Chapter 3. Enzyme manipulation of DNA and RNA
|
|
- Zoe Shields
- 6 years ago
- Views:
Transcription
1 Chapter 3 Enzyme manipulation of DNA and RNA
2 To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA and cold acid (HCl) solution, - Collect the precipitate on a glass microfiber filter (Whatman GF/A), - Measure radioactivity
3 To separate radio-labelled probe from dntps Spin column method (Fig ), Resin (Sephadex G-50, Bio-Gel P-60) Silanized glass wool Dye (phenol red)
4
5 Labeling RNA by run-off in vitro transcription (unit 2.13) - Linealized DNA by restriction digestion immediately downstream of the fragment to be labeled - Mix: DNA, SP6 (T7, T3 etc) RNA polymerse, A, C, G, and [α-32p]u, RNase inhibitor, and incubate RNase free DNase I incubation - Stop reaction by EDTA, can be stored at C for 2 days before use. (During hybridization, use low-stringency wash firstly, Then, RNase A and RNase T1 to remove unhybridized probe, Finally moderate- and high-stringency washes.)
6 Labeling DNA by nick translation - Mix: DNA fragment da, dc, dg, α-32p]du, DNase I, E. coli DNA polymerase I, and incubate - Stop reaction by EDTA (and trna) - Phenol extraction - Spin column
7 Labeling DNA by random priming -Mix DNA fragment and random hexanucleotides, boil and ice - Add da, dc, dg, [α-32p]du, Klenow fragment, and incubate - Stop reaction by EDTA (and trna) - Phenol extraction - Spin column
8 Labeling 3 -end of dsdna with 5 overhang (fill in) Repair 3 or 5 overhangs to become blunt ends all by Klenow fragment
9
10 Restriction digestion Complete digestion Partial digestion: by reduction enzyme concentration or digestion time, or combination. (DNA treated with DNA methylase will resistant to digestion of the corresponding RE.)
11 Synthesis of homopolymer tails (tailing) or biotin-11-dutp labeling by Terminal (deoxynucleotidyl) transferase - template independent - tailing or biotin-labeling to 3 -end of dsdna or ssdna - best with ssdna and dsdna with 3 - overgangs)
12 Removing of 5 -protruding ends of dsdna (for further tailing by terminal transferase) by Lambda exonuclease (λexo)
13 Synthesis of cdna by Reverse transcriptase (using either oligo (dt) primers, or random primers) - RT can degrade the RNA in an RNA::DNA hybrid or RNA can be destroyed by NaOH
14 Dephosphorylation of 5 -end of DNA, RNA, dntps, and NTPs by CIP (calf intestine phosphatase) or BAP (bacterial alkaline phosphatase) - to avoid self-ligation of vector DNA
15 Phosphorylation of oligonucleotides, ssdna, or dsdna with 5 -OH ends by T4 polynucleotide kinase (transfer γ phosphate of ATP to 5 -OH of DNA, RNA) - for ligation of linkers best with 5 protruding ends, blunt ends are OK. - for RE mapping, ds DNA first dephosphorylated by CIP, then labeled by T4 polynucleotide kinase using [γ-32p]atp, then partial digestion of the labeled DNA.
16 Exonuclease Exo VII: work on 3 and 5 end of ssdna, processive λexo: work on 5 overhangs of dsdna, processive, work on 5-P T4 gene 6 exonuclease: work on 5 overhangs of dsdna, non- processive, work on 5-P and 5-OH Exo VIII: work on 3 -OH of dsdna, non-processive
17 Endonclease Bal 31: degrade ssdna, rrna, trna, ss region of ccc, 5 end and 3 end of linear dsdna (controlled shortening of dsdna) S1, mung bean nuclease: degrade ss DNA, ss region of ccc Micrococcal nuclease: degrade DNA and RNA DNase I (RNase-free DNase I): degrade ds DNA, nicks dsdna in the presence of Mg +2 ; generates ds breaks in the presence of Mn +2
18 Ribonuclease RNase A (DNase-free RNase A): degrade RNA after C and U (inhibited by RNase inhibitor: eg., RNasin from Promega) RNase H: degrade RNA in RNA:DNA duplex. RNase T1: degrade RNA after G
19 Ligase T4 DNA ligase: ligation between 5 -P and 3 -OH in duplex DNA T4 RNA ligase: ligation of 5 -P ssdna or RNA to 3 -OH of ssdna or RNA.
20
21
22
23
24 Sub-cloning - RE, CIP. Klenow, linker, T4 DNA ligase - can be done in low-gelling gel slices
25
26
27 Construction of recombinant DNA molecules by PCR Fig Fig Fig
28
29
30
31 Detection by non-isotopic probes Non-isotopic probes: labeled with biotin or digoxigenin, stable for 2 years.
32 I. Biotin-labeled probe and detection Biotin binds to streptavidin (4 x 13 kd) tightly.
33 Biotin probes Nick translation reaction Biotin-11-dUTP is substituted for dttp no phenol extraction (biotinylated probe will go to interphase or phenol layer) Random priming Biotinylated random octamers (NEB, Millipore) Biotin-11-dUTP is substituted for dttp
34 For QC of biotinylated probes, colorimetric method ( color α biotin/ kb) Dot blot biotinylated standard DNA (Life Technologies) test probe Uncharged nylon membrane Hybridization Streptavidin-alkaline phosphatase (AP) conjugate Nitriblue tetrazolium (NBT) 5-bromo-4 chloro-3-indoyl phosphate (BCIP)
35
36 Detection by biotinylated probes Chemiluminescent method (can detect 1 copy of gene in 1μg human genomic DNA) Uncharged nylon membrane blot with DNA or RNA Biotinylated probe Strepavidin Biotinylataed AP Chemiluminescent substrates (eg. Western lightning chemiluminescence Rreagent plus, PekinElmer Life Science)
37
38 II. Digoxigenin -labeled probe and detection (Genius kit, BM) Digoxigenin Labeling nick translation or random priming, replacing dttp by digoxigenin-11-dutp/dttp QC by digoxigenin-labelled stand DNA (part of kit) Detection color or chemiluminescent method using AP conjugated anti-digoxigenin antibody.
Computational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationDNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010.
Technical Bulletin DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. PRINTED IN USA. Revised 12/12 DNA 5 End-Labeling System All technical literature is available on the Internet at: www.promega.com/protocols/
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationGene Cloning & DNA Analysis
CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis
More informationTable of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationDuraScribe T7 Transcription Kit
DuraScribe T7 Transcription Kit Cat. Nos. DS010910 and DS010925 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA170E DuraScribe T7 Transcription Kit 7/2017 1 1. Introduction The
More informationBasic Protocol (v. 2.0, May, 2003)
Basic Protocol (v. 2.0, May, 2003) Preparation of RNA:DNA Handles For the two handles (called A and B), you will need the following oligos: Product 1 : Name=B_reverse : Synthesis=1 umole : Purification=HPLC
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationInstruction Manual cdna Synthesis System
Instruction Manual cdna Synthesis System CAT. NO. 18267-013 Table of Contents 1. Notices to Customer........................................1 1.1 Important Information.............................................1
More informationBacterial DNA replication
Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems
More informationAMV First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationBiotin 3' End DNA Labeling Kit
INSTRUCTIONS Biotin 3' End DNA Labeling Kit 3747 N. Meridian Road P.O. Box 117 Rockford, IL 61105 89818 1290.4 Number Description 89818 Biotin 3' End DNA Labeling Kit, sufficient reagents to perform 20
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationFirst Strand cdna Synthesis Kit (#K1611 for 10 reactions)
3 First Strand cdna Synthesis Kit (#K1611 for 10 reactions) Kit is designed for preparation of full-length fi rst strand cdna from RNA templates. The fi rst strand cdna synthesis kit relies on a cloned
More informationReverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months
www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT
More information778/779 DIG Hyb ManualCover_1AK :32 Uhr Seite 3 C M Y CM MY CY CMY K Probedruck
778/779 DIG Hyb ManualCover_1AK 0.07.2008 14:2 Uhr Seite C Probedruck M Y CM MY CY CMY K Intended use Our preparations are exclusively intended to be used in life science research applications.* They must
More informationSensitivity vs Specificity
Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome
More informationII First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationConversion of plasmids into Gateway compatible cloning
Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from
More informationPrimeScript RT reagent Kit (Perfect Real Time)
Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More informationLecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
More informationPrimeScript 1st strand cdna Synthesis Kit
Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...
More information#FD µl (for 200 rxns) Expiry Date: Description. 1 ml of 10X FastDigest Green Buffer. Store at -20 C
PRODUCT INFORMATION Thermo Scientific FastDigest SalI #FD0644 Lot: 5'...G T C G A C...3' 3'...C A G C T G...5' Supplied with: Store at -20 C 200 µl (for 200 rxns) Expiry Date: BSA included www.thermoscientific.com/onebio
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationApplications for Eppendorf Thermomixer comfort* 1, Thermomixer compact* 2 and ThermoStat plus TM. Purification of DNA, RNA and proteins
Userguide Eppendorf Thermomixer, ThermoStat plus No 001 November 2010 Applications for Eppendorf Thermomixer comfort* 1, Thermomixer compact* 2 and ThermoStat plus TM Cells/ Tissue Analysis of tissue sections
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More informationProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.
DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationAmino-allyl Dye Coupling Protocol
Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationUSB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
More informationRP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O
www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100
More informationsmall RNA Cloning Kit
Cat. # RR065 For Research Use small RNA Cloning Kit Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage... 6 V. Precautions
More informationT4 DNA ligase. Manual for catalog numbers C0005 and C0006. Upon Receipt Store Kits at -20ºC. anvaxbiotech.com
T4 DNA ligase Manual for catalog numbers C0005 and C0006 Upon Receipt Store Kits at -20ºC www.c anvaxbiotech.com PRODUCT MANUAL Version 2.0 Last updated: February 2010 Table of contents Table of contents...
More informationRNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation
RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationScore winning cdna yields with SuperScript III RT
Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How
More informationSouthern Blotting MSU Potato Lab
Southern Blotting MSU Potato Lab A. DNA AGAROSE GEL 1. Prepare a 1% agarose gel and load 5 μl of BMB Molecular Weight Marker DIG labeled in one lane. 2. Mix 20μg Plant Genome DNA (which has been digested
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationAmira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Restriction Endonucleases, (cutting dna) (ligation)
More informationCat. # R006A. For Research Use. TaKaRa Z-Taq DNA Polymerase. Product Manual. v201411da
Cat. # R006A For Research Use TaKaRa Z-Taq DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Specifications... 3 IV. Optimization of Reaction Conditions... 4
More informationCopy Kit. Version G Copy Kit. cdna Synthesis System. Catalog no. L
Copy Kit Version G 022002 25-0013 Copy Kit cdna Synthesis System Catalog no. L1311-03 www.invitrogen.com tech_service@invitrogen.com ii Table of Contents Table of Contents...iii Kit Contents and Storage...
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More information3'-Full RACE Core Set
Table of Contents Description... 2 Principle... 4 Preparation of RNA Sample... 5 Note... 5 Protocol 1. General Protocol... 6 2. Application example... 8 Also available from Takara PCR related products
More informationBCMB Chapters 34 & 35 DNA Replication and Repair
BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationNEBNext Ultra Ligation Module
LIBRARY PREPARATION NEBNext Ultra Ligation Module Instruction Manual NEB #E7445S/L 24/96 reactions This product is intended for research purposes only. This product is not intended to be used for therapeutic
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationStrep-tag detection in Western blots
Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important
More informationBIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205
BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit
More informationGuidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature
Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationCut Smarter with NEB Restriction Enzymes
ut Smarter with EB Restriction Enzymes A Smarter Look Keep track of your enzyme data with our new, streamlined protocol cards. These collectible cards contain all the information you need for setting up
More informationLecture 14 - PCR Applications and Lab Practicum (AMG text pp ) October 9, 2001
Lecture 14 - PCR Applications and Lab Practicum (AMG text pp. 159-169) October 9, 2001 Diagnostic Applications of PCR There are three primary diagnostic applications of PCR: - detecting pathogens using
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationDephosphorylated DNA. 5 HO OH 3 + [γ- P]ATP 3 HO OH 5. FIGURE 1. T4 Polynucleotide Kinase Forward Reaction. OH 3 + ADP + [γ- P 5
FOCUS Introduction ON APPLICATIONS T4 Polynucleotide Kinase Technical Bulletin 18004-2 T4 polynucleotide kinase contains a 5 kinase activity and a 3 phosphatase activity (1-3). It catalyzes the addition
More informationTechnical tips Session 5
Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationKAPA Library Preparation Kits
Technical Data Sheet KAPA Library Preparation Kits Illumina series Product Description The KAPA Library Preparation Kit provides all of the enzymes and reaction buffers required for constructing libraries
More informationWhy adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase
Why adapter ligation? Ligases Introduction to s in general, and RA 1 / RA 2, truncated in particular mira bacterial mra -P unknown sequence 3 -H -PPP unknown sequence 3 -H 3 adapter LIGASE catalyzed known
More informationFisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).
175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further
More informationTranscription & post transcriptional modification
Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity
More informationCat. # For Research Use. BcaBEST Labeling Kit. Product Manual. v201701da
Cat. # 6046 For Research Use BcaBEST Labeling Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Principles... 4 V. Protocol... 5 VI. Effect of Template
More informationProtoscript II RT-PCR Kit. I n s t r u c t i o n M a n u a l NEW ENGLAND. BioLabs. Version 1.2 3/07. Catalog #E6400S Store at 20 C. Inc.
Protoscript II RT-PCR Kit I n s t r u c t i o n M a n u a l Catalog #E6400S Store at 20 C NEW ENGLAND BioLabs Inc. Version 1.2 3/07 Table of Contents: Supplied Components.................................................................................
More informationTECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70
GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More information1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION
1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...
More informationCELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)
Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for
More informationNEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1)
LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Sign up for the NEBNext e-newsletter Scan this code or visit www.neb.com/
More informationTrueORF TM cdna Clones and PrecisionShuttle TM Vector System
TrueORF TM cdna Clones and PrecisionShuttle TM Vector System Application Guide Table of Contents Package Contents and Storage Conditions... 2 Related, Optional Reagents... 2 Related Products... 2 Available
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationDNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
More informationRNA LA PCR Kit (AMV) Ver.1.1
Table of Contents I. Description... 2 II. Kit Components... 2 III. Reagents not supplied in the kit... 3 IV. Equipment required... 3 V. Storage... 3 VI. References... 3 VII. Principle... 4 VIII. Features...
More informationRNA Clean-Up and Concentration Kit Product # 23600, 43200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com RNA Clean-Up and Concentration Kit Product # 23600, 43200 Product
More informationDNA Replication II Biochemistry 302. January 25, 2006
DNA Replication II Biochemistry 302 January 25, 2006 Following in Dad s footsteps Original A. Kornberg E. coli DNA Pol I is a lousy replicative enzyme. 400 molecules/cell but ~2 replication forks/cell
More informationSite-directed Mutagenesis
Site-directed Mutagenesis Applications Subtilisin (Met à Ala mutation resistant to oxidation) Fluorescent proteins Protein structure-function Substrate trapping mutants Identify regulatory regions/sequences
More informationLibrary Preparation for Illumina Sequencing
Materials Library Preparation for Illumina Sequencing Cleanup Kits: Ampure Store in +4 o C: Fermentas 1kb Ladder, Low Mass Ladder Phusion DNA polymerase, NEB Cat# F-531 (-20 o C for long term storage)
More informationin-situ PCR Presented for: Presented by: Date:
in-situ PCR Presented for: Presented by: Date: 2 in situ Hybridization - Definition in situ PCR is a method in which the polymerase chain reaction actually takes place in the cell on a slide, and the product
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More informationMicroarray Protocols Version 1 December 21, 2007
Microarray Protocols Version 1 December 21, 2007 Table of Contents: Genomic DNA Labelling 2 Post-Processing of Oligo Arrays on Epoxy and Amine Coated Slides 4 RNA Extraction 5 cdna Labelling 8 RNA Isolation
More informationPRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda
More informationTable of contents. I. Description...2. Kit Components...2. Reagents not supplied in the kit...3. Equipment required...3. V. Storage...3. Reference...
Table of contents I. Description...2 II. III. IV. Kit Components...2 Reagents not supplied in the kit...3 Equipment required...3 V. Storage...3 VI. Reference...3 VII. Principles...4 VIII. Features...5
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationCELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)
Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression
More information