rheb, Gene Responsible for UV Susceptibility of Human Cells
|
|
- Winfred Cain
- 6 years ago
- Views:
Transcription
1 heb, Gene Responsible fo UV Susceptibility of Human Cells K. Kita 1, K. Kikuno 2, Y. P. Wu 1,.J. Hiano 3, H. Yamamoi 3, and N. Suzuki 1 Depatment of 1 Biochemisty, 2 Laboatoy Medicine, 3 Sugey, Chiba Univesity School of Medicine, Inohana 1-8-1, Chuo-ku, Chiba city, Chiba 260, Japan INTRODUCTION Iadiation of human cells with fa-ultaviolet light (UV, pincipally 254-nm wavelength) induces vaious cellula events such as DNA damage, cell death and mutation (1, 2), via induced expession of seveal genes (3, 4). Some of the genes may play oles in the pleiotopic events of UV (1, 4). Cell lines with discepancy of UV susceptibility seem to be valuable fo identification of such UV-induced genes (5). We theefoe attempted to seach fo genes involved in the susceptibility of cells to UV effects, compaing alteation of gene expession levels afte UV iadiation between UV-sensitive RSa cell line and UV-esistant cell line, UV -1 cells. UV -1 cells wee deived fom RSa cells and showed inceased esistance to UV-induced cellkilling. Levels of thei expessed genes wee analyzed by a PCR-based mrna diffeential display method, following confimation by Nothen blot analysis. We hee epot one gene esponsible fo the UV susceptibility of human cells. MATERIALS AND METHODS Cells and cultue conditions. RSa and UV -1 wee descibed peviously (6, 7). Cells wee seeded in 100-mm dish, gown until subconfluent, and then iadiated with 10 J/m 2 UV (8) o mock-iadiated. Fou h afte UV iadiation, total cellula RNA was isolated fom the cells as peviously descibed (8). PCR-based mrna diffeential display and Nothen analysis. Diffeential display was pefomed as descibed (8, 9), by using RNAmap kit (GenHunte, Bookly, MA, USA). cdnas cloned afte the diffeential display method wee used as templates fo sequencing as descibed (8). Alteation of the mrna expession levels fo the cloned cdnas was confimed by Nothen blot analysis. Antisense study. Fo antisense study, we used highly puified phosphothioate antisense oligonucleotides which was diected against the amino-teminal egion specific fo human Ras homolog eniched in bain (Rheb) mrna (antisense-oligo) o consisting of andomized sequence showing the same nucleotide composition (andomoligo) (Geine Japan, Tokyo, Japan). Cells wee cultued with EMEM containing 10% calf seum and the oligonucleotides fo 5 days afte seeding. Duing the cultue peiod, the medium was efeshed evey 2 days. The cells wee utilized fo examination of suvival activity afte UV iadiation by colony fomation assay (8, 10). RESULTS RT-PCR was pefomed using 20 diffeent combinations of andom pimes. Thiteen cdna bands, which had moe than two-fold o less than a half intensity of that of mock-iadiated cells, wee selected (data not shown). One up-egulated clone among the cdnas was highly homologous to Ras-elated GTP-binding potein, human Ras homolog eniched in at bain (Rheb) (11, 12). The mrna expession of Rheb was futhe examined by Nothen blot analysis. In UV-iadiated RSa and UV -1cells, the expession levels of Rheb mrna wee found to be inceased o deceased to only a little extent, when compaed with those in mockiadiated cells (Table 1). Table 1. UV induction of Rheb mrna expession levels Cells RSa UV -1 UV induction a) a) The Rheb mrna expession levels 4h afte UV iadiation wee analyzed by Nothen blotting and divided by GAPDH mrna levels. The levels wee shown as the expession elative to those afte mock iadiation. 1
2 Howeve, Rheb mrna expession levels wee found to be moe abundant in UV -1 than in RSa cells in conditions without iadiation (Table 2). When functional analysis using antisense oligonucleotides fo Rheb was Table 2. Expession levels of Rheb mrna in logaithmically gowing cells Cells RSa UV -1 Relative levels a) a) The Rheb mrna expession levels wee divided by GAPDH mrna levels. The expession levels of RSa cells was designated as 1.0, and the expession levels of UV -1 cells ae shown as elative levels to those of RSa cells. pefomed, antisense-oligo-teated UV -1 cells showed moe inceased esistance to UV cell-killing than did unteated cells (Figue 1). Random-oligo did not change UV suvival of both the cells (data not shown). 100 antisense-oligoteated-uv -1 UV UV (J/m 2 ) Figue 1. Faction of colony fomes plotted against vaious doses of UV. Antisense oligonucleotides teatment and colony fomation assay wee pefomed as descibed in "MATERIALS AND METHODS". Bas indicate the standad deviations. 15 2
3 DISCUSSION The pecise molecula mechanisms undeling UV sensitivity of RSa and UV -1 cells emain unclaified. In the pesent study, we seached fo genes, expession levels of which alteed afte UV iadiation, using mrna diffeential display and Nothen analysis. Expession levels of human Rheb mrna wee inceased in UVesistant UV -1 cells to a geat extent. Futhemoe, ou esults, showing that UV -1 cells teated with antisense oligonucleotides fo Rheb mrna became moe esistant to UV cell-killing than unteated cells, suggest that Rheb is involved in susceptibility of UV -1 cells to UV cell-killing. To ou knowledge this is the fist epot that Rheb is involved in the susceptibility of human cells to UV cell-killing. Rheb was a ecently identified as a membe of the Ras supefamily (11, 12, 13). UV esponse in mammalian cells is mediated by a signal pathway involving Ras (2, 14). Rheb may be involved in cell polifeation inhibition and/o cell-killing afte UV iadiation, and may play potective oles against UV damage in UV -1 cells. By contast, Rheb might not adequately function in RSa cells. ACKNOWLEDGMRNTS This wok was suppoted in pat by a gant-in-aid fom the Smoking Reseach Foundation, Mishima Kaiun Memoial Foundation fo eseach found, Gound Reseach fo Space Utilization pomoted by NASDA and Japan Space Foum, the Sumitomo Foundation, the Japan Atomic Enegy Reseach Institute, by the contact on the Nuclea Safety Reseach Association, and gant-in aid fom the Ministy of Education, Science and Cultue, Japan. REFERENCES 1. P. Helich, H. Ponta and H.J. Rahmsdof, Rev. Physiol. Biochem. Phamacol. 119, (1992). 2. R.M. Tyell, BioEssays 18, (1996). 3. S.M. Keyse, Sem. Cance Biol. 4, (1993). 4. A.J. Fonace, Annu. Rev. Genet. 26, (1992). 5. C.A. Bill and P.J. Tofilon, Int. J. Radiat. Biol. 65, (1994). 6. N. Suzuki and A. Fuse, Mutation Res. 84, (1981). 7. N. Suzuki, Mutation Res. 125, (1984). 8. Y. Higuchi, K. Kita, H. Nakanishi, X-L. Wang, S. Sugaya, H. Tanzawa, H. Yamamoi, K. Sugita. A. Yamaua and N. Suzuki, Biochem. Biophys. Res. Commun. 248, (1998). 9. P. Liang and A.B. Padee, Science 257, (1992). 10. K. Kikuno, K. Kita, J. Nomua, T. Hiwasa, H. Yonemitsu and N. Suzuki, Biochem. Biophys. Res. Commun. 253, (1998). 11. P.S. Gomov, P. Madsen, N. Tomeup and J.E. Celis, FEBS Lettes 377, (1995). 12. N. Mizuki, M. Kimua, S. Ohno, S. Miyata, M. Sato, H. Ando, M. Ishihaa, K. Goto, S. Watanabe, M. Yamazaki, A. Ono, S. Taguchi, K. Okamua, M. Nogami, H. Taguchi, A. Ando and H. Inoko, Genomics 34, (1996). 13. K.Yamagata, L.K. Sandes, W.E. Kaufmann, W. Yee, C.A. Banes, D. Nathans and P.F. Woley, J. Biol. Chem. 269, (1994). 14. D. Engelbeg, C. Klein, H. Matinetto, K. Stuhl and M. Kain, Cell 77, (1994). It was epoted that Rheb was synegistic with Raf-1 in tansfoming gowth popeties of NIH 3T3 fiboblasts and also induced neuite outgowth potentiated by NGF and camp in PC12 cell (14). We peviously epoted that inceased expession levels of nucleophosmin (6) and syndecan-1 (7) genes esult in the esistance of cells to UV cell-killing. 3
4 Howeve, Rheb was also suggested to antagonize Ras function by foming inactive complexes with Raf-1 in NIH 3T3 cells (15). 5. (14) C. F. Rosen, R. Poon, D. J. Ducke, Am. J. Physiol. 268, C846-C855. (15) H. F. Abts, K. Beuhahn, G. Michel, K. Kohe, P. Esse, T. Ruzicka, Photochem. Photobiol. 66 (1997) (16) T. M. M. Vogt, J. Welsh, W. Stolz, F. Kullmann, B. Jung, M. Landthale, M. McClelland, Cance Res. 57 (1997) (18) N. Suzuki, T. Kuwata, Mutation Res. 60 (1979) (19) P. Chomczynski, N. Sacchi, Anal. Biochem. 162 (1987) (20) T. Ishizuka, K. Kita, T. Sonoda, S. Ishijima, K. Sawa, N. Suzuki, M. Tatibana, Biochim. Biophys. Acta 1306 (1996) (21) M. Enst, U. Novak, S. E. Nicholson, J. E. Layton, A. R. Dunn, J. Biol. Chem.274 (1999) (22) N. Suzuki, J. Nishimaka, T. Kuwata, Mutation Res. 106 (1982) (25) E. C. Fiedbeg, DNA Repai (1985) pp , W. H. Feeman and Company, New Yok. (26) G. C. Walke, Cellula and Molecula Biology (ed. F. C. Niedhad, J. L. Ingaham, K. B. Low, B. Magasanik, M. Shaechte and H. U. Umbage) (1987) pp , Ameican Society of Micobiology, Washington DC. (27) P. Angel, H. J. Rahmsdof, A. Poting, P. Helich, Cance Cells 3 (1985) (28) M. Gamyn, M. Yaa, N. Holbook, B. A. Gilchest, J. Lab. Invest. 65 (1991) (29) C. Campbell, A. G. Quinn, B. Angus, P. M. Fa, J. L. Rees, Cance Res. 53 (1993) (30) B. Stein, H. J. Rahmsdof, A. Steffen, M. Litfin, P.Helich, Mol. Cell. Biol. 9 (1989) (31) G. Hemann, M. Wlaschek, T. S. Lange, K. Penzel, G. Goez, K. Schaffette-Kochanek, Exp. Dematol. 2 (1993) (32) N. Suzuki, H. Suzuki, T. Kojima, K. Sugita, Y. Takakubo, S. Okamoto, Mutation Res. 198 (1988) (33) N. Suzuki, H. Suzuki, Mutation Res. 202 (1988) (34) K. Sugita, N. suzuki, H. Niimi, Mutation Res. 357 (1996) (35) K. Sugita, N. Suzuki, Y. Higuchi, K. Kita, Y. suzuki, A. Lehmann, Mutation Res. 408 (1998) (40) M. A. Guthidge, M. Seldin, C. Basilico, Oncogene 12 (1996)
5 Figue legends Fig. 1 Diffeentially displayed cdna bands in RSa cells with (10 J/m2) and without UV iadiation. Fou h afte UV iadiation, total RNA was extacted and subjected to diffeential display analysis, as descibed in Mateials and methods. The aow indicates the diffeentially displayed cdna band. Fig. 2 Nothen blot analysis of RSa cells with (10 J/m2) and without UV iadiation using as pobes 4 diffeentially expessed cdna fagments. Fou h afte UV iadiation, total RNA was extacted and 12 mg of DNase-teated total RNA was applied to each lane. The 4 diffeentially displayed cdna fagments wee used as pobes and hybidized as descibed in Mateials and methods. Appoximate mrna sizes ae shown in kb. Fig. 3 Alteations of mrna expessions fo 4 clones afte UV iadiation in vaious cells. RNAs wee extacted 1, 4 and 12 h afte UV iadiation (10 J/m2) fom RSa, UV-1 and FF cells, and analyzed by Nothen analysis as descibed in Mateials and methods (A). The mrna level was quantified by the imaging analyze, nomalized fo the value of GAPDH mrna as descibed in Mateials and methods, and given as a pecentage of contol without UV iadiation (B)., RSa cells;, UV-1 cells;, FF cells. Fig. 4 (A) Effects of AS-oligo nucleotides teatment on Rheb mrna expession in RSa and UV-1 cells. Expession levels of Rheb mrna in contol (lanes 1 and 5), the andom-oligo-teated (lanes 2 and 6), and the AS-oligo-teated (lanes 3 and 7) cells, wee assessed by RT-PCR, as descibed in メ Mateials and methods モ. The AS-oligo-teated cells wee iadiated with UV and 1 h afte UV, Rheb mrna expession levels wee also analysed (lanes 4 and 8). Rheb mrna expession levels wee nomalized to GAPDH mrna levels, and epesented as elative atios to those of contol cells. (B) Faction of colony fomes plotted against doses of UV in contol ( ), the andom-oligo-teated ( ), and the AS-oligo-teated ( ) cells. Bas indicate the standad deviations. iadiationthe human homolog of FIN14 mrna expession was makedly inceased afte UV iadiation in RSa cells, but was not o less inceased in UV-1 cells and human fetal fiboblast cells. One was down-egulated afte UV iadiation and then ecoveed in RSa cells, with alteation essentially simila to that in the othe 2 cell lines. These genes might also be elated to UV sensitivity in the cell lines. Thus, it seems likely that the diffeential display method using cell lines with discepant UV sensitivity is useful fo identification of genes involved in UV esponse. and, while those of two mrnas fo unknown genes wee down-egulated ae highly sensitive to cell-killing and mutagenic effects of iadiation with fa-ultaviolet light (UV, pincipally 254-nm wavelength), Although we could not pecisely evaluate the alteation of the mrna levels fo NUD103-2 afte UV iadiation because of weak and boad signals on Nothen analysis, the levels in RSa and FF cells tended to be deceased 1 h afte UV iadiation and the low levels continued up to 12 h, and those in UV-1 cells appeaed to be slowly deceased up to 4 h and ecoveed 12 h afte iadiation (data not shown). 5
Quick Reference: Amplifier Equations
Quick efeence: Amplifie Equations 1.0 Intoduction Befoe deeloping a deep familiaity with the aious chaacteistics of amplifies, it s common to spend a fai amount of time flipping back and foth though you
More informationInvestigation of a Dual-Bed Autothermal Reforming of Methane for Hydrogen Production
Investigation of a Dual-Bed Autothemal Refoming of Methane fo Hydogen Poduction Amonchai Aponwichanop *, Manatsanan Wasuleewan, Yaneepon Patchaavoachot, and Suttichai Assabumungat Depatment of Chemical
More informationTheoretical Investigation on Condensing Characteristics of Air and Oil Vapor Mixtures
Pudue Univesity Pudue e-pubs Intenational Refigeation and Ai Conditioning Confeence School of Mechanical Engineeing 2008 Theoetical Investigation on Condensing Chaacteistics of Ai and Oil Vapo Mixtues
More informationOPTIMIZATION OF FILLER METALS CONSUMPTION IN THE PRODUCTION OF WELDED STEEL STRUCTURES
DOI: 10.1515/adms 016 0003 K. Pańcikiewicz, L. Tuz, Z. Żuek, Ł. Rakoczy AGH Univesity of Science and Technology in Kakow, Faculty Metals Engineeing and Industial Compute Science, Depatment of Physical
More informationProduction Policies of Perishable Product and Raw Materials
Poduction Policies of Peishable Poduct and Raw Mateials Yu-Hsuan Lin, Jei-Zheng Wu, and Jinshyang Roan Depatment of Business Administation, Soochow Univesity 56, Section, Kuei-yang Steet, aipei 0048, aiwan,
More informationCONICAL PIPE ENVELOPE FORMATION PROCESS
Pofesso Fydeyk Knap D Robet Kuzel, Eng. Czestochowa Technical Univesity Poland CONICAL PIPE ENVELOPE FORMATION PROCESS Abstact Conical pipes belong to a goup of economical pofiles which find boad application
More informationAN IDEA BASED ON HONEY BEE SWARM FOR NUMERICAL OPTIMIZATION (TECHNICAL REPORT-TR06, OCTOBER, 2005) Dervis KARABOGA
AN IDEA BASED ON HONEY BEE SWARM FOR NUMERICAL OPTIMIZATION (TECHNICAL REPORT-TR06, OCTOBER, 2005) Devis KARABOGA kaaboga@eciyes.edu.t Eciyes Univesity, Engineeing Faculty Compute Engineeing Depatment
More informationSANITARY ENGINEERING ASSISTANT, 7866 SANITARY ENGINEERING ASSOCIATE, 7870 SANITARY ENGINEER, 7872
8-8-86 SANITARY ENGINEERING ASSISTANT, 7866 SANITARY ENGINEERING ASSOCIATE, 7870 SANITARY ENGINEER, 7872 Summay of Duties : Pefoms pofessional sanitay and envionmental engineeing wok in connection with
More informationCommon up Regulated and down regulated Genes for Multiple Cancers using Microarray Gene Expression Analysis
Intenational Jounal Scientific and Reseach Publications, Volume 5, Issue, Januay 205 ISSN 2250-353 Common up Regulated and down egulated Genes fo Multiple Cances using Micoaay Gene Expession Analysis Apoova.D
More informationA biomechanical model for the study of plant morphogenesis: Coleocheate orbicularis, a 2D study species.
5 th Plant Biomechanics Confeence Stockholm, August 28 Septembe 1 2006 A biomechanical model fo the study of plant mophogenesis: Coleocheate obiculais, a 2D study species. Lionel Dupuy1, Jonathan P. Mackenzie1
More informationTime of Day Tariff Structure
Time of Day Taiff Stuctue Omka S. Pawaska and Pof. Ms. Swati. S. Moe "./ ".- - Demand - Abstact-The demand fo electicity in ndia is inceasing evey day. As pe consume demand, utility is equied to geneate,
More informationSolar in Wetlands. Photo credit: a k e.org/blog/2012/08/15mw solar field near philadelphia.html
Sola in Wetlands Photo cedit: http://www.l a k e.og/blog/2012/08/15mw sola field nea philadelphia.html Ceated by: Jessica son Isabel Molina Allie Ziegle Sam Zuckeman Patnes: Vemont Depatment of Envionmental
More informationFuzzy evaluation to parkour social value research based on AHP improved model
ISSN : 097-7 Volume 0 Issue BTAIJ, 0(), 0 [0-] Fuzzy evaluation to pakou social value eseach based on AHP impoved model Yulian Guo *, Xiaojun Guo and Xigui Sun Institute of Physical Education, Jilin Univesity,
More informationSelf-assessment for the SEPA-compliance of infrastructures
Self-assessment fo the SEPA-compliance of infastuctues Based on Tems of Refeence established by the Euopean Cental Bank as published in the 5 th Pogess Repot of SEPA (July 2007) and available on the website
More informationLecture 3 Activated sludge and lagoons
Lectue Activated sludge and lagoons ACTIVATED SLUDGE PROCESS Activated sludge pocess is used duing seconday teatment of wastewate. Activated sludge is a mixtue of bacteia, fungi, potozoa and otifes maintained
More informationSurface Water Hydrology
Suface Wate Hydology Intoduction Wate is a key component in the life cycles of all oganisms because of its ability to dissolve many substances (univesal solvent) and as a cooling agent. It is also an integal
More informationGenomeLab GeXP. Troubleshooting Guide. A53995AC December 2009
A53995AC Decembe 2009 GenomeLab GeXP Toubleshooting Guide Beckman Coulte, Inc. 250 S. Kaeme Blvd., Bea, CA 92821 Copyight 2009 Beckman Coulte, Inc. Copyight, Licenses and Tademaks Copyight Beckman Coulte,
More informationAdjoint Modeling to Quantify Stream Flow Changes Due to Aquifer Pumping
Adjoint Modeling to Quantify Steam Flow Changes Due to Aquife Pumping Roseanna M. Neupaue, ph. D Univesity of Coloado Novembe 2013 Completion Repot No. 225 Acknowledgements The autho thanks Stanley Leake
More informationAnalysis of the Internal Pressure in Tube Hydroforming and Its Experimental Investigation
84 J. Mate. Sci. Technol., Vol. No., 006 Analysis of the Intenal Pessue in Tube Hydofoming and Its Expeimental Investigation Hongyang LI 1), Zhongen, WANG ), Qibin MIAO ), Shijian YUAN ) and Xiaosong WANG
More informationQuantifying the First-Flush Phenomenon: Effects of First-Flush on Water Yield and Quality
Quantifying the Fist-Flush Phenomenon: Eects of Fist-Flush on Wate Yield and Quality D. B. Matinson* and T.H. Thomas** *Depatment of Civil Engineeing, Univesity of Potsmouth, Potland Building, Potland
More informationApplication of Induction Machine in Wind Power Generation System
Intenational Jounal of Applied Infomation Systems (IJAIS) ISSN : 49-0868 nd National Confeence on Innovative Paadigms in Engineeing & Technology (NCIPET 013) www.ijais.og Application of Induction Machine
More informationDESIGN OF OPTIMAL WATER DISTRIBUTION SYSTEMS
DESIGN OF OPIMAL WAER DISRIBUION SYSEMS IOAN SÂRBU Politehnica Univesity of imişoaa. Intoduction Distibution netwoks ae an essential pat of all wate supply systems. he eliability of supply is much geate
More informationMIAMI-DADE COUNTY PRODUCT CONTROL SECTION DEPARTMENT OF REGULATORY AND ECONOMIC RESOURCES (RER)
MIAMI-DADE COUNTY PRODUCT CONTROL SECTION DEPARTMENT OF REGULATORY AND ECONOMIC RESOURCES (RER) 11805 SW 26 Steet, Room 208 BOARD AND CODE ADMINISTRATION DIVISION Miami, Floida 33175-2474 T (786) 315-2590
More informationLearning and Technology Spillover: Productivity Convergence in Norwegian Salmon Aquaculture
Leaning and Technology Spillove: Poductivity Convegence in Nowegian Salmon Aquacultue Ragna Tveteås Stavange College & Foundation fo Reseach in Economics and Business Administation P.O. Box 2557 Ullandhaug,
More informationEvaluating the Effectiveness of a Balanced Scorecard System Implemented in a Functional Organization
Evaluating the Effectiveness of a Balanced Scoecad System Implemented in a Functional Oganization Chi-Bin Cheng, Depatment of Infomation Management, Tamkang Univesity, Taiwan Bao-Guang Chang, Depatment
More informationQuantitative [3-glucuronidase assay in transgenic plants
BIOLOGIA PLANTARUM 35 (1): 151-155, 1993 Quantitative [3-glucuonidase assay in tansgenic plants S. VITHA, K. BENE~, M. MICHALOV~, M. OND17~EJ Institute of Plant Molecula Biology, Academy of Science of
More informationThe effect of hitch-hiking on genes linked to a balanced polymorphism in a subdivided population
Genet. Res., Camb. (2), 76, pp. 63 73. With 6 figues. Pinted in the United Kingdom 2 Cambidge Univesity Pess 63 The effect of hitch-hiking on genes linked to a balanced polymophism in a subdivided population
More informationA Model for Dissolution of Lime in Steelmaking Slags
A Model fo Dissolution of Lime in Steelmaking Slags RAHUL SARKAR, USHASI ROY, and DINABANDHU GHOSH In a pevious study by Saka et al. (Metall. Mate. Tans. B 46B:96 05), a dynamic model of te LD steelmaking
More informationPcBn for cast iron Machining
spk competencies FOR CAST IRON MACHINING WITH PCBN tools technology application PcBn fo cast ion Machining CUTTING MATERIALS, TOOL SYSTEMS AND TECHNOLOGIES FOR TURNING 2 Machining cast ion mateials The
More informationEnvironmental Externalities in the Presence of Network Effects: Adoption of Low Emission Technologies in the Automobile Market
Envionmental Extenalities in the Pesence of Netwok Effects: Adoption of Low Emission Technologies in the Automobile Maket Eftichios S. Satzetakis 1 Depatment of Accounting and Finance, Univesity of Macedonia
More informationGlobal Energy Trade Flows and Constraints on Conventional and Renewable Energies A Computable Modeling Approach
ISSN 1611-681X Global Enegy Tade Flows and Constaints on Conventional and Renewable Enegies A Computable Modeling Appoach Ole Gogo Dokumentation N. 12-02 Global Enegy Tade Flows and Constaints on Conventional
More informationAn Approach to Classify the Risk of Operating Nuclear Power Plants Case Study: Neckarwestheim Unit 1 and Unit 2
An Appoach to Classify the Risk of Opeating Nuclea Powe Plants Case Study: Neckawestheim Unit 1 and Unit 2 A. Stohm a*, L. Ehlkes a, W. Schwaz a, M. Khatib-Rahba b, M. Zavisca b, and D. Rittig c a EnBW
More informationDetection of allele-specific methylation through a generalized heterogeneous epigenome model
BIOINFORMATICS Vol. 28 ISMB 2012, pages i163 i171 doi:10.1093/bioinfomatics/bts231 Detection of allele-specific methylation though a genealized heteogeneous epigenome model Qian Peng 1,2, and Joseph R.
More informationCombining ability analysis for yield and quality traits in indigenous aromatic rice
Oyza Vol. 49. No. 4, 2012 (251-257) Combining ability analysis fo yield and quality taits in indigenous aomatic ice A K Sivastava*, H K Jaiswal and R K Agawal Institute of Agicultual Sciences, Banaas Hindu
More informationCoal ash ponds: Could they contribute to Alzheimer s disease risk in residential populations?
Coal ash ponds: Could they contibute to Alzheime s disease isk in esidential populations? Julia Kavchenko, MD, PHD Assistant Pofesso, Depatment of Sugey, Duke Univesity School of Medicine Octobe 27-28,
More informationCOMPUTER MODELLING AND FINITE ELEMENT ANALYSIS OF TUBE FORMING OPERATIONS Dr.S.Shamasundar, Manu Mathai, Sachin B M
COMPUTER MODELLING AND FINITE ELEMENT ANALYSIS OF TUBE FORMING OPERATIONS D.S.Shamasunda, Manu Mathai, Sachin B M INTRODUCTION: Tubula sections can be conveted into a vaiety of poducts. One o moe foming
More informationDevelopment projects, migration and malaria in the GMS
Development pojects, migation and malaia in the GMS Biegional Meeting on Healthy Bodes in the GMS 5-7 August 2013, Bangkok, Thailand D. Deye Gopinath MD MPH Wold Health Oganization Lao PDR gopinathd@wpo.who.int
More informationProgress towards Modeling Red Tides and Algal Blooms
Pogess towads Modeling Red Tides and Algal Blooms Maxim Lowe College of the Atlantic Ba Habo, ME 04609 mlowe@coa.edu Novembe 23, 2014 Abstact Conditions in the ocean sometimes allow specific species to
More informationSURFACE TENSION OF LIQUID MARBLES, AN EXPERIMENTAL APPROACH
SURFACE TENSION OF LIQUID MARBLES, AN EXPERIMENTAL APPROACH Tina Abatan, Wei Shen 1 1 Austalian Pulp and Pape Institute, Depatment of Chemical Engineeing, Monash Univesity, Clayton, 3800, Austalia, Wei.shen@monash.edu
More informationDemulsification of Water-in-Oil Emulsions by Microwave Heating Technology
Wold Academy of Science, Engineeing and Technology Intenational Jounal of Chemical and Molecula Engineeing Demulsification of Wate-in-Oil Emulsions by Micowave Heating Technology Abduahman H. Nou, Rosli
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationImproving Software Effort Estimation Using Neuro-Fuzzy Model with SEER-SEM
a g e 52 Vol. 0 Issue 2 (Ve..0) Octobe 200 Global Jounal of Compute Science and Technology Impoving Softwae Effot Estimation Using Neuo-Fuzzy Model with SEER-SEM Abstact - Accuate softwae development effot
More informationEfficient Multi-site-directed Mutagenesis directly from Genomic Template.
Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationDEFECT ASSESSMENT ON PIPE USED FOR TRANSPORT OF MIXTURE OF HYDROGEN AND NATURAL GAS
1 DEFECT ASSESSMENT ON PIPE USED FOR TRANSPORT OF MIXTURE OF HYDROGEN AND NATURAL GAS ABSTRACT Capelle, J. 1, Gilget, J. 1 and Pluvinage, G. 1 1 Laboatoie de mécanique Biomécanique Polymèe Stuctue (LaBPS),
More informationSuper Precision Bearings for Machine Tools
Supe Pecision Beaings fo Machine Tools Outstanding speed, igidity, and pecision delive impoved machine tool pefomance while educing enegy loss and placing less buden on the global envionment. NSK s key
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationManaging Accounting Information Quality: An Australian Study
Association fo Infomation Systems AIS Electonic Libay (AISeL) ICIS 2000 Poceedings Intenational Confeence on Infomation Systems (ICIS) Decembe 2000 Managing Accounting Infomation Quality: An Austalian
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationof the North American Automotive Industry VOLUME 3: MATERIALS June, 1998 Published by
Delphi IX Foecast and Analysis of the Noth Ameican Automotive Industy VOLUME 3: MATERIALS June, 1998 Published by Office fo the Study of Automotive Tanspotation Univesity of Michigan Tanspotation Reseach
More informationCONE PERMEAMETER IN-SITU PERMEABILITY MEASUREMENTS WITH DIRECT PUSH TECHNIQUES
CONE PERMEAMETER IN-SITU PERMEABILITY MEASUREMENTS WITH DIRECT PUSH TECHNIQUES Bill Lowy, Neva Mason, and Veaun Chipman Science and Engineeing Associates 3205 Richads Lane, Suite A, Santa Fe, NM 87505
More informationABSTRACT INTRODUCTION
www.bunsmcd.com Title: Case Study: Minnkota Powe s Milton R. Young Station Electical System Assessment Authos: M. Cales Mille, Buns & McDonnell M. Dan Matian, Minnkota Powe Coopeative M. Richad Mahaley,
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationSIMULATION OF NATURAL GAS FLUIDIZED BED USING COMPUTATIONAL FLUID DYNAMICS
o PDPETO, Campinas, SP 5.3.03- - de Outubo de 007 SIMULATION OF NATUAL GAS FLUIDIZED BED USING COMPUTATIONAL FLUID DYNAMICS Felix Seveino de Faias Junio UNICAMP) 5, ubens Maciel Filho UNICAMP) 5, Seio
More informationSocial Rewarding in Wiki Systems Motivating the Community
Social Rewading in Wiki Systems Motivating the Community Benhad Hoisl 1, Wolfgang Aigne 2, Silvia Miksch 2 1 Institute of Softwae Technology and Inteactive Systems, Vienna Univesity of Technology, Favoitenst.
More informationMSEC_ICM&P ESTIMATION OF TEMPERATURE DISTRIBUTION IN SILICON DURING MICRO LASER ASSISTED MACHINING
Poceedings of the 008 Intenational Manfacting Science and Engineeing Confeence MSEC008 Octobe 7-10, 008, Evanston, Illinois, USA MSEC_ICM&P008-7195 ESTIMATION OF TEMPERATURE DISTRIBUTION IN SILICON DURING
More informationHousehold Energy Use and Carbon Emissions in China: A Decomposition Analysis
1 2 Hosehold Enegy Use and Cabon Emissions in China: A Decomposition Analysis 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Qin ZHU 1 and Taoyan WEI 2 * 1 School of Social Development and Pblic
More informationKINEMATICS OF RIGID BODIES. y Copyright 1997 by The McGraw-Hill Companies, Inc. All rights reserved. KINEMATICS OF RIGID BODIES
KINEMTICS F RIGID DIES Copight 1997 b The McGaw-Hill Companies, Inc ll ights eseved KINEMTICS F RIGID DIES In igid bod tanslation, all points of the bod have the same velocit and the same acceleation at
More informationOne-to-one Marketing on the Internet
Association fo Infomation Systems AIS Electonic Libay (AISeL) ICIS 1999 Poceedings Intenational Confeence on Infomation Systems (ICIS) Decembe 1999 One-to-one Maketing on the Intenet Rajiv Dewan Univesity
More informationTheoretical model and experimental investigation of current density boundary condition for welding arc study
Theoetical model and expeimental investigation of cuent density bounday condition fo welding ac study A. Boutaghane, K. Bouhadef, F. Valensi, S. Pellein, Y. Benkedda To cite this vesion: A. Boutaghane,
More informationRecombinant Enzymes from NEB
New England Biolabs, Inc. Tel: 800-632-5227 (odes) Tel: 800-632-7799 (suppot) Fax: 978-921-1350 info@neb.com www.neb.com Recombinant Enzymes fom NEB New England Biolabs, Inc. Established in 1975 as a pivate
More informationTaq DNA Polymerase. high yield, robust and reliable PCR reactions. Value Industry standard for routine PCR at a low price
July 2006. vol. 1.2 NEBexpessions a scientific update fom New England Biolabs Welcome to the summe edition of NEB Expessions. In addition to new poduct announcements and technical tips, we highlight data
More informationNumerical Simulation of Transient 3-D Surface Deformation of a Completely Penetrated GTA Weld
WELDING RESEARCH Numeical Simulation of Tansient 3-D Suface Defomation of a Completely Penetated GTA Weld An analytical model that loes the dynamic behavio of a weld pool will help in the development of
More informationTRAINING NEEDS ANALYSIS and NATIONAL TRAINING STRATEGIES
TRAINING NEEDS ANALYSIS and NATIONAL TRAINING STRATEGIES How to ensue the ight taining at the ight time to the ight people? Deliveing Good Govenance Tools fo Local and Cental Authoities Pinciples of Taining
More informationQuantitative Models to Study the Soil Porosity
Open Jounal of Moden Hydology, 016, 6, 53-6 http://www.scip.og/jounal/ojmh ISSN Online: 163-0496 ISSN Pint: 163-0461 Quantitative Models to Study the Soil Poosity as Function of Soil Resistivity M. Juandi
More informationCustomer Portfolio Analysis Using the SOM
Association fo Infomation Systems AIS Electonic Libay (AISeL) ACIS 2008 Poceedings Austalasian (ACIS) 2008 Custome Potfolio Analysis Using the SOM Annika H. Holmbom Tuku Cente fo Compute Science (TUCS)
More informationDISPLACEMENT-BASED DESIGN OF CONCRETE TILT-UP FRAMES ACCOUNTING FOR FLEXIBLE DIAPHRAGMS
13 th Wold Confeence on Eathquake Engineeing Vancouve, B.C., Canada August 1-6, 24 Pape No. 154 DISPLACEMENT-BASED DESIGN OF CONCRETE TILT-UP FRAMES ACCOUNTING FOR FLEXIBLE DIAPHRAGMS Pey ADEBAR 1, Zhao
More informationIntroduction. Keywords: bamboo, dynamic nanoindentation, heat treatment, quasi-static nanoindentation
Holzfoschung 2015; 69(7): 909 914 Yanjun Li, Liping Yin, Chengjian Huang, Yujie Meng, Feng Fu, Siqun Wang* and Qiang Wu* Quasi-static and dynamic nanoindentation to detemine the influence of themal teatment
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationPROGRAMA BIOEN Projeto 2008/ Simulating Land Use and Agriculture Expansion in Brazil: Food, Energy, Agro industrial and Environmental Impacts
PROGRAMA BIOEN Pojeto 2008/56156 0 Simulating Land Use and Agicultue Expansion in Bazil: Food, Enegy, Ago industial and Envionmental Impacts Relatóio Científico Final (9 de Feveeio de 2011) Pesquisado
More informationSPONSORSHIP OPPORTUNITIES
Ottawa Childen s Festival de la jeunesse SPONSORSIP OPPORTUNITIES 2018 T: 61.241.0999 294 Albet St., Suite 602 Ottawa, ON, K1P 6E6 Chaitable Registation # 11891-4977-RR0001 OVERVIEW The Ottawa Childen
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationHOBAS NC Line. Make things happen.
HOBAS Line Make things happen. HOBAS Line - fo Pipes with a on-icula oss-section HOBAS Line ae glass-einfoced polyeste (GRP) pipes manufactued using the filament winding pocess and designed fo constucting
More informationEvolving Large Scale UAV Communication System
Evolving Lage Scale UAV Communication System Adian Agogino UCSC at NASA Ames ail Stop 69-3 offett Field, CA 94035 Adian.K.Agogino@ nasa.gov Chis HolmesPake Oegen State Univesity 04 oges Hall Covallis,
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationJournal of Retail Analytics
Jounal of Retail Analytics platt etail institute Binging Reseach to Retail SM Sponsoed by: The Jounal of Retail Analytics is published quately by Platt Retail Institute, LLC. Aticles on elevant topics
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationOptimum Design of Pipe Bending Based on High- Frequency Induction Heating Using Dynamic Reverse Moment
Optiu Design of Pipe Bending Based on High- Fequency Induction Heating Using Dynaic Revese Moent Pipe bending by high-fequency local induction heating is an advanced technique used to bend pipes having
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationCompetitive Analytics of Multi-channel Advertising and Consumer Inertia
Abstact Competive Analytics of Multi-channel Advetising and Consume Inetia Yiyi Li UT Dallas yxl111020@utdallas.edu (Full pape) Eic Zheng UT Dallas zxz062000@utdallas.edu Ying Xie UT Dallas ying.xie@utdallas.edu
More informationAssessing Emission Allocation in Europe: An Interactive Simulation Approach
Discussion Pape No. 04-40 Assessing Emission Allocation in Euope: An Inteactive Simulation Appoach Chistoph Böhinge, Tim Hoffmann, Andeas Lange, Andeas Löschel and Ulf Moslene Discussion Pape No. 04-40
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationSteam Turbine Seminar -17 Lund University
Steam Tubine Semina -17 Lund Univesity Something on hydaulics N.B. This is an old setup with 1 of 2 the stateof-the-at is 2 out of 3 tip edundancy (both the potection system and the hydaulics) The safety
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationT 1.
* T 1 T3 T3 Email: abbasezaei2@gmail.com * SDC m m oc ph EC (ds m -1 ) (mg kg -1 ) (mg kg -1 ) T 1 E Y H I T3 B Y E Y WP I P WP I+P I T3 SAS(v.9.1) LSD T3 T3 = = = T3 T3 T3. Oyza sativa L. ice in a semi
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationCitation Zeitschrift für Metallkunde. 92(11)
Title Themodynamic valuation of Phase Diagams Nano-Pa utho(s) Tanaka, Toshihio; Haa, shigeta Citation Zeitschift fü Metallkunde. 92(11) Issue 21 Date Text Vesion publishe URL http://hdl.handle.net/1194/26514
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationArch. Min. Sci., Vol. 61 (2016), No 4, p
Ach. Min. Sci., ol. 6 (206), No 4, p. 967 977 Electonic vesion (in colo) of this pape is available: http://mining.achives.pl DOI 0.55/amsc-206-0064 RYSZARD SNOPKOWSKI*, ANETA NAPIERAJ*, MARTA SUKIENNIK*
More informationLecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
More informationComparison of gene expression under in vitro and ex vitro conditions during rooting of grape cuttings through mrna differential display
Plant Cell, Tissue and Organ Culture (2005) 80: 105 109 Ó Springer 2005 Research note Comparison of gene expression under in vitro and ex vitro conditions during rooting of grape cuttings through mrna
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual KOD -Plus- 1207 F0934K KOD -Plus- Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2.
More informationOptimal Policies for Perishable Items when Demand Depends on Freshness of Displayed Stock and Selling Price
Opinion imedpub Jounals www.iedpub.co DOI: 10.21767/2394-9988.100060 Intenational Jounal of Applied Science - Reseach and Review Abstact Optial Policies fo Peishable Ites when Deand Depends on Feshness
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More information