Introduction. Everyone knew the winner would get a dynamite prize. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Size: px

Start display at page:

Grant Gregory
6 years ago
Views:

1 Introduction In the mid 1900 s, some classic experiments showed that it was the DNA in chromosomes that actually carried the information, and the race was on to figure out how DNA worked. Everyone knew the winner would get a dynamite prize.

3 Griffith called this phenomenon transformation, but he never determined what the stuff was. Conclusion for each of the below based on what you see? Fig. 16.1????????????????????????

4 In 1944, Oswald Avery, Maclyn McCarty and Colin MacLeod announced that the transforming substance was DNA. Still, many biologists were skeptical. Why, do you figure?

5 In 1952, Alfred Hershey and Martha Chase at Cold Spring Harbor showed that DNA was the genetic material by using a neat looking virus. Fig. 16.2a

6 Watch here to see what they did. Elegant, eh?

7 Here it is in diagram form. Fig. 16.2b

8 This DNA, then, has two main functions: 1. To hold instructions and have them used to make proteins. 2. To copy itself (replicate) so that those instructions can be passed on to the next generation. Generation of what????

9 By 1947, it was known that DNA was a polymer of nucleotides; what s a nucleotide? The bases could be adenine (A), thymine (T), guanine (G), or cytosine (C). Then Erwin Chargaff discovered an interesting fact about the bases.

10 The number of adenines was approximately equal to the number of thymines (%T = %A). The number of guanines was approximately equal to the number of cytosines (%G = %C). Human DNA, for example, is 30.9% adenine, 29.4% thymine, 19.9% guanine and 19.8% cytosine. The relationship between the ratios is obvious, yes?

11 But who would win the dynamite prize?! By the beginnings of the 1950 s, the race was on. Among the scientists working on the problem were Linus Pauling in California, and Maurice Wilkins and Rosalind Franklin in London. Two young no-names joined the London group. Politics and circumstance then stepped in to alter the fate of science history. Here s how

12 Rosalind Franklin used X-ray crystallography to take this neat picture of DNA. James Watson and Francis Crick snuck into her lab and took a peek. Were they being bad boys??? Fig. 16.4

13 By building models based on info gained from others research, they put together the model they called the double helix. Watch here Let s sketch it. It is said to be double stranded. What does strand mean here?

14 Fig. 16.5

15 Note how the bases bond. What does complementary mean? Anti-parallel? Fig. 16.6

16 The sequence of the four bases can be varied in countless ways, meeting the requirement of carrying large amounts of information. Base pairing allowed for a way of another requirement, accurate replication, as we will see. In April 1953, Watson and Crick published a succinct, onepage paper in Nature reporting their double helix model of DNA. Do we have time to read it and figure out the structure from it? How about a neat paper model? See it here.

18 How can DNA copy itself, you ask??? In a second paper, Watson and Crick published their hypothesis for how DNA replicates. What does the word template mean??

19 Here s the basic idea. Fig. 16.7

20 Enzymes separate the strands, forming a replication bubble. Replication proceeds in both directions until the entire molecule is copied. Let s watch some video and consider some of the enzymes involved. First, an oldie but goodie

21 In eukaryotes, there may be hundreds or thousands of replication bubbles per chromosome. Here s a sketch and about the best picture we can make. Fig

22 Helicase catalyzes the unzipping. DNA polymerases catalyze the elongation of new DNA at a replication fork. What difference does that anti-parallel thing make? Now watch herehttp://highered.mcgrawhill.com/sites/ /student_view0/chapter14/a nimations.html and select DNA Replication Fork

23 Introduction Let s review these fundamental concepts so when the details continue we don t lose sight of the forest for the trees. What actually causes your traits??? And this stuff is made where?? And DNA is where??? Problem????

24 RNA to the rescue!!! The bridge between DNA and protein synthesis is RNA. RNA is chemically similar to DNA, except that???

25 During transcription, a DNA strand provides a template, for the synthesis of an RNA strand. Are they identical? What would you call them? What is a messenger RNA (mrna) molecule? During translation, the mrna is used to make a specific sequence of amino acids. Translation occurs at ribosomes. Keep these trans words straight!!!

26 What is a dogma?? What kind of dogma do we have here? Is it really dogma???

27 SC.912.L.16.5: Explain the basic processes of transcription and translation and how they result in expression of genes.

28 1. Transcription is the DNA-directed synthesis of RNA: a closer look RNA polymerase (not helicase this time) unzips the DNA and bonds the RNA nucleotides as they basepair along the DNA template. Let s watch an animation from the Hbio DVD. Now maybe watch this

29 Transcription How does this look different than replication? How does it look the same? Fig. 17.6a

30 Fig. 17.6b

31 3. In the genetic code, nucleotide triplets specify amino acids In the days of the cold war, codes were a hot topic. How many amino acids can be coded for by two base code words? What about a triplet code? So does it have to be a triplet code? Lucky for us.

32 Digest this for a minute Fig. 17.3

33 So what exactly is a CODON??? It would take at least 300 nucleotides to code for a polypeptide that is 100 amino acids long.

34 Time for another race for another dynamite prize in the early 1960s. And the winner was How did he do it??? RIP 1/21/2010.

35 By the mid-1960s the entire code was deciphered. 61 of 64 triplets code for amino acids. Start codon??? Stop codons???? Differences??? Fig. 17.4

36 Determine the sequence of amino acids coded for by the following mrna strand CAGCCCAAGGGCCCGACAUUUGUG Now go back and give the base sequence of the DNA that coded for it. And the other side of that DNA?

37 The genetic code is redundant but not ambiguous. Say what??? Notice that codons that code for the same amino acid often differ only how???

38 4. The genetic code must have evolved very early in the history of life Neat picture!! What does it tell us? Fig. 17.5

39 A shared genetic vocabulary is one of the biggest reasons we feel strongly that all life forms are related, all evolving from a single common ancestor. This concept often shows up on a test.

40 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look Let s look at RNA that has a different job Fig

41 It includes a loop containing the anticodon and an attachment site at the 3 end for an amino acid. Fig

42 TRICK QUESTION!!! Which amino acid is attached to the trna with the following anti-codon? CCU AGA ACC CCC

43 And how about those ribosomes?? What are they made of?? Fig a

44 Review time!! Where, exactly, is that rrna made? Then what happens to make a subunit? Then what happens to make a complete ribosome??

45 Translation can be divided into three stages: initiation elongation termination These are very similar in principal to what happened in transcription: start building a long polymer, continue making it longer, finish. Let s watch some oldie-goldie animations.

46 Here s initiation This is the only time that can bind to without the help of. Fig

47 Elongation is very repetitive. Let s watch the oldie goldie on the Hbio DVD first. mations.html So what does that ribosome do? (song)

48 Termination occurs when one of the three stop codons reaches the A site. What s that attached to the stop codon??? And then what happens???? Fig

49 Diagram the translation of the protein coded for by the following mrna: CCGAAUGCCAGACUUCUGACCGA HOMEWORK: diagram the transcription of the bottom side of the following DNA; then diagram the translation of the resulting mrna: CCATGGCCAAACAGGCCTGACCG GGTACCGGTTTGTCCGGACTGGC

51 5. Point mutations can affect protein structure and function What is a MUTATION??? What is a gene mutation?? Point mutation?? Chromosome mutation?? Germ?? Somatic?? How many mutations do you think the person sitting next to you has????

52 Classic example of a point mutation!!! Sickle-cell disease. Fig

53 This type of point mutation is called a base-pair substitution. Will it always cause a problem? What does it sound like an insertion or deletion is? What changes in a protein would they cause?

54 Fig

55 What is a gene? revisiting the question The Mendelian concept of a gene views it as a discrete unit of inheritance that affects phenotype. Morgan and his colleagues assigned genes to specific loci on chromosomes. We can also view a gene as a specific nucleotide sequence along a region of a DNA molecule. We can define a gene functionally as a DNA sequence that codes for a specific polypeptide chain, or an RNA polymer.

66 SC.912.L.16.3/16.4/16.5 Describe the basic process of DNA replication & how it relates to the transmission & conservation of the genetic information; EXPLAIN HOW MUTATIONS IN THE DNA SEQUENCE MAY OR MAY NOT RESULT IN PHENOTYPIC CHANGE. Explain the basic processes of transcription & translation & how they result in the expression of genes

67 The genetic code is universal and common to almost all organisms. Of the following choices, which BEST preserves the genetic code from one generation to the next? A. protein synthesis B. enzyme activation C. RNA translation D. DNA Replication

68 As a result of base pairing in DNA, there is the same number of which two bases? A. Guanine and thymine B. Adenine and guanine C. Guanine and cytosine D. Adenine and cytosine

69 What IS DNA polymerase and what role does it play in DNA replication? A. It s a Lipid that separates the double Helix structure. B. It s a neurotransmitter present on chromosome tips needed for the process of replication. C. It s an enzyme that joins individual nucleotides. D. It s a codon base that is necessary only in prokaryotic dna replication in order to complete the process.

70 1 of the factors allowing DNA to fit inside the nucleus of a cell is its ability to: A. break apart into separate genes B. denature from the effect of an enzyme C. coil tightly around associated proteins D. extend to form very long, thin molecules

71 DNA is a polymer which is made of subunits of nucleotides. Which of these is not a nucleotide component? A. ribose sugar B. phosphate group C. deoxyribose sugar D. nitrogenous base

72 The diagram below shows models of nucleic acids. A segment of each model is highlighted. Which two segments in the models ONLY contain DNA? B. 2 & 4 C. 3 & 4 D. 1 & 3

73 A scientist is studying the results of a DNA gel electrophoresis from 4 different species. What kind of information can the scientist determine from this test? A. how closely related the species are B. which species are carnivores C. how the different species live D. what is the common ancestor for the species

74 Observe the karyotype below. Who would it belong to?

75 Scientists use a particular technique to measure the RNA levels in various cell types. Which of the following which BEST explains what is most directly observed by this technique? A. mutation B. protein synthesis C. gene expression D. pedigree within a family tree

76 The chart shown matches messenger RNA codons with amino acids. DNA strand has the codon TCA. According to the chart, the corresponding messenger RNA codes for which of the following amino acids? A. glycine B. leucine C. alanine D. serine

77 Translation is crucial to the process of protein synthesis. Which statement best describes what takes place during translation? A. An RNA copy of a DNA strand is made. B. A copy of chromosomal DNA is made. C. Information m RNA is converted into a sequence of amino acids in a protein. D. Instructions from DNA in the nucleus are brought to the cytoplasm.

78 What matches a nucleic acid codon with the proper amino acid during the process of translation?

79 Review the diagram, below. What process is Shown?

80 Of the following, which are the important differences between RNA and DNA? A. One is made of nucleotides, the other is not. one has messenger RNA, the other does not. B. One is necessary for the transmission & conservation of genetic material, one is not needed for either. one does all of the work in the replication process. C. one has cytosine in place of thymine on a base pair, the other has thymine. One is ribose sugar, the other is deoxyribose. D. One is single stranded, the other is double stranded. One has uracil in place of thymine.

81 Which of the following is correctly matched with its function? A. RRNA contains does to make new ribosomes B. dna CARRIES THE AMOINO ACIDS TO THE RIBSOMES C. Trna-COMBINES WITH PROTEINS TO MAKE UP RIBOSOMES D. Mrna-Carries genetic codes from nucleus to the ribosomes

82 Which of the following would be produced if a messenger RNA strand is coded from the DNA sequence CCCGGAATT? A. CCCGGAAUU B. GGGCCTTAA C. AAATTCCGG D. GGGCCUUAA

83 Briefly explain the difference between a chromosomal mutation and a gene mutation. Is there a difference?

Introduction. Everyone knew the winner would get a dynamite prize. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Introduction. Everyone knew the winner would get a dynamite prize. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings Introduction In the mid 1900 s, some classic experiments showed that it was the DNA in chromosomes that actually carried the information, and the race was on to figure out how DNA worked. Everyone knew