonality detected no evidence of clonality; probably polyclonality (particularly in case of clear Gaussian GeneScan profiles or heteroduplex smears) no clonality detected Van Krieken et al., Leukemia 2007; 21:
14 When to use clonality testing? Reactive versus Malignant Recurrence versus new lymphoma Lineage verification Lymphoproliferations in immune deficiency NOT: Hodgkin versus non-hodgkin Know the pitfalls Interaction pathologist-molecular biologist
15 Standard lab procedure diagnostic requests Frozen tissue Paraffin-embedded tissue Quality control: Biomed size-ladder PCR (control gene primer sets) 400 bp 300 bp 200 bp 100 bp Representative tissue; HE stainings: percentage of B-T-cells, tumour load PJTA Groenen PhD, Dept of Pathology
16 Common problems encountered in workshops Unknown or poor quality of DNA Too few targets Only one read-out (genescan/heteroduplex) Misinterpretation of polyclonality in TCR Aspecific peaks Peaks outside size range Mathematical analysis of peaks Signing out as presence or absence of clonality Insufficient data on the histopathology
17 BIOMED-2 WP2a category: reactive tissue lesions Inclusion by experienced hematopathologists - cases clinically suspected for lymphoma, but histopathologically reactive - additional archival cases (retrospective) Site of biopsy lymph node (91) (6 axillary, 13 cervical, 7 inguinal, 1 mediastinal, 1 mesenteric, 1 midline, 20 neck, 1 para aortic, 5 submandibular, 36 of unknown site) appendix (1) sinus maxillaris (1) skin (4) spleen (5) thyroid gland (1) tonsil (7) BIOMED-2 Reactive lesions report; AW Langerak et al., Leukemia 2007
18 BIOMED-2 WP2a category: reactive tissue lesions Initial histopathological diagnosis Non-specific lymphadenitis, often follicular hyperplasia (n=74) EBV / CMV / HIV infection (n=5/1/1) Dermatopathic lymphadenopathy (n=4) Cat scratch disease (n=3) Toxoplasmosis (n=3) Sarcoidosis (n=2) Tuberculosis (n=2) Progressively transformed GC (n=2) Spleen in spherocytosis / spleen in ITP / trauma spleen (n=1/1/1) Myoepithelial sialo-adenitis (n=1) Kikuchi s lymphadenitis (n=1) Skin pseudo lymphoma (n=1) Hashimoto (n=1) Reactive, suspect B / T (n=1/1) BIOMED-2 Reactive lesions report; AW Langerak et al., Leukemia 2007
19 BIOMED-2 WP2a category: reactive tissue lesions (n=107) Results clear clonal results (categories I + II): 11% (12 / 107) - missed lymphomas (n=2) - unexplained clonal results (n=10) ambiguous molecular results (category III): 14% (15 / 107) - mainly oligoclonality (restricted repertoire) in polyclonal background clear polyclonal results (category IV): 75% (80 / 107) Ι ΙΙ ΙΙΙ ΙV : clear clonal products in multiple loci and multiple tubes : clear clonal products, but in single locus : ambiguous, mostly clonality with single technique or single tube : polyclonal in every locus and tube
20 Molecular results Clear clonal results n = 15 Clerical errors n = 3 Missed lymphomas n = 2 Unconfirmed clonal result n = 32
21 BIOMED-2 WP2a category: reactive tissue lesions Missed lymphomas (only recognised after molecular results!) involved by MF / Sezary syndrome (DE 069; cat. I) involved by MZL (DE 105; cat. I) Unexplained clonal results (n = 10) skin pseudolymphoma (NL 108; cat. I) EBV infection (ES 189; cat. I) ruptured spleen (remark. plasma cells!) (PT 021; cat. I) early AILD in M. Sjögren? (PT 024; cat. I) large GC in frozen tissue (GBN017;cat.I) reactive lymph node (treated for DLBCL) (DE 107; cat. I) reactive, but difficult (skin; B-NHL?) (GBN037;cat.II) traumatic spleen (unusual T-cells) (NL 111; cat. II) spleen ITP (NL 156; cat. II) reactive (progressively transformed GC) (NL 172; cat. II)
22 Clonality analysis and histopathology in case NL 111 TCRB Vβ-Jβ TCRB Dβ-Jβ TCRG monoclonal monoclonal monoclonal NL 111 NL 111 NL 111 polyclonal polyclonal polyclonal Hematoxylin and eosin staining of spleen Granzyme staining of spleen BIOMED-2 Reactive lesions report; AW 22Langerak et al, Leukemia 2007;21:222-2
23 Clonality analysis and histopathology in case PT 021 IGH VH-J H FR1 IGH VH-J H FR monoclonal monoclonal MC PT 021 PC PT 021 PT 021 polyclonal polyclonal Hematoxylin and eosin staining of spleen Ig κ staining of spleen Ig λ staining of spleen BIOMED-2 Reactive lesions report; AW 23 Langerak et al, Leukemia 2007;21:222-
24 Conclusions Clonality testing is a mature technique Well defined indications for hematopathology Needs expertise and experience from molecular biologist and pathologist Well recognised do s and don t s Clonality does not equal malignancy Yearly workshops in Nijmegen and worldwide Website for education and consultation ( Publications, guidelines, FAQ s, QA-program Workshops difficult cases
Antigen receptor (immunoglobulin and T-cell receptor) gene rearrangements: Utility in Routine Diagnostic Hematopathology
Antigen receptor (immunoglobulin and T-cell receptor) gene rearrangements: Utility in Routine Diagnostic Hematopathology DIAGNÓSTICO PRÁTICO DOS LINFOMAS São Paulo, Brasil 02 DE SETEMBRO DE 2011 Adam Bagg
More informationEuroClonality/BIOMED-2 guidelines for interpretation and reporting of Ig/TCR clonality testing in suspected lymphoproliferations
Leukemia (212) 26, 2159 2171 & 212 Macmillan Publishers Limited All rights reserved 887-6924/12 www.nature.com/leu REVIEW for interpretation and reporting of Ig/TCR clonality testing in suspected lymphoproliferations
More informationMultiple clonal Ig/TCR products: implications for interpretation of clonality findings
DOI 10.1007/s12308-011-0129-1 REVIEW Multiple clonal Ig/TCR products: implications for interpretation of clonality findings Anton W. Langerak & Jacques J. M. van Dongen Received: 30 June 2011 / Accepted:
More informationPitfalls in TCR gene clonality testing: teaching cases
DOI 10.1007/s12308-008-0013-9 ORIGINAL ARTICLE Pitfalls in TCR gene clonality testing: teaching cases Patricia J. T. A. Groenen & Anton W. Langerak & Jacques J. M. van Dongen & Johan H. J. M. van Krieken
More informationNGS immunogenetic analysis in vitro: clonality feasibility study
NGS immunogenetic analysis in vitro: clonality feasibility study ERIC EuroClonality-NGS 1-day workshop Rotterdam, NL, November 24, 2017 Anton W. Langerak, Laboratory for Medical Immunology, Dept. Immunology
More informationImmunoglobulin/T-cell receptor clonality diagnostics
Immunoglobulin/T-cell receptor clonality diagnostics Review 1. Introduction 2. Ig/T-cell receptor clonality detection 3. Standardization of polymerase chain reaction-based clonality testing 4. Pitfalls
More informationEuropean guidelines for the universal description of Ig / TCR clonality testing data
December 13, 2011 3rd Scientific Meeting MolecularDiagnostics.be t Elzenveld, Antwerp European guidelines for the universal description of Ig / TR clonality testing data Anton W. Langerak Dept. of Immunology
More informationLeukemia (2003) 17, & 2003 Nature Publishing Group All rights reserved /03 $
(2003) 17, 2257 2317 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu LEADING ARTICLE Design and standardization of PCR primers and protocols for detection of clonal
More informationClonality of the Immunoglobulin Heavy Chain Genes in B Cell Non-Hodgkin Lymphoma Using Semi-Nested PCR
ORIGINAL ARTICLE Tanaffos (2011) 10(2), 25-31 2011 NRITLD, National Research Institute of Tuberculosis and Lung Disease, Iran Clonality of the Immunoglobulin Heavy Chain Genes in B Cell Non-Hodgkin Lymphoma
More informationIgH/TCR Clonality Status. Performance Monitoring Cover Sheet. Final IgH Clonality Result IGH 131. Uncontrolled Copy
Performance Monitoring Cover Sheet Participant No: Trial No: IgH161703 Issue Date: 20 th December 2016 Performance Monitoring: Your Result N Consensus Clonality Result Final IgH Clonality Result IGH 131
More informationChapter 2 Hematolymphoid Proliferations of the Skin
Chapter 2 Hematolymphoid Proliferations of the Skin Carlos A. Torres-Cabala, Jonathan L. Curry, Su S. Chen and Roberto N. Miranda Introduction Molecular tests used by practicing pathologists are mostly
More informationA practical approach to diagnostic Ig/TCR clonality evaluation in clinical pathology
J Hematopathol (2012) 5:17 25 DOI 10.1007/s12308-011-0131-7 ORIGINAL ARTICLE A practical approach to diagnostic Ig/TCR clonality evaluation in clinical pathology Patricia J. T. A. Groenen & Annemiek van
More informationA practical strategy for the routine use of BIOMED-2 PCR assays for detection of B- and T-cell clonality in diagnostic haematopathology
research paper A practical strategy for the routine use of BIOMED-2 PCR assays for detection of B- and T-cell clonality in diagnostic haematopathology Hongxiang Liu, 1 Anthony J. Bench, 2 Chris M. Bacon,
More informationImproved reliability of lymphoma diagnostics via PCR-based clonality testing: F Report of the BIOMED-2 Concerted Action BHM4-CT
ORIGINAL ARTICLE (2006), 1 6 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu Improved reliability of lymphoma diagnostics via PCR-based clonality testing: F Report
More informationIgH REARRANGEMENTS MOLECULAR ANALYSIS KIT
IgH REARRANGEMENTS MOLECULAR ANALYSIS KIT CAT. Nº MAD-003994BP-2/5 (20 DETERMINATIONS) The diagnosis of malignant lymphomas is one of the most challenging tasks in histopathology. While many cases can
More informationStorage Conditions: -65 C to -85ºC (DNA controls may be separated from assay kits and stored at 2 C to 8 C)
Technical Service: Customer Service (US): Customer Service (EU): support@invivoscribe.com sales@invivoscribe.com sales-eu@invivoscribe.com IdentiClone TCRB + TCRG T-Cell Clonality Assay For Identification
More informationStorage Conditions: -65 C to -85ºC (DNA controls may be separated from assay kits and stored at 2 C to 8 C)
Technical Service: Customer Service (US): Customer Service (EU): support@invivoscribe.com sales@invivoscribe.com sales-eu@invivoscribe.com IdentiClone TCRB + TCRG T-Cell Clonality Assay For Identification
More informationDetection of T-cell clonality in patients with B-cell chronic lymphocytic leukemia
Detection of T-cell clonality in patients with B-cell chronic lymphocytic leukemia Dijana Djureinovic Degree project in biology, Master of science (1 year), 2008 Examensarbete i biologi 30 hp till magisterexamen,
More informationNGS-Based Clonality Testing Assessing Clonality Status, Somatic Hypermutation and Monitoring Minimum Residual Disease (MRD)
NGS-Based Clonality Testing Assessing Clonality Status, Somatic Hypermutation and Monitoring Minimum Residual Disease (MRD) Maria Arcila, M.D. Memorial Sloan Kettering Cancer Center Educational Goals Review
More informationDetection Limit of Monoclonal B-Cells Using Multiplex PCR and Laser- Induced Fluorescence Capillary Electrophoresis
The Korean Journal of Pathology 2011; 45: 582-588 http://dx.doi.org/10.4132/koreanjpathol.2011.45.6.582 Detection Limit of Monoclonal B-Cells Using Multiplex PCR and Laser- Induced Fluorescence Capillary
More informationDetection of clonality in follicular lymphoma using formalin-fixed, paraffin-embedded tissue samples and BIOMED-2 immunoglobulin primers
1 Department of Pathology, The Gade Institute, Haukeland University Hospital, Bergen, Norway 2 Section for Pathology, The Gade Institute, University of Bergen, Bergen, Norway Correspondence to Professor
More informationBasic principles of IG sequence analysis: Immunogenetic analysis: in vitro
IMMUNOGENETICS IN CLL IN THE NGS ERA Rotterdam, The Netherlands, November 24 th 2017 Basic principles of IG sequence analysis: Immunogenetic analysis: in vitro Lesley Ann Sutton Dept. of IGP, Uppsala University,
More informationTEMA 7. LA GENERACIÓN DE LA DIVERSIDAD
TEMA 7. LA GENERACIÓN DE LA DIVERSIDAD Ehrlich's side-chain theory. Ehrlich proposed that the combination of antigen with a preformed B-cell receptor (now known to be antibody) triggered the cell to produce
More informationIMPLEMENTATION OF MICROFLUIDIC CHIP ELECTROPHORESIS FOR THE DETECTION OF B-CELL CLONALITY
CT MEDC MRTNN 2016 16/1 DO: 10.1515/acm-2016-0002 17 MPLEMENTTON OF MCROFLUDC CHP ELECTROPHORESS FOR THE DETECTON OF B-CELL CLONLTY Vazan M 1,2, Kasubova 1,2, Vanochova 1, Lukac P 1,4, Plank L 3, Lasabova
More informationFor In Vitro Diagnostic Use. Catalog Number. Reagent Volume. Storage Conditions. Expiration Date. Consult Instructions for Use
Technical Service: Customer Service (US): Customer Service (EU): support@invivoscribe.com sales@invivoscribe.com sales-eu@invivoscribe.com IdentiClone IGH + IGK B-Cell Clonality Assay For Identification
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Defective T and B cell lineage development in the absence of 53BP1. a, Average number of thymocytes in WT, 53BP1 /, p53 /, 53BP1 / / p53, Nbs1 tr735 and 53BP1 / Nbs1 tr735 mice
More informationA comparative analysis of protocols for detection of T cell clonality in formalin-fixed, paraffin-embedded tissue implications for practical use
J Hematopathol (212) 5:7 16 DOI 1.17/s1238-11-128-2 ORIGINAL ARTICLE A comparative analysis of protocols for detection of T cell clonality in formalin-fixed, paraffin-embedded tissue implications for practical
More informationFrom the patient to the sequence : Primers, PCR, Detection of clonality, Sequencing
6th ERIC Educational workshop on IG gene analysis in CLL, Uppsala, SE, Sept 23, 2016 From the patient to the sequence : Primers, PCR, Detection of clonality, Sequencing Anton W. Langerak Dept. of Immunology
More informationUK NEQAS for Leukocyte Typing Scientific Meeting, Sheffield, UK 24 June 2013
UK NEQAS for Leukocyte Typing Scientific Meeting, Sheffield, UK 24 June 2013 Flow cytometry vs. Molecular techniques for Diagnosis, Classification and Monitoring of Hematological Malignancies Need of innovation,
More informationUNDERSTANDING THE CLONOSEQ ASSAY
FOR HEALTHCARE PROVIDERS UNDERSTANDING THE CLONOSEQ ASSAY Clonality (ID) and Tracking (MRD) Reports clonoseq is an FDA-cleared in vitro diagnostic (IVD) test service provided by Adaptive Biotechnologies
More informationMolecular Hematopathology Lymphomas. December 21, 2004
Molecular Hematopathology Lymphomas December 21, 2004 Translocations Small or large fragment of a chromosome fuses with another chromosome The fusion is viable The fusion chromosome is faithfully replicated
More informationAttribution: University of Michigan Medical School, Department of Microbiology and Immunology
Attribution: University of Michigan Medical School, Department of Microbiology and Immunology License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution
More informationTumour 2. Tumour 9. Tumour 25 Tumour 26. Tumour 27. t(6;16) doi: /nature06159 SUPPLEMENTARY INFORMATION Supplementary Figure 1
doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary Figure 1 Tumour Tumour 9 t(6;16) Tumour 5 Tumour 6 Tumour 7 www.nature.com/nature 1 doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary
More informationAntibody Structure. Antibodies
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationAntibody Structure supports Function
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More information- Contains an amplification mix for each one of the segments FR1-JH, FR2-JH and FR3-JH, and an internal control for verifying DNA quality.
! The diagnosis of malignant lymphomas is one of the most challenging tasks in histopathology. While many cases can be diagnosed from histomorphological and immunohistochemical data, it is occasionally
More informationIdentiClone TCRD Gene Clonality Assay For Identification of Clonal T Cell Receptor Delta Chain Gene Rearrangements For In Vitro Diagnostic Use
Technical Service: Customer Service (US): Customer Service (EU): support@invivoscribe.com sales@invivoscribe.com sales-eu@invivoscribe.com IdentiClone TCRD Gene Clonality Assay For Identification of Clonal
More informationABSTRACT. The adaptive immune system s response to invading pathogens depends on the ability of T
ABSTRACT McMILLAN, RUTH ERICA. Transcriptional Control of Dβ2. (Under the direction of Michael L. Sikes). The adaptive immune system s response to invading pathogens depends on the ability of T and B-lymphocytes
More informationImmunoglobulins Harry W Schroeder Jr MD PhD
Immunoglobulins Harry W Schroeder Jr MD PhD Division of Developmental and Clinical Immunology Departments of Medicine, Microbiology, and Genetics University of Alabama at Birmingham Immunoglobulin Has
More informationBIMM18 Dec 20 th - Flow cytometry in clinical diagnostics
BIMM18 Dec 20 th - Flow cytometry in clinical diagnostics I. B cell leukemia and lymphomas Immunophenotyping as part of the diagnostic work- up of hematologic malignancies offers a rapid and effective
More informationGENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY. Steven J. Norris, Ph.D
GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY Steven J. Norris, Ph.D Topics I. General principles II. The heavy chain Ig locus and VDJ rearrangement III. Light chain rearrangement. IV. Mechanisms of
More informationChapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity
Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy
More informationT and B cell gene rearrangement October 17, Ram Savan
T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR
More informationbioinformatics: state of art tools for NGS immunogenetics
bioinformatics: state of art tools for NGS immunogenetics Nikos Darzentas, Ph.D. CEITEC MU, Brno, Czech Republic bat.infspire.org nikos.darzentas@gmail.com Ministry of Health of theczech Republic, grant#
More informationLECTURE: 22 IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to:
LECTURE: 22 Title IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to: Identify the chromosome that contains the gene segments that encode the surface immunoglobulin heavy chain
More information4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig
4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig gene rearrangements Lineage commitment: transcription factors
More informationAVANÇOS NO DIAGNÓSTICO E CLASSIFICAÇÃO IMUNOFENOTIPICA DE LEUCEMIAS LINFOCITICAS CRÓNICAS B
AVANÇOS NO DIAGNÓSTICO E CLASSIFICAÇÃO IMUNOFENOTIPICA DE LEUCEMIAS LINFOCITICAS CRÓNICAS B CANCER RESEARCH CENTER IBSAL-UNIVERSITY OF SALAMANCA/CSIC HEMO 2016 Congreso Brasileiro de Hematologia, Hemoterapia
More informationWho pairs with whom? High-throughput sequencing of the human paired heavy and light chain repertoire
Who pairs with whom? High-throughput sequencing of the human paired heavy and light chain repertoire Technical Journal Club September 15 th Christina Müller Background - antibody repertoire is the sum
More informationClonality assay of IGH gene rearrangement in Iraqi patients with non hodgkin s lymphoma using FFPE tissue
Clonality assay of IGH gene rearrangement in Iraqi patients with non hodgkin s lymphoma using FFPE tissue Mustafa RY Abdullah 1*, Hazima MO Alabassi 1, Majeed AR Sabbah 2 1 Deprtment of Biology, College
More informationchronic leukemia lymphoma myeloma differentiated 14 September 1999 Transformed Pre- Ig Surface Surface Secreted B- ALL Macroglobulinemia Myeloma
Disease Usual phenotype acute leukemia precursor chronic leukemia lymphoma myeloma differentiated Pre- B-cell B-cell Transformed B-cell Plasma cell Ig Surface Surface Secreted Major malignant counterpart
More informationIMGT-ONTOLOGY and IMGT databases, tools and Web resources for immunoinformatics
IMGT-ONTOLOGY and IMGT databases, tools and Web resources for immunoinformatics Marie-Paule Lefranc Université Montpellier, CNRS First international Immunoinformatics Symposium Yokohama, Japan, 26-27 February
More informationAtlas of Genetics and Cytogenetics in Oncology and Haematology. IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction
Atlas of Genetics and Cytogenetics in Oncology and Haematology IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction I Historical questions II Answers II.1 Light chains (kappa or lambda) II.1.1
More informationOriginal Article Use of IGK gene rearrangement analysis for clonality assessment of lymphoid malignancies: a single center experience
Am J Blood Res 2011;1(2):167-174 www.ajblood.us /ISSN: 2160-1992/AJBR1108002 Original Article Use of IGK gene rearrangement analysis for clonality assessment of lymphoid malignancies: a single center experience
More informationAntibody Structure, and the Generation of B-cell Diversity. Chapter 4 5/1/17
Antibody Structure, and the Generation of B-cell Diversity B cells recognize their antigen without needing an antigen presenting cell Chapter 4 Structure of Immunoglobulins Structure and function Immunoglobulin
More informationIn vitro cultures of bone marrow stromal cells and progenitor B cells can accurately recapitulate the normal steps of B cell development.
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
More informationB cell development The stages of B cell development
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
More informationThese products are sold FOR RESEARCH USE ONLY; not for use in diagnostic procedures.
Minimal Residual Disease (MRD) testing by Next- Generation Sequencing (NGS) has become an important methodology demonstrating clear potential to optimize therapeutic management of lymphoproliferative diseases.
More informationTCRG T-Cell Clonality Assay
Instructions for Use TCRG T-Cell Clonality Assay For identification of clonal T cell receptor gamma chain gene rearrangements For RESEARCH USE ONLY. Not for use in diagnostic procedures. Schematic depiction
More informationRecombination Lecture, Dr. Aguilera 2/17/2014
Lymphocytes and Antigen Receptors Thymus T-Cells Lymph nodes Spleen } T+B-cells Paper Presentation: Bone Marrow Stem cells and B-cells Nat. Rev. Immunol. STEM CELL CLP Committed Lymphocyte Precursor T-cells
More informationApplications of AmpliSeq-based Ion Torrent TCRB Immune Repertoire Sequencing
Applications of AmpliSeq-based Ion Torrent TCRB Immune Repertoire Sequencing Timothy Looney, PhD Staff Scientist, Clinical Next-Generation Sequencing Division Thermo Fisher Scientific The world leader
More informationOutline. Clonality Targets. Human IGH locus. Human IGK locus. Human TRB locus
Complete Suite of NGS Clonality Assays with Bioinfmatics Identification and Tracking Patient Specific Clones Presha Shah, Ph.D. Development Scientist Outline Part I: LymphoTrack Products What are different
More informationImmunoglobulins. Generation of Diversity
Immunoglobulins Generation of Diversity Unfortunately, for this theory to be true the number of antibody genes would need to be 100-1000-fold greater than the entire human genome Introduction Immunologist
More informationElevated Immunoglobulins and Paraproteins
Elevated Immunoglobulins and Paraproteins NWL Pathology GP Study Afternoon Thursday 19 th October 2017 Dr Aristeidis Chaidos Consultant Haematologist and Honorary Senior Clinical Lecturer Hammersmith Hospital,
More informationElizabeth Ann Wilcox Chan. Department of Immunology Duke University. Date: Approved: Michael Krangel, Supervisor. Weiguo Zhang, Chair.
The Role of Tcrb Subnuclear Positioning in V(D)J Recombination by Elizabeth Ann Wilcox Chan Department of Immunology Duke University Date: Approved: Michael Krangel, Supervisor Weiguo Zhang, Chair Yuan
More informationchronic leukemia lymphoma myeloma differentiated 14 September 1999 Pr e- Transformed Ig Su rf ace Su rf ace Secre ted Myelom a
Disease Usual phenotype acute leukemia precursor chronic leukemia lymphoma myeloma differentiated Pr e- B-ce ll B-ce ll Transformed B-ce ll Plasma cell Ig Su rf ace Su rf ace Secre ted Major malignant
More informationCynthia L. Schultz, PhD, Yelena Akker, Juan Duu MD, and Howard Ratech, MM. Materials and Methods
Hematopathology / TANSPOTATION BUE O MOECUA DIANOSIS A ysis, Storage, and Transportation Buffer for ong-term, oom-temperature Preservation of Human Clinical ymphoid Tissue Samples Yielding High Molecular
More information2111: ALL Post-HCT. Add/ Remove/ Modify. Manual Section. Date. Description. Comprehensive Disease- Specific Manuals
2111: ALL Post-HCT The Acute Lymphoblastic Leukemia Post-HCT Data Form is one of the Comprehensive Report Forms. This form captures ALL-specific post-hct data such as: planned treatments post-hct, the
More informationApplications of the Ion AmpliSeq Immune Repertoire Assay Plus TCRβ
Applications of the Ion AmpliSeq Immune Repertoire Assay Plus TCRβ Timothy Looney, PhD Staff Scientist, Clinical Next-Generation Sequencing Division Thermo Fisher Scientific The world leader in serving
More informationV(D)J recombination and its defects
ESID Prague meeting, 14-15 May 2007 V(D)J recombination and its defects Mirjam van der Burg, PhD Dept. of Immunology Erasmus MC, Rotterdam NL m.vanderburg@erasmusmc.nl Outline - V(D)J recombination and
More informationProposals of B cells standard immunophenotyping in mature B cell non-hodgkin lymphomas
Clinical immunology Proposals of B cells standard immunophenotyping in mature B cell non-hodgkin lymphomas URSZULA PODSTAWKA, IZABELLA SZCZEPAŃSKA, JOANNA KOPEĆ-SZLĘZAK Department of Hematological Cytobiology,
More informationB cells Harry W Schroeder Jr MD PhD
B cells Harry W Schroeder Jr MD PhD Division of Clinical Immunology and Rheumatology Departments of Medicine, Microbiology, and Genetics University of Alabama at Birmingham Director, UAB Program in Immunology
More informationFlow Cytometry in the Diagnosis of Hematopoietic Neoplasia. Brent Wood MD, PhD Professor, Laboratory Medicine University of Washington, Seattle
Flow Cytometry in the Diagnosis of Hematopoietic Neoplasia Brent Wood MD, PhD Professor, Laboratory Medicine University of Washington, Seattle 1 Flow Cytometer 2 The Power of Flow Cytometry Single cell
More informationImmunology 2011 Lecture 9 Immunoglobulin Biosynthesis 3 October
Immunology 2011 Lecture 9 Immunoglobulin Biosynthesis 3 October APC Antigen processing (dendritic cells, MΦ et al.) Antigen "presentation" Ag/Ab complexes Antigenspecific triggering B T ANTIGEN Proliferation
More informationacute leukemia precursor chronic leukemia lymphoma
Disease Usual phenotype acute leukemia precursor chronic leukemia lymphoma myeloma differentiated t d Pre- B-cell B-cell Ig Surface Transformed B-cell Surface Plasma cell Secreted Major malignant counterpart
More informationDIAGNOSTIC APPLICATIONS
CHAPTER 7 MOLECULAR AND CYTOGENETIC STUDIES DIAGNOSTIC APPLICATIONS 7.1 B-cell clonality testing by PCR for diagnostic purposes 7.1.1 Immunoglobulin gene rearrangements Assessment of IgH gene rearrangements
More informationTowards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis
Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis Trevor Pugh, PhD, FACMG Princess Margaret Cancer Centre, University Health Network Dept.
More information1 Name. 1. (3 pts) What is apoptosis and how does it differ from necrosis? Which is more likely to trigger inflammation?
1 Name MCB 150 Midterm Eam #1 (100 points total) Please write your full name on each page of the eam!! The eam consists of 17 questions (6 pages). Each has a different point count as indicated. Please
More informationThe generation of lymphocyte antigen receptors (Chapter 5):
The generation of lymphocyte antigen receptors (Chapter 5): 1. Ig Gene Rearrangement (somatic recombination). 2. Ig Somatic Hypermutation. 3. Ig Class Switching 4. T cell Receptor Gene Rearragement 1.
More informationTheraLin. Universal Tissue Fixative Enabling Molecular Pathology
TheraLin Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology Contents Page # TheraLin Universal Tissue Fixative 3 Introduction 5 Easy
More informationFISH is better than BIOMED-2 PCR to detect IgH/BCL2 translocation in follicular lymphoma at diagnosis using paraffin-embedded tissue sections
Available online at www.sciencedirect.com Leukemia Research 32 (2008) 737 742 FISH is better than BIOMED-2 PCR to detect IgH/BCL2 translocation in follicular lymphoma at diagnosis using paraffin-embedded
More informationMolecular Diagnostics in Hematopathology. Madhuri Ramanathan Ph.D. Ridgewood, New Jersey ASCLS-NJ Spring Seminar April 14, 2016
Molecular Diagnostics in Hematopathology Madhuri Ramanathan Ph.D. Ridgewood, New Jersey ASCLS-NJ Spring Seminar April 14, 2016 Learning Objectives Explain the principles of Molecular Diagnostics Describe
More informationT he human immune system efficiently protects us against
249 ORIGINAL ARTICLE Receptor revision of immunoglobulin heavy chain genes in human MALT lymphomas D Lenze, A Greiner, C Knörr, I Anagnostopoulos, H Stein, M Hummel... See end of article for authors affiliations...
More informationImmunogenetics. Immunodeficiency
4.05.009 Immune response represents a system of recognition of foreign molecules. Immunogenetics Foreign molecules (proteins, glycoproteins, carbohydrates, ssdna, viruses) or parts of foreign molecules
More informationSupporting Information
(xe number cells) LSK (% gated) Supporting Information Youm et al../pnas. SI Materials and Methods Quantification of sjtrecs. CD + T subsets were isolated from splenocytes using mouse CD + T cells positive
More informationThe Trianni Mouse: Best-In-Class Technology for Human Antibody Discovery
The Trianni Mouse: Best-In-Class Technology for Human Antibody Discovery Corporate Overview Co David Meininger, PhD, MBA Chief Business Officer, Trianni 1 Our Mission Trianni is a biotech company with
More informationLecture 3. Used anti B cell marker antibodies to deplete in mice
Lecture 3 V-Gene Rearrangement and Expression Used anti B cell marker antibodies to deplete in mice Rat anti mouse CD19, anti mouse B220, and anti mouse CD22. Mice were then injected with a secondary antibody
More informationIMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS
A Prototype Ig Gene: Murine Kappa About 10 0 V κ gene segments 4 J Gene Segment s 1 C κ Gene Segmen t Multiple V gene segments, distant from J and C A few J gene segments One C gene segment GERMLINE Ig
More informationWhere not previously determined by morphology and immunophenotyping: Minimal residual disease (MRD) detection and monitoring (MRDDM)
CHAPTER 6 MOLECULAR AND CYTOGENETIC STUDIES TECHNIQUES 6.1 Introduction In most lymphoid proliferations, morphological assessment and immunophenotyping are sufficient to establish a diagnosis. In a minority
More informationdetection limit of cytomorphological techniques detection limit of immunophenotyping and PCR techniques cure follow-up in years
relative frequency of leukemic cells 1 10-1 10-2 10-3 10-4 10-5 10-6 10-7 0 Detection of minimal residual disease (MRD) detection limit of cytomorphological techniques detection limit of immunophenotyping
More informationMolecular Characterization of a Recurrent t(2;7) Translocation Linking CDK6 to the IGK Locus in Chronic B-cell Neoplasia
Molecular Characterization of a Recurrent t(2;7) Translocation Linking CDK6 to the IGK Locus in Chronic B-cell Neoplasia by Edward Parker A thesis submitted in conformity with the requirements for the
More informationPreanalytical Variables in Blood Collection: Impact on Precision Medicine
Preanalytical Variables in Blood Collection: Impact on Precision Medicine Carolyn Compton, MD, PhD Chair, Scientific Advisory Committee, Indivumed GmbH Professor of Life Sciences, ASU Professor of Laboratory
More informationGuidelines for the diagnosis of Multiple Myeloma Ass.lec.: Dr. Karam T. Agha M.Sc.Pathology
Guidelines for the diagnosis of Multiple Myeloma 2014 By:British Committee for Standards in Haematology (BCSH) Ass.lec.: Dr. Karam T. Agha M.Sc.Pathology Diagnosis, prognostic factors and disease monitoring
More informationHematolymphoid markers A decennium of experience in NordiQC
A decennium of NordiQC Hematolymphoid markers A decennium of experience in NordiQC Jan Klos M.D. Department of Pathology Stavanger University Hospital Norway 85 different epitopes assessed 31 runs ~ 5-6
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationProduct Description SALSA MLPA Probemix P438-D2 HLA
Product Description SALSA Probemix P438-D2 HLA To be used with the MLPA General Protocol. Version D2. Catalogue numbers: P438-025R: SALSA MLPA Probemix P438 HLA, 25 reactions. P438-050R: SALSA MLPA Probemix
More informationHuman Molecular Genetics Assignment 3 (Week 3)
Human Molecular Genetics Assignment 3 (Week 3) Q1. Which one of the following is an effect of a genetic mutation? a. Prevent the synthesis of a normal protein. b. Alters the function of the resulting protein
More informationTHE POTENTIAL ROLE OF VH REPLACEMENT IN EDITING AND GENERATING AUTOREACTIVE ANTIBODIES RUN FAN
THE POTENTIAL ROLE OF VH REPLACEMENT IN EDITING AND GENERATING AUTOREACTIVE ANTIBODIES by RUN FAN ZHIXIN ZHANG, MENTOR PETER D BURROWS LOUIS B JUSTEMENT JOHN D MOUNTZ HARRY W SCHROEDER A DISSERTATION Submitted
More informationCourse Agenda. Day One
Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase
More informationAdaptive Immunity: Specific Defenses of the Host
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 17 Adaptive Immunity: Specific Defenses of the Host The Adaptive Immune System Adaptive immunity:
More information