Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies.

Size: px
Start display at page:

Download "Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies."

Transcription

1 Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies.

2 References Summaries of Affymetrix Genechip Probe Level Data, Irizarry et al., Nucleic Acids Research, 2003, Vol. 31, No. 4. Exploration, Normalization and Summaries of High Density Oligonucleotide Array Probe Level Data, Irizarry et al., A Model Based Background Adjustment for Oligonucleotide Expression Arrays, Wu, Irizarry et al., Johns Hopkins University, Dept. of Biostatistics

3 Affymetrix Genechips Each gene represented by probe pairs. Probe pairs are 3 biased. Probe Pair consists of Perfect Match (PM) and MisMatch (MM) probes. MM has altered middle (13th) base. Designed to measure non-specific binding (NSB).

4 Genechip Scanning RNA sample prepared, labelled and hybridised to chip. Chip fluorescently scanned. Gives a raw pixelated image -.DAT file. Grid used to separate pixels related to individual probes. Pixel intensities averaged to give single intensity for each probe -.CEL file. Probe level intensities combined for each probe set to give single intensity value for each gene.

5 Affymetrix MicroArray Suite (MAS) v4.0 Uses MM probes to correct for NSB. MAS4.0 used simple Average Difference method: 1 AvDiff A PM j A j MM j MM j 3 A is the subset of probes where d j PMisj within d 2,..., d J 1 SDs of the average of Excludes outliers, but not a robust averaging method.

6 Affymetrix MicroArray Suite (MAS) v5.0 Current method employed by Affymetrix. Weighted mean using one-step Tukey Biweight Estimate: signal log 1 Tukey Biweight log PM j CT j CTj is a quantity derived from MMj never larger than PMj. Weights each probe intensity based on it s distance from the mean. Robust average (insensitive to small changes from any assumptions made).

7 Tukey Biweight

8 Problems with Mis-Match data MM intensity levels are greater than PM intensity levels in ~1/3 of all probes. Suggests that MM probes measure actual signal, and not just NSB. Removal of MM results in negative signal values. Subtracting MM data will result in loss of interesting signal in many probes. Several methods have been proposed using only PM data.

9 Problems with Mis-Match data

10 Problems with MAS5.0 Loss of probe-level information. Background estimate may cause noise at low intensity levels due to subtraction of MM data.

11 Robust Multiarray Average (RMA) Subtraction of MM data corrects for NSB, but introduces noise. Want a method that gives positive intensity values. Normalising at probe level avoids the loss of information.

12 Robust Multiarray Average (RMA) 1) Background correction. 2) Normalization (across arrays). Probe level intensity calculation. 4) Probe set summarization. 3)

13 Robust Multiarray Average (RMA) PM data is combination of background and signal. B PM ijn Sijn PM ijn Assume strictly positive distribution for signal. Then background corrected signal is also positively distributed. Background correction performed on each array seperately.

14 Robust Multiarray Average (RMA) 1) 2) Background correction. Normalization (across arrays). 3) Probe level intensity calculation. 4) Probe set summarization.

15 Robust Multiarray Average (RMA) Normalises across all arrays to make all distributions the same. Quantile Normalization used to correct for array biases. Compares expression levels between arrays for various quantiles. Can view this on quantile-quantile plot. Protects against outliers.

16 Robust Multiarray Average (RMA) Background correction. Normalization (across arrays). 1) 2) 3) Probe level intensity calculation. 4) Probe set summarization.

17 Robust Multiarray Average (RMA) Linear model. Uses background corrected, normalised, log transformed probe intensities (Yijn). Yijn in jn ijn μin = Log scale expression level (RMA measure). αjn = Probe affinity affect. εijn = Independent identically distributed error term (with mean 0).

18 Robust Multiarray Average (RMA) Background correction. Normalization (across arrays). Probe level intensity calculation. 1) 2) 3) 4) Probe set summarization.

19 Robust Multiarray Average (RMA) Combine intensity values from the probes in the probe set to get a single intensity value for each gene. Uses Median Polishing. Each chip normalised to its median. Each gene normalised to its median. Repeated until medians converge. Maximum of 5 iterations to prevent infinate loops.

20 Robust Multiarray Average (RMA) Pre-Normalisation

21 Robust Multiarray Average (RMA) Post-Normalisation

22 GC-RMA Corrects for background noise as well as NSB. Probe affinity calculated using position dependant base effects: MM data adjusted based on probe affinity, then subtracted from PM. Does not lose MM data.

23 Advantages of RMA/GC-RMA Gives less false positives than MAS5.0. See less variance at lower expression levels than MAS5.0. Provides more consistent fold change estimates. Exclusion of MM data in RMA reduces noise, but loses information. Inclusion of adjusted MM data in GC-RMA reduces noise, and retains MM data.

24 Disadvantages of RMA/GC-RMA May hide real changes, especially at low expression levels (false negatives). Makes quality control after normalisation difficult. Normalisation assumes equal distribution which may hide biological changes.

25 Conclusions RMA is more precise than MAS5.0, but may result in false negatives at low expression levels. Useful for fold change analysis, but not for studying statistical significance. Makes quality control difficult. Ideal solution Use standard MAS5.0 techniques for quality control. Then go back and perform probe level normalisation on quality controlled genes.

Preprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT

Preprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT Preprocessing Affymetrix GeneChip Data Credit for some of today s materials: Ben Bolstad, Leslie Cope, Laurent Gautier, Terry Speed and Zhijin Wu Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT

More information

Introduction to gene expression microarray data analysis

Introduction to gene expression microarray data analysis Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful

More information

DNA Microarray Data Oligonucleotide Arrays

DNA Microarray Data Oligonucleotide Arrays DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental

More information

Outline. Analysis of Microarray Data. Most important design question. General experimental issues

Outline. Analysis of Microarray Data. Most important design question. General experimental issues Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction

More information

Parameter Estimation for the Exponential-Normal Convolution Model

Parameter Estimation for the Exponential-Normal Convolution Model Parameter Estimation for the Exponential-Normal Convolution Model Monnie McGee & Zhongxue Chen cgee@smu.edu, zhongxue@smu.edu. Department of Statistical Science Southern Methodist University ENAR Spring

More information

SPH 247 Statistical Analysis of Laboratory Data

SPH 247 Statistical Analysis of Laboratory Data SPH 247 Statistical Analysis of Laboratory Data April 14, 2015 SPH 247 Statistical Analysis of Laboratory Data 1 Basic Design of Expression Arrays For each gene that is a target for the array, we have

More information

Bioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays

Bioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays Bioinformatics III Structural Bioinformatics and Genome Analysis PART II: Genome Analysis Chapter 7. DNA Microarrays 7.1 Motivation 7.2 DNA Microarray History and current states 7.3 DNA Microarray Techniques

More information

Exploration, normalization, and summaries of high density oligonucleotide array probe level data

Exploration, normalization, and summaries of high density oligonucleotide array probe level data Biostatistics (2003), 4, 2,pp. 249 264 Printed in Great Britain Exploration, normalization, and summaries of high density oligonucleotide array probe level data RAFAEL A. IRIZARRY Department of Biostatistics,

More information

What does PLIER really do?

What does PLIER really do? What does PLIER really do? Terry M. Therneau Karla V. Ballman Technical Report #75 November 2005 Copyright 2005 Mayo Foundation 1 Abstract Motivation: Our goal was to understand why the PLIER algorithm

More information

Humboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture

Humboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization

More information

affy: Built-in Processing Methods

affy: Built-in Processing Methods affy: Built-in Processing Methods Ben Bolstad October 30, 2017 Contents 1 Introduction 2 2 Background methods 2 2.1 none...................................... 2 2.2 rma/rma2...................................

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Introduction to Bioinformatics. Fabian Hoti 6.10.

Introduction to Bioinformatics. Fabian Hoti 6.10. Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction

More information

Microarray Technique. Some background. M. Nath

Microarray Technique. Some background. M. Nath Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

6. GENE EXPRESSION ANALYSIS MICROARRAYS

6. GENE EXPRESSION ANALYSIS MICROARRAYS 6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011

More information

Predicting Microarray Signals by Physical Modeling. Josh Deutsch. University of California. Santa Cruz

Predicting Microarray Signals by Physical Modeling. Josh Deutsch. University of California. Santa Cruz Predicting Microarray Signals by Physical Modeling Josh Deutsch University of California Santa Cruz Predicting Microarray Signals by Physical Modeling p.1/39 Collaborators Shoudan Liang NASA Ames Onuttom

More information

What you still might want to know about microarrays. Brixen 2011 Wolfgang Huber EMBL

What you still might want to know about microarrays. Brixen 2011 Wolfgang Huber EMBL What you still might want to know about microarrays Brixen 2011 Wolfgang Huber EMBL Brief history Late 1980s: Lennon, Lehrach: cdnas spotted on nylon membranes 1990s: Affymetrix adapts microchip production

More information

ADVANCED STATISTICAL METHODS FOR GENE EXPRESSION DATA

ADVANCED STATISTICAL METHODS FOR GENE EXPRESSION DATA ADVANCED STATISTICAL METHODS FOR GENE EXPRESSION DATA Veera Baladandayuthapani & Kim-Anh Do University of Texas M.D. Anderson Cancer Center Houston, Texas, USA veera@mdanderson.org Course Website: http://odin.mdacc.tmc.edu/

More information

Description of Logit-t: Detecting Differentially Expressed Genes Using Probe-Level Data

Description of Logit-t: Detecting Differentially Expressed Genes Using Probe-Level Data Description of Logit-t: Detecting Differentially Expressed Genes Using Probe-Level Data Tobias Guennel October 22, 2008 Contents 1 Introduction 2 2 What s new in this version 3 3 Preparing data for use

More information

Probe-Level Data Analysis of Affymetrix GeneChip Expression Data using Open-source Software Ben Bolstad

Probe-Level Data Analysis of Affymetrix GeneChip Expression Data using Open-source Software Ben Bolstad Probe-Level Data Analysis of Affymetrix GeneChip Expression Data using Open-source Software Ben Bolstad bmb@bmbolstad.com http://bmbolstad.com August 7, 2006 1 Outline Introduction to probe-level data

More information

Gene Expression Data Analysis (I)

Gene Expression Data Analysis (I) Gene Expression Data Analysis (I) Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Bioinformatics tasks Biological question Experiment design Microarray experiment

More information

Gene Signal Estimates from Exon Arrays

Gene Signal Estimates from Exon Arrays Gene Signal Estimates from Exon Arrays I. Introduction: With exon arrays like the GeneChip Human Exon 1.0 ST Array, researchers can examine the transcriptional profile of an entire gene (Figure 1). Being

More information

Oligonucleotide microarray data are not normally distributed

Oligonucleotide microarray data are not normally distributed Oligonucleotide microarray data are not normally distributed Johanna Hardin Jason Wilson John Kloke Abstract Novel techniques for analyzing microarray data are constantly being developed. Though many of

More information

Exploration and Analysis of DNA Microarray Data

Exploration and Analysis of DNA Microarray Data Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate

More information

Analysis of a Tiling Regulation Study in Partek Genomics Suite 6.6

Analysis of a Tiling Regulation Study in Partek Genomics Suite 6.6 Analysis of a Tiling Regulation Study in Partek Genomics Suite 6.6 The example data set used in this tutorial consists of 6 technical replicates from the same human cell line, 3 are SP1 treated, and 3

More information

Comparative analysis of microarray normalization procedures: effects on reverse engineering gene networks

Comparative analysis of microarray normalization procedures: effects on reverse engineering gene networks BIOINFORMATICS Vol. 23 ISMB/ECCB 2007, pages i282 i288 doi:10.1093/bioinformatics/btm201 Comparative analysis of microarray normalization procedures: effects on reverse engineering gene networks Wei Keat

More information

Philippe Hupé 1,2. The R User Conference 2009 Rennes

Philippe Hupé 1,2. The R User Conference 2009 Rennes A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

A GENOTYPE CALLING ALGORITHM FOR AFFYMETRIX SNP ARRAYS

A GENOTYPE CALLING ALGORITHM FOR AFFYMETRIX SNP ARRAYS Bioinformatics Advance Access published November 2, 2005 The Author (2005). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

More information

Class Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1

Class Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1 This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Analyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek

Analyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek Analyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek This example data set consists of 20 selected HapMap samples, representing 10 females and 10 males, drawn from a mixed ethnic population of

More information

Bioconductor tools for microarray analysis Preprocessing : normalization & error models. Wolfgang Huber EMBL

Bioconductor tools for microarray analysis Preprocessing : normalization & error models. Wolfgang Huber EMBL Bioconductor tools for microarray analysis Preprocessing : normalization & error models Wolfgang Huber EMBL An international open source and open development software project for the analysis of genomic

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

HELP Microarray Analytical Tools

HELP Microarray Analytical Tools HELP Microarray Analytical Tools Reid F. Thompson October 30, 2017 Contents 1 Introduction 2 2 Changes for HELP in current BioC release 3 3 Data import and Design information 4 3.1 Pair files and probe-level

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

MulCom: a Multiple Comparison statistical test for microarray data in Bioconductor.

MulCom: a Multiple Comparison statistical test for microarray data in Bioconductor. MulCom: a Multiple Comparison statistical test for microarray data in Bioconductor. Claudio Isella, Tommaso Renzulli, Davide Corà and Enzo Medico May 3, 2016 Abstract Many microarray experiments compare

More information

Technical Note. Performance Review of the GeneChip AutoLoader for the Affymetrix GeneChip Scanner Introduction

Technical Note. Performance Review of the GeneChip AutoLoader for the Affymetrix GeneChip Scanner Introduction GeneChip AutoLoader AFFYMETRIX PRODUCT FAMILY > > Technical Note Performance Review of the GeneChip AutoLoader for the Affymetrix GeneChip ner 3000 Designed for use with the GeneChip ner 3000, the GeneChip

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

Use of DNA microarrays, wherein the expression levels of

Use of DNA microarrays, wherein the expression levels of Modeling of DNA microarray data by using physical properties of hybridization G. A. Held*, G. Grinstein, and Y. Tu IBM Thomas J. Watson Research Center, Yorktown Heights, NY 10598 Communicated by Charles

More information

Data Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds. Overview. Data Analysis Tutorial

Data Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds. Overview. Data Analysis Tutorial Data Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds Overview In order for accuracy and precision to be optimal, the assay must be properly evaluated and a few

More information

MAOSA: A new procedure for detection of differential gene expression

MAOSA: A new procedure for detection of differential gene expression Statistical Methodology 3 (2006) 42 54 www.elsevier.com/locate/stamet MAOSA: A new procedure for detection of differential gene expression Greg Dyson a,,c.f.jeffwu b a Department of Human Genetics, University

More information

Custom Design and Analysis of High-Density Oligonucleotide Bacterial Tiling Microarrays

Custom Design and Analysis of High-Density Oligonucleotide Bacterial Tiling Microarrays Custom Design and Analysis of High-Density Oligonucleotide Bacterial Tiling Microarrays Gard O. S. Thomassen 1,2, Alexander D. Rowe 2, Karin Lagesen 2, Jessica M. Lindvall 3, Torbjørn Rognes 2,3 * 1 Centre

More information

Guidelines for setting up microrna profiling experiments v2.0

Guidelines for setting up microrna profiling experiments v2.0 Guidelines for setting up microrna profiling experiments v2.0 December 2010 Table of contents 2 Experimental setup................................................ 3 Single-color experiments........................................

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Mentor: Dr. Bino John

Mentor: Dr. Bino John MAT Shiksha Mantri Mentor: Dr. Bino John Model-based Analysis y of Tiling-arrays g y for ChIP-chip X. Shirley Liu et al., PNAS (2006) vol. 103 no. 33 12457 12462 Tiling Arrays Subtype of microarray chips

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

Introduction to microarrays. Overview The analysis process Limitations Extensions (NGS)

Introduction to microarrays. Overview The analysis process Limitations Extensions (NGS) Introduction to microarrays Overview The analysis process Limitations Extensions (NGS) Outline An overview (a review) of microarrays Experiments with microarrays The data analysis process Microarray limitations

More information

A comparative analytical assay of gene regulatory networks inferred using microarray and RNA-seq datasets

A comparative analytical assay of gene regulatory networks inferred using microarray and RNA-seq datasets www.bioinformation.net Volume 12(6) Hypothesis A comparative analytical assay of gene regulatory networks inferred using microarray and RNA-seq datasets Fereshteh Izadi *, Hamid Najafi Zarrini, Ghaffar

More information

Comparison of mrna Gene Expression Analysis between Quantitative-real time PCR Assay and DNA Microarray Based Assay

Comparison of mrna Gene Expression Analysis between Quantitative-real time PCR Assay and DNA Microarray Based Assay 2011 International Conference on Agricultural and Natural Resources Engineering Advances in Biomedical Engineering, Vol.3-5 Comparison of mrna Gene Expression Analysis between Quantitative-real time PCR

More information

What is a microarray

What is a microarray DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

DNA Microarray Data Analysis and Mining: Affymetrix Software Package and In-House Complementary Packages

DNA Microarray Data Analysis and Mining: Affymetrix Software Package and In-House Complementary Packages University of New Orleans ScholarWorks@UNO University of New Orleans Theses and Dissertations Dissertations and Theses 12-19-2003 DNA Microarray Data Analysis and Mining: Affymetrix Software Package and

More information

New Stringent Two-Color Gene Expression Workflow Enables More Accurate and Reproducible Microarray Data

New Stringent Two-Color Gene Expression Workflow Enables More Accurate and Reproducible Microarray Data Application Note GENOMICS INFORMATICS PROTEOMICS METABOLOMICS A T C T GATCCTTC T G AAC GGAAC T AATTTC AA G AATCTGATCCTTG AACTACCTTCCAAGGTG New Stringent Two-Color Gene Expression Workflow Enables More

More information

Data Mining Whole-Genome Expression Profiling

Data Mining Whole-Genome Expression Profiling Data Mining Whole-Genome Expression Profiling Internship Presentation Computational Biosciences Arizona State University Advisors: Dr. Seth Dobrin Dr. Dietrich Stephan Intern: Shruti Lal Outline Introduction

More information

TRANSCRIPTOME ANALYSIS IN PRETERM INFANTS DEVELOPING BRONCHOPULMONARY DYSPLASIA

TRANSCRIPTOME ANALYSIS IN PRETERM INFANTS DEVELOPING BRONCHOPULMONARY DYSPLASIA TRANSCRIPTOME ANALYSIS IN PRETERM INFANTS DEVELOPING BRONCHOPULMONARY DYSPLASIA Data processing and statistical analysis of microarray data Inauguraldissertation zur Erlangung des Grades eines Doktors

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Outline. Array platform considerations: Comparison between the technologies available in microarrays

Outline. Array platform considerations: Comparison between the technologies available in microarrays Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of

More information

CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer

CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer T. M. Murali January 31, 2006 Innovative Application of Hierarchical Clustering A module map showing conditional

More information

DNA Microarray Experiments: Biological and Technological Aspects

DNA Microarray Experiments: Biological and Technological Aspects DNA Microarray Experiments: Biological and Technological Aspects Danh V. Nguyen 1, A. Bulak Arpat 2, Naisyin Wang 1, and Raymond J. Carroll 1 1 Department of Statistics, Texas A&M University, College Station,

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

ADNA barcode is a short DNA sequence that uniquely

ADNA barcode is a short DNA sequence that uniquely Design of 240,000 orthogonal 25mer DNA barcode probes Qikai Xu a, Michael R. Schlabach a, Gregory J. Hannon b, and Stephen J. Elledge a,1 a Department of Genetics, Center for Genetics and Genomics, Brigham

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

UNIVERSITY OF TORINO. Department of Clinical and Biological Sciences. Doctoral School in Complex Systems in Medicine and Life Sciences

UNIVERSITY OF TORINO. Department of Clinical and Biological Sciences. Doctoral School in Complex Systems in Medicine and Life Sciences UNIVERSITY OF TORINO Department of Clinical and Biological Sciences Doctoral School in Complex Systems in Medicine and Life Sciences Ph.D. in COMPLEX SYSTEMS IN POST-GENOMIC BIOLOGY XXIII cycle Computational

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

A Comparative Performance Survey on Microarray Data Analysis Techniques for Colon Cancer Classification

A Comparative Performance Survey on Microarray Data Analysis Techniques for Colon Cancer Classification International Journal of Computer Applications (975 8887) Volume 93 No.17, May 214 A Comparative Performance Survey on Microarray Data Analysis Techniques for Colon Cancer Classification Kshipra Chitode

More information

Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04

Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu

More information

Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer

Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Nagwan M. Abdel Samee 1, Nahed H. Solouma 2, Mahmoud Elhefnawy 3, Abdalla S. Ahmed 4, Yasser M. Kadah 5 1 Computer Engineering

More information

Agilent s Mx3000P and Mx3005P

Agilent s Mx3000P and Mx3005P Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded

More information

Identifying the binding sites and regulatory targets of a transcription

Identifying the binding sites and regulatory targets of a transcription Model-based analysis of tiling-arrays for ChIP-chip W. Evan Johnson*, Wei Li*, Clifford A. Meyer*, Raphael Gottardo, Jason S. Carroll, Myles Brown, and X. Shirley Liu* *Department of Biostatistics and

More information

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

Gene Expression Analysis Superior Solutions for any Project

Gene Expression Analysis Superior Solutions for any Project Gene Expression Analysis Superior Solutions for any Project Find Your Perfect Match ArrayXS Global Array-to-Go Focussed Comprehensive: detect the whole transcriptome reliably Certified: discover exceptional

More information

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6 Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...

More information

Designing Complex Omics Experiments

Designing Complex Omics Experiments Designing Complex Omics Experiments Xiangqin Cui Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham 6/15/2015 Some slides are from previous lectures given by

More information

ImmGen microarray gene expression data: Data Generation and Quality Control pipeline.

ImmGen microarray gene expression data: Data Generation and Quality Control pipeline. ImmGen microarray gene expression data: Data Generation and Quality Control pipeline. Jeff Ericson*, Scott Davis*, Jon Lesh #, Melissa Howard #, Diane Mathis and Christophe Benoist Division of Immunology,

More information

A Data Warehouse for Multidimensional Gene Expression Analysis

A Data Warehouse for Multidimensional Gene Expression Analysis Leipzig Bioinformatics Working Paper No. 1 November 2004 A Data Warehouse for Multidimensional Gene Expression Analysis Data Sources Data Integration Database Data Warehouse Analysis and Interpretation

More information

University of Groningen

University of Groningen University of Groningen Evaluation of an Affymetrix High-density Oligonucleotide Microarray Platform as a Measurement System van den Heuvel, Edwin; Geeven, Geert; Bauerschmidt, Susanne; Polman, Jan E.M.

More information

Sort-seq under the hood: implications of design choices on largescale characterization of sequence-function relations

Sort-seq under the hood: implications of design choices on largescale characterization of sequence-function relations Sort-seq under the hood: implications of design choices on largescale characterization of sequence-function relations The Harvard community has made this article openly available. Please share how this

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

Quality assessment for short oligonucleotide microarray data

Quality assessment for short oligonucleotide microarray data Julia Brettschneider, François Collin, Benjamin M. Bolstad, Terence P. Speed Quality assessment for short oligonucleotide microarray data Quality of microarray gene expression data has emerged as a new

More information

Data Sheet. GeneChip Human Genome U133 Arrays

Data Sheet. GeneChip Human Genome U133 Arrays GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array

More information

DNA CHIPS- Technology and Utility

DNA CHIPS- Technology and Utility DNA CHIPS- Technology and Utility Yanal Alkuddsi Ph.D Student Dept. of Genetics and Plant Breeding University of Agricultural Sciences Dharwad, Karnataka, India, 580005 1.INTRODUCTION CONTENT 2.MICROARRAYS:

More information

RNA spike-in controls & analysis methods for trustworthy genome-scale measurements

RNA spike-in controls & analysis methods for trustworthy genome-scale measurements RNA spike-in controls & analysis methods for trustworthy genome-scale measurements Sarah A. Munro, Ph.D. Genome-Scale Measurements Group ABRF Meeting March 29, 2015 Overview External RNA Controls Consortium

More information

GEOsubmission. Alexandre Kuhn October 30, 2017

GEOsubmission. Alexandre Kuhn October 30, 2017 GEOsubmission Alexandre Kuhn (kuhnam@mail.nih.gov) October 30, 2017 1 Summary The goal of GEOsubmission is to ease the submission of microarray datasets to the GEO repository. It generates a single file

More information

Chromosome Analysis Suite 3.0 (ChAS 3.0)

Chromosome Analysis Suite 3.0 (ChAS 3.0) Chromosome Analysis Suite 3.0 (ChAS 3.0) FAQs related to CytoScan Cytogenetics Suite 1. What is required for processing and viewing CytoScan array CEL files? CytoScan array CEL files are processed and

More information

Importance of replication in microarray gene expression studies: Statistical methods and evidence from repetitive cdna hybridizations

Importance of replication in microarray gene expression studies: Statistical methods and evidence from repetitive cdna hybridizations Importance of replication in microarray gene expression studies: Statistical methods and evidence from repetitive cdna hybridizations Mei-Ling Ting Lee*, Frank C. Kuo, G. A. Whitmore, and Jeffrey Sklar

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Statistical issues with microarrays: processing and analysis

Statistical issues with microarrays: processing and analysis Statistical issues with microarrays: processing and analysis 265 Robert Nadon and Jennifer Shoemaker The study of gene expression with printed arrays and prefabricated chips is evolving from a qualitative

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Separation and Detection, Part

More information

Interpretation of Results. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010

Interpretation of Results. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 Interpretation of Results Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 Instrumentation Cepheid Smartcycler Training Diagnostic testing Equivalency testing for

More information

Immunome TM Protein Array

Immunome TM Protein Array Immunome TM Protein Array User Manual Last Revised, September 7 th 2016 Product code: 9PAH-IMM-1631 ISO 13485 & GLP Certified Tel: (Toll Free) 1-888-494-8555 or 770-729-2992; Fax: 770-206-2393 Web: www.raybiotech.com

More information

FirePlex mirna Assay. Multiplex microrna profiling from low sample inputs

FirePlex mirna Assay. Multiplex microrna profiling from low sample inputs FirePlex mirna Assay Multiplex microrna profiling from low sample inputs Abstract We introduce a new assay for multiplex microrna (mirna) discovery and verification that enables simultaneous profiling

More information

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

Design Microarray Probes

Design Microarray Probes Design Microarray Probes Erik S. Wright October 30, 2017 Contents 1 Introduction 1 2 Getting Started 1 2.1 Startup................................................ 1 2.2 Creating a Sequence Database....................................

More information

MADSCAN ONLINE version6.1 Tutorial for MicroArray Data Suite of Computed Analysis

MADSCAN ONLINE version6.1 Tutorial for MicroArray Data Suite of Computed Analysis CENTRE HOSPITALIER UNIVERSITAIRE DE NANTES MADSCAN ONLINE version6.1 Tutorial for MicroArray Data Suite of Computed Analysis * Nolwenn LE MEUR * Copyright 2005 Le Meur, N., Leger, J.J. All rights reserved

More information