A tutorial introduction into the MIPS PlantsDB barley&wheat databases. Manuel Spannagl&Kai Bader transplant user training Poznan June 2013
|
|
|
- Christian Cunningham
- 6 years ago
- Views:
Transcription
1 A tutorial introduction into the MIPS PlantsDB barley&wheat databases Manuel Spannagl&Kai Bader transplant user training Poznan June 2013
2 MIPS PlantsDB tutorial - some exercises Please go to:
3 Tutorial objectives Search and navigate the MIPS PlantsDB instances Understand triticeae data concepts&contents and access Search and navigate the triticeae GenomeZippers Learn how to use the CrowsNest Synteny browser Use BLAST to identify candidate genes Download batch files to your local machine for further analysis
4 Access to species databases
5 Exercise 1 Go to the MIPS PlantsDB home page at Find all information available in PlantsDB about the Barley gene MLOC_ On what contig is it located? How many Barley genes do you find searching for WUSCHEL-related homeobox?
6 Exercise 2 Find details about a gene in the MIPS PlantsDB barley DB Find all barley genes carrying the annotation Alpha-glucosidase and open the gene report of the fourth hit (MLOC_ ) Identify the putative orthologs in other plant species and putative paralogs in barley how many are there and for what organisms do you find some? (hint: use gene family information) Download the genes protein and CDS sequence
7 Exercise 3 - background Brachypodium distachyon is a model organism for related, but much more complex triticeae species such as wheat and barley.
8 Exercise 3 Query complex genomes using reference organisms the barley GenomeZipper Can you identify the (approximate) location of the barley locus orthologous/syntenic to the brachypodium gene Bradi2g on the barley genome? What chromosome is it on, what is the appr. cm position? What marker is responsible for this anchoring? Are there any other genes in this syntenic position?
9 Exercise 4 - background Many related plant genomes share long stretches of conserved gene order: synteny This feature can be used to transfer knowledge from model to crop organisms Visualization of synteny is needed: CrowsNest tool Displays pre-calculated syntenic regions Browse from macro- to micro-synteny levels Integration of add. features such as Ka/Ks, gene families, density and heatmap plots
10 Exercise 4 - background
11 Exercise 4 Explore syntenic relationships between related plant genomes the CrowsNest tool Open the gene report of the Brachypodium gene from exercise 3: Bradi2g Start CrowsNest by clicking CrowsNest_SyntenyToBarley and explore the syntenic relationship of this gene region with barley What barley region is syntenic to the Bradi2g gene region, what chromosome and what gene? Is there an inversion on that chr.?
12 Exercise 5 Search for homologous genes in barley for your own sequence BLAST tool Download the DNA sequence from: ftp://ftpmips.helmholtzmuenchen.de/plants/user_training/unknowngrassseq.fa Use BLAST to identify the best matching barley (HC) gene model for this sequence: Remember the found barley gene identifier and search for it in MIPS PlantsDB barley
13 Exercise 5 continued Search for homologous genes in barley for your own sequence BLAST tool What kind of function does the barley gene likely perform? What functional domains (PFAM, Interpro) are annotated for that gene?
14 Exercise 6 Query complex genomes using reference organisms extract wheat genic sequence Download the DNA sequence from: Use BLAST to identify the best matching representative grass gene model for this sequence: ftp://ftpmips.helmholtzmuenchen.de/plants/user_training/unknowngrassseq.fa Extract&download the wheat sub-assembly sequences for the identified rep. Grass gene
15 Exercise 6 continued Query complex genomes using reference organisms extract wheat genic sequence Open the downloaded file What kind of information do you find encoded in the gene fragment identifiers?
16 Exercise 7 Download bulk genome data from MIPS PlantsDB Download all the protein sequences annotated for the barley genome Is there any categorization for these genes (such as confidence classes)? What kind of additional data is available as bulk download for barley?
A tutorial introduction into the MIPS PlantsDB barley&wheat database instances
transplant 2 nd user training workshop Poznan, Poland, June, 27 th, 2013 A tutorial introduction into the MIPS PlantsDB barley&wheat database instances TUTORIAL ANSWERS Please direct any questions related
Triticeae genome MIPS PlantsDB. Manuel Spannagl transplant workshop Versailles Nov 2012
Triticeae genome resources @ MIPS PlantsDB Manuel Spannagl transplant workshop Versailles Nov 2012 What is MIPS PlantsDB? Generic database schema+system for the integration, management and (comparative)
Integrating and Leveraging Cereal and Grass Genome Resources. David Marshall Information and Computational Sciences Group
Integrating and Leveraging Cereal and Grass Genome Resources David Marshall Information and Computational Sciences Group David.Marshall@hutton.ac.uk What I m going to cover Brief overview of the new barley
Browser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1)
FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) 1.1 Finding a gene using text search. Note: For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium.
Data Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Finding Genes, Building Search Strategies and Visiting a Gene Page
Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use
Finding Genes, Building Search Strategies and Visiting a Gene Page
Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use
How to use Variant Effects Report
How to use Variant Effects Report A. Introduction to Ensembl Variant Effect Predictor B. Using RefSeq_v1 C. Using TGACv1 A. Introduction The Ensembl Variant Effect Predictor is a toolset for the analysis,
Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M.
Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Brent Prerequisites: A Simple Introduction to NCBI BLAST Resources: The GENSCAN
Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
Overview of the next two hours...
Overview of the next two hours... Before tea Session 1, Browser: Introduction Ensembl Plants and plant variation data Hands-on Variation in the Ensembl browser Displaying your data in Ensembl After tea
user s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
BME 110 Midterm Examination
BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource
Functional analysis using EBI Metagenomics
Functional analysis using EBI Metagenomics Contents Tutorial information... 2 Tutorial learning objectives... 2 An introduction to functional analysis using EMG... 3 What are protein signatures?... 3 Assigning
Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries.
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. O. A. Olsen, T. Belova, B. Zhan, S. R. Sandve, J. Hu, L. Li, J. Min, J. Chen,
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO Luigi Cattivelli, The International Durum Wheat Genome Sequencing Consortium 31/01/2017 1 Durum wheat Durum wheat with a total production of about
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
![Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G](/thumbs/95/123686269.jpg "Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G")
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
Chimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
Chimp BAC analysis: Adapted by Wilson Leung and Sarah C.R. Elgin from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. Michael R.
Chimp BAC analysis: Adapted by Wilson Leung and Sarah C.R. Elgin from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. Michael R. Brent Prerequisites: BLAST exercise: Detecting and Interpreting Genetic
Small Exon Finder User Guide
Small Exon Finder User Guide Author Wilson Leung wleung@wustl.edu Document History Initial Draft 01/09/2011 First Revision 08/03/2014 Current Version 12/29/2015 Table of Contents Author... 1 Document History...
Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009)
Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009) Prerequisites: BLAST Exercise: An In-Depth Introduction to NCBI BLAST Familiarity
COMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
RNA-Seq Analysis. August Strand Genomics, Inc All rights reserved.
RNA-Seq Analysis August 2014 Strand Genomics, Inc. 2014. All rights reserved. Contents Introduction... 3 Sample import... 3 Quantification... 4 Novel exon... 5 Differential expression... 12 Differential
UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
1 st transplant user training workshop Versailles, 12th-13th November 2012
trans-national Infrastructure for Plant Genomic Science 1 st transplant user training workshop Versailles, 12th-13th November 2012 Paul Kersey, EMBL-EBI More people, less land Plant genome sequences, 2005
Identifying Regulatory Regions using Multiple Sequence Alignments
Identifying Regulatory Regions using Multiple Sequence Alignments Prerequisites: BLAST Exercise: Detecting and Interpreting Genetic Homology. Resources: ClustalW is available at http://www.ebi.ac.uk/tools/clustalw2/index.html
Bioinformatics & Protein Structural Analysis. Bioinformatics & Protein Structural Analysis. Learning Objective. Proteomics
The molecular structures of proteins are complex and can be defined at various levels. These structures can also be predicted from their amino-acid sequences. Protein structure prediction is one of the
Knowledge-Guided Analysis with KnowEnG Lab
Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing
Comparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs.
Page 1 REMINDER: BMI 214 Industry Night Comparative Genomics Russ B. Altman BMI 214 CS 274 Location: Here (Thornton 102), on TV too. Time: 7:30-9:00 PM (May 21, 2002) Speakers: Francisco De La Vega, Applied
Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
CS313 Exercise 1 Cover Page Fall 2017
CS313 Exercise 1 Cover Page Fall 2017 Due by the start of class on Monday, September 18, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try
Why learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
Hands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang
Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang Ruth Howe Bio 434W April 1, 2010 INTRODUCTION De novo annotation is the process by which a finished genomic sequence is searched for
Annotating Fosmid 14p24 of D. Virilis chromosome 4
Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome
Annotation of a Drosophila Gene
Annotation of a Drosophila Gene Wilson Leung Last Update: 12/30/2018 Prerequisites Lecture: Annotation of Drosophila Lecture: RNA-Seq Primer BLAST Walkthrough: An Introduction to NCBI BLAST Resources FlyBase:
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
Access to genes and genomes with. Ensembl. Worked Example & Exercises
Access to genes and genomes with Ensembl Worked Example & Exercises September 2006 1 CONTENTS WORKED EXAMPLE... 2 BROWSING ENSEMBL... 21 Exercises... 21 Answers... 22 BIOMART... 25 Exercises... 25 Answers...
SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen
SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen The tutorial is designed to take you through the steps necessary to access SNP data from the primary database resources:
Supplement to: The Genomic Sequence of the Chinese Hamster Ovary (CHO)-K1 cell line
Supplement to: The Genomic Sequence of the Chinese Hamster Ovary (CHO)-K1 cell line Table of Contents SUPPLEMENTARY TEXT:... 2 FILTERING OF RAW READS PRIOR TO ASSEMBLY:... 2 COMPARATIVE ANALYSIS... 2 IMMUNOGENIC
Applied Bioinformatics
Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement
Guided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
Bioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
What I hope you ll learn. Introduction to NCBI & Ensembl tools including BLAST and database searching!
What I hope you ll learn Introduction to NCBI & Ensembl tools including BLAST and database searching What do we learn from database searching and sequence alignments What tools are available at NCBI What
Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]
![Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]](/thumbs/75/71877651.jpg "Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]")
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web
Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009
Page 1 Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 2 Introduction: Annotation is the process of analyzing the genomic sequence of an organism. Besides identifying
CGE Pipeline. Content 1. The Batch Upload 2. The Pipeline 3. The User System 4. The List Tool 5. The Map Tool 6. Exercises
CGE Pipeline Content 1. The Batch Upload 2. The Pipeline 3. The User System 4. The List Tool 5. The Map Tool 6. Exercises Jose Luis Bellod Cisneros PhD. Student Content 1. The Batch Upload 2. The Pipeline
Nature Biotechnology: doi: /nbt.3943
Supplementary Figure 1. Distribution of sequence depth across the bacterial artificial chromosomes (BACs). The x-axis denotes the sequencing depth (X) of each BAC and y-axis denotes the number of BACs
(a) (3 points) Which of these plants (use number) show e/e pattern? Which show E/E Pattern and which showed heterozygous e/e pattern?
1. (20 points) What are each of the following molecular markers? (Indicate (a) what they stand for; (b) the nature of the molecular polymorphism and (c) Methods of detection (such as gel electrophoresis,
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
NCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
Genomic, genetic and phenomic plant data at the INRA URGI : GnpIS.
Genomic, genetic and phenomic plant data at the INRA URGI : GnpIS. Training on Triticeae GnpIS presentation Part I, Wheat Genomic resources Quick tour of private sections Part II, Genetic resources and
Gene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September
CGE Pipeline. Content 1. The User System 2. The Batch Upload 3. The Pipeline 4. The List Tool 5. The Map Tool 6. FuturePlans 7.
CGE Pipeline Content 1. The User System 2. The Batch Upload 3. The Pipeline 4. The List Tool 5. The Map Tool 6. FuturePlans 7. Q&A Jose Luis Bellod Cisneros PhD. Student Content 1. The Batch Upload 2.
TIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
ab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
INE: a rice genome database with an integrated map view
2000 Oxford University Press Nucleic Acids Research, 2000, Vol. 28, No. 1 97 101 INE: a rice genome database with an integrated map view Katsumi Sakata, Baltazar A. Antonio 1, Yoshiyuki Mukai 1, Hideki
The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.
Data mining in Ensembl with BioMart Worked Example The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Which other genes related to human
Chapter 15 The Human Genome Project and Genomics. Chapter 15 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning
Chapter 15 The Human Genome Project and Genomics Genomics Is the study of all genes in a genome Relies on interconnected databases and software to analyze sequenced genomes and to identify genes Impacts
Worksheet for Bioinformatics
Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research
Genomics: Genome Browsing & Annota3on
Genomics: Genome Browsing & Annota3on Lecture 4 of 4 Introduc/on to BioMart Dr Colleen J. Saunders, PhD South African National Bioinformatics Institute/MRC Unit for Bioinformatics Capacity Development,
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get
PRIMEGENSw3 User Manual
PRIMEGENSw3 User Manual PRIMEGENSw3 is Web Server version of PRIMEGENS program to automate highthroughput primer and probe design. It provides three separate utilities to select targeted regions of interests
Tutorial for Stop codon reassignment in the wild
Tutorial for Stop codon reassignment in the wild Learning Objectives This tutorial has two learning objectives: 1. Finding evidence of stop codon reassignment on DNA fragments. 2. Detecting and confirming
Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan
Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan Yasunari Ogihara 1, Kanako Kawaura 1, Shuhei Nasuda 2, Takashi R. Endo 2, Katsuyuki Hayakawa 3, Jaroslav Dolezel 4,Hirokazu Handa
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for you to discover methylation changes at specific genomic
The genome of Leishmania panamensis: insights into genomics of the L. (Viannia) subgenus.
SUPPLEMENTARY INFORMATION The genome of Leishmania panamensis: insights into genomics of the L. (Viannia) subgenus. Alejandro Llanes, Carlos Mario Restrepo, Gina Del Vecchio, Franklin José Anguizola, Ricardo
Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
Introgression Browser tutorial
Introgression Browser tutorial EU-TransPLANT Training course: exploring plant variation data Jan-Peter Nap, Sven Warris, Saulo Alves Aflitos Access at EBI: Family name A-I, please use: http://10.7.243.39:10000
Assessing De-Novo Transcriptome Assemblies
Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,
LECTURE 12: INSIGHTS FROM GENOME SEQUENCING
LECTURE 12: INSIGHTS FROM GENOME SEQUENCING Read Chapter 10 (p366-375) DOE s Genomics and its implications (link at course website) STS (p359), SNP, SSR (integrates the following) Linkage, Physical, Sequence
Introduction to DNA-Sequencing
informatics.sydney.edu.au sih.info@sydney.edu.au The Sydney Informatics Hub provides support, training, and advice on research data, analyses and computing. Talk to us about your computing infrastructure,
Exercise I, Sequence Analysis
Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt
Kyoto Encyclopedia of Genes and Genomes (KEGG)
NPTEL Biotechnology -Systems Biology Kyoto Encyclopedia of Genes and Genomes (KEGG) Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded
Investigating Inherited Diseases
Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise to inherited diseases.
What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?
Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression
MODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
Do engineered ips and ES cells have similar molecular signatures?
Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series
Why study sequence similarity?
Sequence Similarity Why study sequence similarity? Possible indication of common ancestry Similarity of structure implies similar biological function even among apparently distant organisms Example context:
Browsing Genomes with Ensembl Genomes
Browsing Genomes with Ensembl Genomes www.ensemblgenomes.org Coursebook http://www.ebi.ac.uk/~blaise/beca BECA- ILRI 16 th October 2013 Chat room: http://tinyurl.com/ensembl-nairobi TABLE OF CONTENTS Introduction
HC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet
HC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet NAME: DATE: QUESTION ONE Using primers given to you by your TA, you carried out sequencing reactions to determine the identity of the
Community-assisted genome annotation: The Pseudomonas example. Geoff Winsor, Simon Fraser University Burnaby (greater Vancouver), Canada
Community-assisted genome annotation: The Pseudomonas example Geoff Winsor, Simon Fraser University Burnaby (greater Vancouver), Canada Overview Pseudomonas Community Annotation Project (PseudoCAP) Past
Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background
Functional profiling of metagenomic short reads: How complex are complex microbial communities?
Functional profiling of metagenomic short reads: How complex are complex microbial communities? Rohita Sinha Senior Scientist (Bioinformatics), Viracor-Eurofins, Lee s summit, MO Understanding reality,
CrusView is a tool for karyotype/genome visualization and comparison of crucifer species. It also provides functions to import new genomes.
CrusView Manual CrusView is a tool for karyotype/genome visualization and comparison of crucifer species. It also provides functions to import new genomes. Contents System Requirement..........................................
BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES
BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes What are the starting and end points for
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
Aaditya Khatri. Abstract
Abstract In this project, Chimp-chunk 2-7 was annotated. Chimp-chunk 2-7 is an 80 kb region on chromosome 5 of the chimpanzee genome. Analysis with the Mapviewer function using the NCBI non-redundant database