Korilog. high-performance sequence similarity search tool & integration with KNIME platform. Patrick Durand, PhD, CEO. BIOINFORMATICS Solutions
|
|
- Edmund Lynch
- 6 years ago
- Views:
Transcription
1 KLAST high-performance sequence similarity search tool & integration with KNIME platform Patrick Durand, PhD, CEO
2 Sequence analysis big challenge DNA sequence... Context 1. Modern sequencers produce huge amount of data 2. Reference databanks contain large amount of data Problem How to compare all that data quickly and efficiently? Our answer KLAST deluge of data
3 The KLAST project Context Public/private collaborative R&D project to create new high-performance tools for NGS Partners team.inria.fr/genscale Duration Stage 1: : creation of KLAST Stage 2: : enhancements of KLAST + metagenomics oriented tools Funding and Support Région Bretagne / Oséo Innovation / CRITT Santé Bretagne
4 KLAST algorithm KLAST = PLAST + ORIS + data filtering engine Algorithm PLAST Protein / Protein algorithm (KLASTp, KLASTx, tklastn, tklastx) Van-Hoa Nguyen, Dominique Lavenier, «PLAST: Parallel Local Alignment Search Tool for database comparison», BMC Bioinformatics 2009 Algorithm ORIS Nucleotide / Nucleotide algorithm (KLASTn) Dominique Lavenier, «Ordered Index Seed Algorithm for Intensive DNA Sequence Comparison», HiCOMB 2008 Efficient usage of hardware capabilities Multi-cores architectures SSE3 architecture / AVX2 ready
5 KLAST algorithm Differences between KLAST and BLAST amino acid algorithm * hits localization (subset seeds) + hits filtering (specific hardware usage) nucleotides algorithm * hits filtering (specific heuristic & specific hardware usage) data filtering engine (scores, e-value, identity, coverage, etc.) Common parts between KLAST and BLAST last algorithm step (dynamic programming) + statistical model Questions what are the differences between tools results? (quality) how fast KLAST is compared to BLAST? (speed)
6 Benchmark Study of Tara Oceans data sets KLAST and BLAST+ benchmark: comparison of 8,245 sequences (translated 454 reads) from Tara Oceans metagenomic data against 15 million proteins from Uniprot. Both algorithms ran on 8 Intel Xeon cores. 1. Speedup is 18x 2. KLAST covers 96% of BLAST results 8,238 min vs. 469 min Benchmark data courtesy of Jean-Marc Aury, Eric Pelletier and Thomas Vannier research team (National Sequencing Centre CEA, France).
7 KLAST integration Challenge Combining KLAST sequence comparison engine and data integration & analysis tools
8 Integration with KNIME What is KLAST Extension for KNIME? Provides nodes to + run Klast on NGS data sets + annotate results: Enzyme, GO, InterPro, NCBI Taxonomy (full and Lowest Common Ancestor) + filter data + import and export sequences and results + quickly prototype sequence analysis workflows + manage databanks: EMBL, Genbank, Uniprot, RefSeq, Silva, DNA Barcoding, standard FASTA, user-defined, etc.
9 KLAST: graphical mode Study of Tara Oceans data sets Dataset: klastp comparison of 8,245 proteins vs. Uniprot (15 million sequences) CPU time : 469 minutes for klastp workflow vs minutes for blastp on a Genoscope cluster node (8 cores). Speedup: 18x Datasets and tests provided by Jean-Marc Aury, Eric Pelletier and Thomas Vannier (French National Sequencing Center / Genoscope / CEA)
10 KLAST: graphical mode Study of functional & taxonomy diversity Display the taxonomy diversity of a result dataset as a piechart Dataset: klastx comparison of 97,000 sequences (454 reads) vs. SwissProt_bacteria (350,000 sequences) Computation: 2h on an Apple MacBook Air (4 cores, 4 Go RAM). Metagenomics dataset provided by Philippe Vandenkoornhuyse and Alexis Dufresne, CAREN CNRS UMR 6553 EcoBio, Rennes
11 B I O I N F O R M AT I C S Solutions More information: contact Patrick Durand pdurand@korilog.com Phone: +33 (0)
ELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationNovel HPC technologies for Rapid Analysis in Bioinformatics Presenter: Paul Walsh, nsilico Life Science Ltd, Ireland
Presenter: Paul Walsh, nsilico Life Science Ltd, Ireland Tristan Cabel, Gabriel Hautreux, Eric Boyer: CINES, France Simon Wong: ICHEC, Ireland Nicolas Mignerey: GENCI, France Synthetic Biotech Revolution!
More informationGenScale Scalable, Optimized and Parallel Algorithms for Genomics. Dominique LAVENIER
GenScale Scalable, Optimized and Parallel Algorithms for Genomics Dominique LAVENIER Context New Sequencing Technologies - NGS Exponential growth of genomic data Drastic decreasing of costs Emergence of
More informationBioinformatic tools for metagenomic data analysis
Bioinformatic tools for metagenomic data analysis MEGAN - blast-based tool for exploring taxonomic content MG-RAST (SEED, FIG) - rapid annotation of metagenomic data, phylogenetic classification and metabolic
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationProtein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
More informationLarge Scale Enzyme Func1on Discovery: Sequence Similarity Networks for the Protein Universe
Large Scale Enzyme Func1on Discovery: Sequence Similarity Networks for the Protein Universe Boris Sadkhin University of Illinois, Urbana-Champaign Blue Waters Symposium May 2015 Overview The Protein Sequence
More informationUNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics
UNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, 2010 SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics DURATION: 3 HOURS TOTAL MARKS: 125 Internal Examiner: Dr. Ché Pillay External Examiner: Prof. Nicola
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationRNA sequencing with the MinION at Genoscope
RNA sequencing with the MinION at Genoscope Jean-Marc Aury jmaury@genoscope.cns.fr @J_M_Aury December 13, 2017 RNA workshop, Genoscope Overview Genoscope Overview MinION sequencing at Genoscope RNA-Seq
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationIntroduction to EMBL-EBI.
Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationUSING HPC CLASS INFRASTRUCTURE FOR HIGH THROUGHPUT COMPUTING IN GENOMICS
USING HPC CLASS INFRASTRUCTURE FOR HIGH THROUGHPUT COMPUTING IN GENOMICS Claude SCARPELLI Claude.Scarpelli@cea.fr FUNDAMENTAL RESEARCH DIVISION GENOMIC INSTITUTE Intel DDN Life Science Field Day Heidelberg,
More informationNext Generation Sequencing for Metagenomics
Next Generation Sequencing for Metagenomics Genève, 13.10.2016 Patrick Wincker, Genoscope-CEA Human and model organisms sequencing were initially based on the Sanger method Sanger shotgun sequencing was
More informationCloudLCA: finding the lowest common ancestor in metagenome analysis using cloud computing
Protein Cell 2012, 3(2): 148 152 DOI 10.1007/s13238-012-2015-8 RESEARCH ARTICLE CloudLCA: finding the lowest common ancestor in metagenome analysis using cloud computing Guoguang Zhao 1,4*, Dechao Bu 1,4*,
More informationCBC Data Therapy. Metagenomics Discussion
CBC Data Therapy Metagenomics Discussion General Workflow Microbial sample Generate Metaomic data Process data (QC, etc.) Analysis Marker Genes Extract DNA Amplify with targeted primers Filter errors,
More informationEnsembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
More informationWhat s New in LigandScout 4.4
What s New in LigandScout 4.4 What's New in LigandScout 4.4? 2D Molecule editor for convenient structure editing Binding affinity prediction and atom contribution display Automated protein binding site
More informationSupplementary Figures and Tables
Genome assembly using Nanopore-guided Long and Error-free DNA Reads Mohammed-Amin Madoui 1 *, Stefan Engelen 1 *, Corinne Cruaud 1, Caroline Belser 1, Laurie Bertrand 1, Adriana Alberti 1, Arnaud Lemainque
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationProtein Grouping, FDR Analysis and Databases.
Protein Grouping, FDR Analysis and Databases. March 15th 2012 Pratik Jagtap The Minnesota http://www.mass.msi.umn.edu/ Protein Grouping, FDR Analysis and Databases Overview. Protein Grouping : Concept
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationElixir: European Bioinformatics Research Infrastructure. Rolf Apweiler
Elixir: European Bioinformatics Research Infrastructure Rolf Apweiler EMBL-EBI Service Mission To enable life science research and its translation to medicine, agriculture, the bioindustries and society
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationGenomics. Data Analysis & Visualization. Camilo Valdes
Genomics Data Analysis & Visualization Camilo Valdes cvaldes3@miami.edu https://github.com/camilo-v Center for Computational Science, University of Miami ccs.miami.edu Today Sequencing Technologies Background
More informationSpectral Counting Approaches and PEAKS
Spectral Counting Approaches and PEAKS INBRE Proteomics Workshop, April 5, 2017 Boris Zybailov Department of Biochemistry and Molecular Biology University of Arkansas for Medical Sciences 1. Introduction
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationG4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
More informationBioinformatics for Microbial Biology
Bioinformatics for Microbial Biology Chaochun Wei ( 韦朝春 ) ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Fall 2013 1 Outline Part I: Visualization tools for microbial genomes Tools: Gbrowser Part II:
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationI AM NOT A METAGENOMIC EXPERT. I am merely the MESSENGER. Blaise T.F. Alako, PhD EBI Ambassador
I AM NOT A METAGENOMIC EXPERT I am merely the MESSENGER Blaise T.F. Alako, PhD EBI Ambassador blaise@ebi.ac.uk Hubert Denise Alex Mitchell Peter Sterk Sarah Hunter http://www.ebi.ac.uk/metagenomics Blaise
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationde novo paired-end short reads assembly
1/54 de novo paired-end short reads assembly Rayan Chikhi ENS Cachan Brittany Symbiose, Irisa, France 2/54 THESIS FOCUS Graph theory for assembly models Indexing large sequencing datasets Practical implementation
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationChimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
More informationBME 110 Midterm Examination
BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource
More informationA Prac'cal Guide to NCBI BLAST
A Prac'cal Guide to NCBI BLAST Leonardo Mariño-Ramírez NCBI, NIH Bethesda, USA June 2018 1 NCBI Search Services and Tools Entrez integrated literature and molecular databases Viewers BLink protein similarities
More informationDesigning Filters for Fast Protein and RNA Annotation. Yanni Sun Dept. of Computer Science and Engineering Advisor: Jeremy Buhler
Designing Filters for Fast Protein and RNA Annotation Yanni Sun Dept. of Computer Science and Engineering Advisor: Jeremy Buhler 1 Outline Background on sequence annotation Protein annotation acceleration
More informationIntroduction to BLAST
Introduction to BLAST PowerPoint by Ananth Kalyanaraman School of Electrical Engineering and Computer Science Washington State University SC08 Education Sequence Comparison for Metagenomics 1 About the
More informationAn Interactive Workflow Generator to Support Bioinformatics Analysis through GPU Acceleration
An Interactive Workflow Generator to Support Bioinformatics Analysis through GPU Acceleration Anuradha Welivita, Indika Perera, Dulani Meedeniya Department of Computer Science and Engineering University
More informationWorksheet for Bioinformatics
Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research
More informationShannon pipeline plug-in: For human mrna splicing mutations CLC bio Genomics Workbench plug-in CLC bio Genomics Server plug-in Features and Benefits
Shannon pipeline plug-in: For human mrna splicing mutations CLC bio Genomics Workbench plug-in CLC bio Genomics Server plug-in Features and Benefits Cytognomix introduces a line of Shannon pipeline plug-ins
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationOutline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
More informationMatch the Hash Scores
Sort the hash scores of the database sequence February 22, 2001 1 Match the Hash Scores February 22, 2001 2 Lookup method for finding an alignment position 1 2 3 4 5 6 7 8 9 10 11 protein 1 n c s p t a.....
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationPractical Bioinformatics for Life Scientists. Week 14, Lecture 27. István Albert Bioinformatics Consulting Center Penn State
Practical Bioinformatics for Life Scientists Week 14, Lecture 27 István Albert Bioinformatics Consulting Center Penn State No homework this week Project to be given out next Thursday (Dec 1 st ) Due following
More informationRead Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
More informationDeakin Research Online
Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationExercise I, Sequence Analysis
Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt
More informationImaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized
1 2 3 Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized medicine, risk assessment etc Public Health Bio
More informationA New Algorithm for Protein-Protein Interaction Prediction
A New Algorithm for Protein-Protein Interaction Prediction Yiwei Li The University of Western Ontario Supervisor: Dr. Lucian Ilie Overview 1 Background 2 Previous approaches Experimental approaches Computational
More informationHiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
More informationFunctional profiling of metagenomic short reads: How complex are complex microbial communities?
Functional profiling of metagenomic short reads: How complex are complex microbial communities? Rohita Sinha Senior Scientist (Bioinformatics), Viracor-Eurofins, Lee s summit, MO Understanding reality,
More informationHot Topics. What s New with BLAST?
Hot Topics What s New with BLAST? Slides based on NCBI talk at American Society of Human Genetics October 2005 Hot Topics Outline I. New BLAST Algorithm: Discontiguous MegaBLAST II. New Databases III.
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More informationBLAST. Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences.
BLAST Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences. An example could be aligning an mrna sequence to genomic DNA. Proteins are frequently composed of
More informationStay Tuned Computational Science NeSI. Jordi Blasco
Computational Science Team @ NeSI Jordi Blasco (jordi.blasco@nesi.org.nz) Outline 1 About NeSI CS Team Who we are? 2 Identify the Bottlenecks Identify the Most Popular Apps Profile and Debug 3 Tuning Increase
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More informationFACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE
FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)
More informationBGGN 213: Foundations of Bioinformatics (Fall 2017)
BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on
More informationGandiva: Introspective Cluster Scheduling for Deep Learning
Gandiva: Introspective Cluster Scheduling for Deep Learning Wencong Xiao, Romil Bhardwaj, Ramachandran Ramjee, Muthian Sivathanu, Nipun Kwatra, Zhenhua Han, Pratyush Patel, Xuan Peng, Hanyu Zhao, Quanlu
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationWhat s New for School Year in Phage Genome Annotation
Phagehunting Program What s New for School Year 2013-14 in Phage Genome Annotation Created by DJS December, 2013. The purpose of this document is to target the most prominent changes and/or updates to
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationSurviving the Life Sciences Data Deluge using Cray Supercomputers
Surviving the Life Sciences Data Deluge using Cray Supercomputers Bhanu Rekepalli and Paul Giblock National Institute for Computational Sciences The University of Tennessee Knoxville, TN, USA bhanu@utk.edu,
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationComputing for Metagenome Analysis
New Horizons of Computational Science with Heterogeneous Many-Core Processors Computing for Metagenome Analysis National Institute of Genetics Hiroshi Mori & Ken Kurokawa Contents Metagenome Sequence similarity
More informationGPU-Meta-Storms: Computing the similarities among massive microbial communities using GPU
GPU-Meta-Storms: Computing the similarities among massive microbial communities using GPU Xiaoquan Su $, Xuetao Wang $, JianXu, Kang Ning* Shandong Key Laboratory of Energy Genetics, CAS Key Laboratory
More informationab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More informationAnnotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
More informationAddressing the I/O bottleneck of HPC workloads. Professor Mark Parsons NEXTGenIO Project Chairman Director, EPCC
Addressing the I/O bottleneck of HPC workloads Professor Mark Parsons NEXTGenIO Project Chairman Director, EPCC I/O is key Exascale challenge Parallelism beyond 100 million threads demands a new approach
More informationAgenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
More informationThis practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.
PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationBioinformatics to chemistry to therapy: Some case studies deriving information from the literature
Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry:
More informationPlant genome annotation using bioinformatics
Plant genome annotation using bioinformatics ghorbani mandolakani Hossein, khodarahmi manouchehr darvish farrokh, taeb mohammad ghorbani24sma@yahoo.com islamic azad university of science and research branch
More informationIntroduction to DNA-Sequencing
informatics.sydney.edu.au sih.info@sydney.edu.au The Sydney Informatics Hub provides support, training, and advice on research data, analyses and computing. Talk to us about your computing infrastructure,
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationLARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES
1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,
More informationFunction Prediction of Proteins from their Sequences with BAR 3.0
Open Access Annals of Proteomics and Bioinformatics Short Communication Function Prediction of Proteins from their Sequences with BAR 3.0 Giuseppe Profiti 1,2, Pier Luigi Martelli 2 and Rita Casadio 2
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationELIXIR: data for molecular biology and points of entry for marine scientists
ELIXIR: data for molecular biology and points of entry for marine scientists Guy Cochrane, EMBL-EBI EuroMarine 2018 General Assembly meeting 17-18 January 2018 www.elixir-europe.org Scales of molecular
More informationBIOINFORMATICS TO ANALYZE AND COMPARE GENOMES
BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes What are the starting and end points for
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationFast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing:
Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Patented, Anti-Correlation Technology Provides 99.5% Accuracy & Sensitivity to 5% Variant Knowledge Base and External Annotation
More informationAccelerating Motif Finding in DNA Sequences with Multicore CPUs
Accelerating Motif Finding in DNA Sequences with Multicore CPUs Pramitha Perera and Roshan Ragel, Member, IEEE Abstract Motif discovery in DNA sequences is a challenging task in molecular biology. In computational
More informationGoya Inference Platform & Performance Benchmarks. Rev January 2019
Goya Inference Platform & Performance Benchmarks Rev. 1.6.1 January 2019 Habana Goya Inference Platform Table of Contents 1. Introduction 2. Deep Learning Workflows Training and Inference 3. Goya Deep
More informationDatabases in genomics
Databases in genomics Search in biological databases: The most common task of molecular biologist researcher, to answer to the following ques7ons:! Are they new sequences deposited in biological databases
More informationAnnotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station
Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Library preparation Sequencing Hypothesis testing Bioinformatics 2 Why annotate?
More informationMetaGO: Predicting Gene Ontology of non-homologous proteins through low-resolution protein structure prediction and protein-protein network mapping
MetaGO: Predicting Gene Ontology of non-homologous proteins through low-resolution protein structure prediction and protein-protein network mapping Chengxin Zhang, Wei Zheng, Peter L Freddolino, and Yang
More informationChallenging algorithms in bioinformatics
Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationAnnotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
More information