Introduction. Everyone knew the winner would get a dynamite prize. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
|
|
- Grant Gregory
- 6 years ago
- Views:
Transcription
1 Introduction In the mid 1900 s, some classic experiments showed that it was the DNA in chromosomes that actually carried the information, and the race was on to figure out how DNA worked. Everyone knew the winner would get a dynamite prize.
2
3 Griffith called this phenomenon transformation, but he never determined what the stuff was. Conclusion for each of the below based on what you see? Fig. 16.1????????????????????????
4 In 1944, Oswald Avery, Maclyn McCarty and Colin MacLeod announced that the transforming substance was DNA. Still, many biologists were skeptical. Why, do you figure?
5 In 1952, Alfred Hershey and Martha Chase at Cold Spring Harbor showed that DNA was the genetic material by using a neat looking virus. Fig. 16.2a
6 Watch here to see what they did. Elegant, eh?
7 Here it is in diagram form. Fig. 16.2b
8 This DNA, then, has two main functions: 1. To hold instructions and have them used to make proteins. 2. To copy itself (replicate) so that those instructions can be passed on to the next generation. Generation of what????
9 By 1947, it was known that DNA was a polymer of nucleotides; what s a nucleotide? The bases could be adenine (A), thymine (T), guanine (G), or cytosine (C). Then Erwin Chargaff discovered an interesting fact about the bases.
10 The number of adenines was approximately equal to the number of thymines (%T = %A). The number of guanines was approximately equal to the number of cytosines (%G = %C). Human DNA, for example, is 30.9% adenine, 29.4% thymine, 19.9% guanine and 19.8% cytosine. The relationship between the ratios is obvious, yes?
11 But who would win the dynamite prize?! By the beginnings of the 1950 s, the race was on. Among the scientists working on the problem were Linus Pauling in California, and Maurice Wilkins and Rosalind Franklin in London. Two young no-names joined the London group. Politics and circumstance then stepped in to alter the fate of science history. Here s how
12 Rosalind Franklin used X-ray crystallography to take this neat picture of DNA. James Watson and Francis Crick snuck into her lab and took a peek. Were they being bad boys??? Fig. 16.4
13 By building models based on info gained from others research, they put together the model they called the double helix. Watch here Let s sketch it. It is said to be double stranded. What does strand mean here?
14 Fig. 16.5
15 Note how the bases bond. What does complementary mean? Anti-parallel? Fig. 16.6
16 The sequence of the four bases can be varied in countless ways, meeting the requirement of carrying large amounts of information. Base pairing allowed for a way of another requirement, accurate replication, as we will see. In April 1953, Watson and Crick published a succinct, onepage paper in Nature reporting their double helix model of DNA. Do we have time to read it and figure out the structure from it? How about a neat paper model? See it here.
17
18 How can DNA copy itself, you ask??? In a second paper, Watson and Crick published their hypothesis for how DNA replicates. What does the word template mean??
19 Here s the basic idea. Fig. 16.7
20 Enzymes separate the strands, forming a replication bubble. Replication proceeds in both directions until the entire molecule is copied. Let s watch some video and consider some of the enzymes involved. First, an oldie but goodie
21 In eukaryotes, there may be hundreds or thousands of replication bubbles per chromosome. Here s a sketch and about the best picture we can make. Fig
22 Helicase catalyzes the unzipping. DNA polymerases catalyze the elongation of new DNA at a replication fork. What difference does that anti-parallel thing make? Now watch herehttp://highered.mcgrawhill.com/sites/ /student_view0/chapter14/a nimations.html and select DNA Replication Fork
23 Introduction Let s review these fundamental concepts so when the details continue we don t lose sight of the forest for the trees. What actually causes your traits??? And this stuff is made where?? And DNA is where??? Problem????
24 RNA to the rescue!!! The bridge between DNA and protein synthesis is RNA. RNA is chemically similar to DNA, except that???
25 During transcription, a DNA strand provides a template, for the synthesis of an RNA strand. Are they identical? What would you call them? What is a messenger RNA (mrna) molecule? During translation, the mrna is used to make a specific sequence of amino acids. Translation occurs at ribosomes. Keep these trans words straight!!!
26 What is a dogma?? What kind of dogma do we have here? Is it really dogma???
27 SC.912.L.16.5: Explain the basic processes of transcription and translation and how they result in expression of genes.
28 1. Transcription is the DNA-directed synthesis of RNA: a closer look RNA polymerase (not helicase this time) unzips the DNA and bonds the RNA nucleotides as they basepair along the DNA template. Let s watch an animation from the Hbio DVD. Now maybe watch this
29 Transcription How does this look different than replication? How does it look the same? Fig. 17.6a
30 Fig. 17.6b
31 3. In the genetic code, nucleotide triplets specify amino acids In the days of the cold war, codes were a hot topic. How many amino acids can be coded for by two base code words? What about a triplet code? So does it have to be a triplet code? Lucky for us.
32 Digest this for a minute Fig. 17.3
33 So what exactly is a CODON??? It would take at least 300 nucleotides to code for a polypeptide that is 100 amino acids long.
34 Time for another race for another dynamite prize in the early 1960s. And the winner was How did he do it??? RIP 1/21/2010.
35 By the mid-1960s the entire code was deciphered. 61 of 64 triplets code for amino acids. Start codon??? Stop codons???? Differences??? Fig. 17.4
36 Determine the sequence of amino acids coded for by the following mrna strand CAGCCCAAGGGCCCGACAUUUGUG Now go back and give the base sequence of the DNA that coded for it. And the other side of that DNA?
37 The genetic code is redundant but not ambiguous. Say what??? Notice that codons that code for the same amino acid often differ only how???
38 4. The genetic code must have evolved very early in the history of life Neat picture!! What does it tell us? Fig. 17.5
39 A shared genetic vocabulary is one of the biggest reasons we feel strongly that all life forms are related, all evolving from a single common ancestor. This concept often shows up on a test.
40 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look Let s look at RNA that has a different job Fig
41 It includes a loop containing the anticodon and an attachment site at the 3 end for an amino acid. Fig
42 TRICK QUESTION!!! Which amino acid is attached to the trna with the following anti-codon? CCU AGA ACC CCC
43 And how about those ribosomes?? What are they made of?? Fig a
44 Review time!! Where, exactly, is that rrna made? Then what happens to make a subunit? Then what happens to make a complete ribosome??
45 Translation can be divided into three stages: initiation elongation termination These are very similar in principal to what happened in transcription: start building a long polymer, continue making it longer, finish. Let s watch some oldie-goldie animations.
46 Here s initiation This is the only time that can bind to without the help of. Fig
47 Elongation is very repetitive. Let s watch the oldie goldie on the Hbio DVD first. mations.html So what does that ribosome do? (song)
48 Termination occurs when one of the three stop codons reaches the A site. What s that attached to the stop codon??? And then what happens???? Fig
49 Diagram the translation of the protein coded for by the following mrna: CCGAAUGCCAGACUUCUGACCGA HOMEWORK: diagram the transcription of the bottom side of the following DNA; then diagram the translation of the resulting mrna: CCATGGCCAAACAGGCCTGACCG GGTACCGGTTTGTCCGGACTGGC
50
51 5. Point mutations can affect protein structure and function What is a MUTATION??? What is a gene mutation?? Point mutation?? Chromosome mutation?? Germ?? Somatic?? How many mutations do you think the person sitting next to you has????
52 Classic example of a point mutation!!! Sickle-cell disease. Fig
53 This type of point mutation is called a base-pair substitution. Will it always cause a problem? What does it sound like an insertion or deletion is? What changes in a protein would they cause?
54 Fig
55 What is a gene? revisiting the question The Mendelian concept of a gene views it as a discrete unit of inheritance that affects phenotype. Morgan and his colleagues assigned genes to specific loci on chromosomes. We can also view a gene as a specific nucleotide sequence along a region of a DNA molecule. We can define a gene functionally as a DNA sequence that codes for a specific polypeptide chain, or an RNA polymer.
56
57
58
59
60
61
62
63
64
65
66 SC.912.L.16.3/16.4/16.5 Describe the basic process of DNA replication & how it relates to the transmission & conservation of the genetic information; EXPLAIN HOW MUTATIONS IN THE DNA SEQUENCE MAY OR MAY NOT RESULT IN PHENOTYPIC CHANGE. Explain the basic processes of transcription & translation & how they result in the expression of genes
67 The genetic code is universal and common to almost all organisms. Of the following choices, which BEST preserves the genetic code from one generation to the next? A. protein synthesis B. enzyme activation C. RNA translation D. DNA Replication
68 As a result of base pairing in DNA, there is the same number of which two bases? A. Guanine and thymine B. Adenine and guanine C. Guanine and cytosine D. Adenine and cytosine
69 What IS DNA polymerase and what role does it play in DNA replication? A. It s a Lipid that separates the double Helix structure. B. It s a neurotransmitter present on chromosome tips needed for the process of replication. C. It s an enzyme that joins individual nucleotides. D. It s a codon base that is necessary only in prokaryotic dna replication in order to complete the process.
70 1 of the factors allowing DNA to fit inside the nucleus of a cell is its ability to: A. break apart into separate genes B. denature from the effect of an enzyme C. coil tightly around associated proteins D. extend to form very long, thin molecules
71 DNA is a polymer which is made of subunits of nucleotides. Which of these is not a nucleotide component? A. ribose sugar B. phosphate group C. deoxyribose sugar D. nitrogenous base
72 The diagram below shows models of nucleic acids. A segment of each model is highlighted. Which two segments in the models ONLY contain DNA? B. 2 & 4 C. 3 & 4 D. 1 & 3
73 A scientist is studying the results of a DNA gel electrophoresis from 4 different species. What kind of information can the scientist determine from this test? A. how closely related the species are B. which species are carnivores C. how the different species live D. what is the common ancestor for the species
74 Observe the karyotype below. Who would it belong to?
75 Scientists use a particular technique to measure the RNA levels in various cell types. Which of the following which BEST explains what is most directly observed by this technique? A. mutation B. protein synthesis C. gene expression D. pedigree within a family tree
76 The chart shown matches messenger RNA codons with amino acids. DNA strand has the codon TCA. According to the chart, the corresponding messenger RNA codes for which of the following amino acids? A. glycine B. leucine C. alanine D. serine
77 Translation is crucial to the process of protein synthesis. Which statement best describes what takes place during translation? A. An RNA copy of a DNA strand is made. B. A copy of chromosomal DNA is made. C. Information m RNA is converted into a sequence of amino acids in a protein. D. Instructions from DNA in the nucleus are brought to the cytoplasm.
78 What matches a nucleic acid codon with the proper amino acid during the process of translation?
79 Review the diagram, below. What process is Shown?
80 Of the following, which are the important differences between RNA and DNA? A. One is made of nucleotides, the other is not. one has messenger RNA, the other does not. B. One is necessary for the transmission & conservation of genetic material, one is not needed for either. one does all of the work in the replication process. C. one has cytosine in place of thymine on a base pair, the other has thymine. One is ribose sugar, the other is deoxyribose. D. One is single stranded, the other is double stranded. One has uracil in place of thymine.
81 Which of the following is correctly matched with its function? A. RRNA contains does to make new ribosomes B. dna CARRIES THE AMOINO ACIDS TO THE RIBSOMES C. Trna-COMBINES WITH PROTEINS TO MAKE UP RIBOSOMES D. Mrna-Carries genetic codes from nucleus to the ribosomes
82 Which of the following would be produced if a messenger RNA strand is coded from the DNA sequence CCCGGAATT? A. CCCGGAAUU B. GGGCCTTAA C. AAATTCCGG D. GGGCCUUAA
83 Briefly explain the difference between a chromosomal mutation and a gene mutation. Is there a difference?
Introduction. Everyone knew the winner would get a dynamite prize. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Introduction In the mid 1900 s, some classic experiments showed that it was the DNA in chromosomes that actually carried the information, and the race was on to figure out how DNA worked. Everyone knew
More informationHow do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
More informationMacromolecule Review
DNA: CH 13 Macromolecule Review Nucleic acid Monomer = nucleotide Polymer = DNA, RNA Function = genetic information Protein Monomer = amino acid Polymer = polypeptide Function = structure and chemical
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationUnit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
More informationTo truly understand genetics, biologists first had to discover the chemical nature of genes
To truly understand genetics, biologists first had to discover the chemical nature of genes Identifying the structure that carries genetic information makes it possible to understand how genes control
More informationDNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationBiology. DNA & the Language of Life
Biology DNA & the Language of Life Genes are Made of DNA Fredrick Griffith (1928) studied pneumonia strains (one was harmless while the other was pathogenic, or disease-causing) Made non-harmful strains
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationDNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
More informationRoute to DNA discovery
Unit 6 All living things use DNA to pass genetic information to the next generation. Genetic information directs the development and homeostasis of organism through a process of translating the genetic
More informationChapter 12 Reading Questions
Chapter 12 Reading Questions Name Section 11 In Frederick Griffith s experiment, what four substances were given to laboratory mice, and what was the result of each? 4. Which result was surprising, and
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationMarch 26, 2012 NUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS MAIN MAIN TOPICS TOPICS TO TO BE BE COVERED COVERED THIS THIS UNIT: UNIT: I. I. EVIDENCE EVIDENCE OF OF DNA DNA AS AS THE THE GENETIC GENETIC CODE CODE II. II. DNA DNA
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More information8.1. KEY CONCEPT DNA was identified as the genetic material through a series of experiments. 64 Reinforcement Unit 3 Resource Book
8.1 IDENTIFYING DNA AS THE GENETIC MATERIAL KEY CONCEPT DNA was identified as the genetic material through a series of experiments. A series of experiments helped scientists recognize that DNA is the genetic
More informationBiology Celebration of Learning (100 points possible)
Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein
More informationUnit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
More information12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall:
12 1 DNA 1 of 37 http://www.biologyjunction.com/powerpoints_dragonfly_book_prent.htm 12 1 DNA Griffith and Transformation Griffith and Transformation In 1928, Fredrick Griffith was trying to learn how
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationII. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationChapter 12 Notes DNA
Chapter 12 Notes DNA What makes up Genes? 3 teams of scientists answered this question. 1. Griffith Transformation 2. Avery DNA destroying protein 3. Hershey-Chase -- virus Griffith used bacteria 2 types
More informationThe Central Dogma: This explains how the information to make proteins is carried: DNA RNA proteins
7.1 DNA and RNA The Central Dogma: This explains how the information to make proteins is carried: DNA RNA proteins Discovering DNA It was not always known that DNA contains all of the genetic material.
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationDNA, RNA and protein synthesis
DNA, RNA and protein synthesis DNA is deoxyribonucleic acid DNA contains all the genetic instructions for making proteins within the cell. Each DNA molecule is made of repeating subunits called nucleotides.
More informationGriffith and Transformation (pages ) 1. What hypothesis did Griffith form from the results of his experiments?
Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the DNA molecule.
More informationResources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationwhat are proteins? what are the building blocks of proteins? what type of bond is in proteins? Molecular Biology Proteins - review Amino Acids
Molecular Biology The Study of Proteins and Nucleic Acids what are proteins? what are the building blocks of proteins? what type of bond is in proteins? Proteins - review functions include: catalysts for
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationHow can something so small cause problems so large?
How can something so small cause problems so large? Objectives Identify the structural components of DNA and relate to its function Create and ask questions about a model of DNA DNA is made of genes. Gene
More informationWrite: Unit 5 Review at the top.
Warm-up Take out a sheet of paper: Write: Unit 5 Review at the top. As each question goes on the board, write that question down and answer it. When answers come up, either write correct next to what you
More informationName Class Date. Information and Heredity, Cellular Basis of Life Q: What is the structure of DNA, and how does it function in genetic inheritance?
12 DNA Big idea Information and Heredity, Cellular Basis of Life Q: What is the structure of DNA, and how does it function in genetic inheritance? WHAT I KNOW WHAT I LEARNED 12.1 How did scientists determine
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationCh 12.DNA and RNA.Biology.Landis
Identity Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the
More informationDNA. Essential Question: How does the structure of the DNA molecule allow it to carry information?
DNA Essential Question: How does the structure of the DNA molecule allow it to carry information? Fun Website to Explore! http://learn.genetics.utah.edu/content/molecules/ DNA History Griffith Experimented
More informationHonors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationDNA Structure and Protein synthesis
DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making
More informationChapter 12 DNA & RNA
Chapter 12 DNA & RNA Experiments with Heredity Material Griffith s Experiments: injected mice with bacteria that cause pneumonia Concluded genetic info is transformed from one bacteria to another Avery
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More information3/10/16 DNA. Essential Question. Answer in your journal notebook/ What impact does DNA play in agriculture, science, and society as a whole?
DNA Essential Question. Answer in your journal notebook/ What impact does DNA play in agriculture, science, and society as a whole? 1 Benchmark SC.912.N.1.3, SC912.L16.9 Explain how & why the genetic code
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationUnit 6 Molecular Genetics
Unit 6 Molecular Genetics I. DNA and RNA structure pages 2-6 II. DNA replication pages 6-7 III. Protein Synthesis pages 7-10 South Dakota State Standard 9-12.L.1.1 Students are able to relate cellular
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More information3.a.1- DNA and RNA 10/19/2014. Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes.
3.a.1- DNA and RNA Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. EU 3.A: Heritable information provides for continuity of life. EU 3.B: Expression
More informationDNA & Genetics. Chapter Introduction DNA 6/12/2012. How are traits passed from parents to offspring?
Section 5.3 DNA & Genetics Chapter Introduction How are traits passed from parents to offspring? Chromatin- DNA in the nucleus loose strands Chromosome- When DNA gets organized before cell division Gene-
More informationDNA & RNA. Chapter Twelve and Thirteen Biology One
DNA & RNA Chapter Twelve and Thirteen Biology One I. DNA Structure A. DNA monomers = nucleotides *1. sugar bonded to PO4 & one of four possible nitrogen bases 2. bases = Adenine, Guanine, Cytosine, Thymine
More informationAP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More informationCh Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationBiology 30 DNA Review: Importance of Meiosis nucleus chromosomes Genes DNA
Biology 30 DNA Review: Importance of Meiosis Every cell has a nucleus and every nucleus has chromosomes. The number of chromosomes depends on the species. o Examples: Chicken 78 Chimpanzee 48 Potato 48
More informationDNA Replication. Packet #17 Chapter #16
DNA Replication Packet #17 Chapter #16 1 HISTORICAL FACTS ABOUT DNA 2 Historical DNA Discoveries 1928 Frederick Griffith finds a substance in heat-killed bacteria that transforms living bacteria 1944 Oswald
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationBrief History. Many people contributed to our understanding of DNA
DNA (Ch. 16) Brief History Many people contributed to our understanding of DNA T.H. Morgan (1908) Frederick Griffith (1928) Avery, McCarty & MacLeod (1944) Erwin Chargaff (1947) Hershey & Chase (1952)
More informationDNA: The Primary Source of Heritable Information. Genetic information is transmitted from one generation to the next through DNA or RNA
DNA and Replication DNA: The Primary Source of Heritable Information Genetic information is transmitted from one generation to the next through DNA or RNA Chromosomes Non-eukaryotic (bacteria) organisms
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationDNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
More informationUnit #5 - Instructions for Life: DNA. Background Image
Unit #5 - Instructions for Life: DNA Introduction On the following slides, the blue sections are the most important. Underline words = vocabulary! All cells carry instructions for life DNA. In this unit,
More informationBIOLOGY REVISION SHEET FINAL EXAM TERM-III Session: CCS: 10.BIO.4 a, 5 a, 5 b.
BIOLOGY REVISION SHEET FINAL EXAM TERM-III Session: 2017-18 CCS: 10.BIO.4 a, 5 a, 5 b. Name: Grade: 10 CHAPTER.8: SECTION 8.1, SECTION 8.2, SECTION 8.3, SECTION 8.4 & SECTION 8.5. NOTE: THE STUDENTS SHOULD
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationDo you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering
DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural
More informationDNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
More informationDNA, RNA, and Protein. The Whole Story
DNA, RNA, and Protein The Whole Story They didn t always know DNA was the Genetic Material. But they did know that the genetic material needed to do four things. The Master Molecule Contains Information
More informationStudy Guide A. Answer Key
From DNA to Proteins Answer Key SECTION 1. IDENTIFYING DNA AS THE GENETIC MATERIAL 1. Mice lived 2. Mice died 3. Mice lived 4. Mice died 5. S 6. bacteria 7. DNA; DNA; DNA 8. protein 9. radioactive 10.
More informationDNA stands for deoxyribose nucleic acid. This chemical substance is present in the nucleus of all cells in all living organisms
DNA Structure Notes DNA stands for deoxyribose nucleic acid This chemical substance is present in the nucleus of all cells in all living organisms DNA determines the kind of cell which is formed, (muscle,
More informationFrederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria
Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More informationIntroduction. Why is your hair the color that it is??? Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Introduction Why is your hair the color that it is??? George Beadle and Edward Tatum made Neurospora crassa famous. You know it as?? Here s what they did Fig. 17.1 They came up with this saying: one gene
More informationLesson Overview. The Structure of DNA
Lesson Overview The Structure of DNA Related Videos Stated Clearly: http://youtu.be/zwibgnge4ay Bozeman Nucleic acids: http://youtu.be/nnasrkiu5fw Bozeman People who discovered DNA: http://youtu.be/qoervswkmgk
More informationVocabulary: DNA (Deoxyribonucleic Acid) RNA (Ribonucleic Acid) Gene Mutation
STUDENTS WILL: Identify the parts of a DNA molecule and its structure. Explain how DNA copies itself. Describe the structure and function of each kind of RNA. Vocabulary: DNA (Deoxyribonucleic Acid) RNA
More informationEssential Questions. DNA: The Genetic Material. Copyright McGraw-Hill Education
Essential Questions Which experiments led to the discovery of DNA as the genetic material? What is the basic structure of DNA? What is the basic structure of eukaryotic chromosomes? Vocabulary Review nucleic
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationIntroduction. Why is your hair the color that it is??? Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Introduction Why is your hair the color that it is??? George Beadle and Edward Tatum made Neurospora crassa famous. You know it as?? Here s what they did Fig. 17.1 They came up with this saying: one gene
More information11/17/14. Why would scientist want to make a mouse glow?
11/17/14 Why would scientist want to make a mouse glow? 11/20 Your test today has ten words please use this time wisely. Chapter 8 Vocabulary Review Bacteriophage Viruses that infect bacteria, makes the
More informationKEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected
Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming
More informationCH_12_molecular_genetics_DNA_RNA_protein.notebook. February 08, DNA : The Genetic Material
Oswald very Identified the molecule that transformed the R strain into the S strain DN : The Genetic Material * fter Mendel, scientists knew that some kind of genetic material was located on chromosomes.
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationChapter 6. Genes and DNA. Table of Contents. Section 1 What Does DNA Look Like? Section 2 How DNA Works
Genes and DNA Table of Contents Section 1 What Does DNA Look Like? Section 1 What Does DNA Look Like? Objectives List three important events that led to understanding the structure of DNA. Describe the
More informationDNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationChapter 9. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination
Chapter 9 Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination 1 Genetics Genome Chromosome Gene Protein Genotype Phenotype 2 Terms and concepts gene Fundamental unit of heredity
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationDNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More information1/6/2014. Welcome Back! Do now:
Welcome Back! Do now: 1/6/2014 -Discuss with your shoulder partners What was your favorite thing you did over winter break? -Take out your EOC Sample Questions any questions for me right now? Agenda: DNA
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More information