Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies.
|
|
- Julie Morrison
- 6 years ago
- Views:
Transcription
1 Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies.
2 References Summaries of Affymetrix Genechip Probe Level Data, Irizarry et al., Nucleic Acids Research, 2003, Vol. 31, No. 4. Exploration, Normalization and Summaries of High Density Oligonucleotide Array Probe Level Data, Irizarry et al., A Model Based Background Adjustment for Oligonucleotide Expression Arrays, Wu, Irizarry et al., Johns Hopkins University, Dept. of Biostatistics
3 Affymetrix Genechips Each gene represented by probe pairs. Probe pairs are 3 biased. Probe Pair consists of Perfect Match (PM) and MisMatch (MM) probes. MM has altered middle (13th) base. Designed to measure non-specific binding (NSB).
4 Genechip Scanning RNA sample prepared, labelled and hybridised to chip. Chip fluorescently scanned. Gives a raw pixelated image -.DAT file. Grid used to separate pixels related to individual probes. Pixel intensities averaged to give single intensity for each probe -.CEL file. Probe level intensities combined for each probe set to give single intensity value for each gene.
5 Affymetrix MicroArray Suite (MAS) v4.0 Uses MM probes to correct for NSB. MAS4.0 used simple Average Difference method: 1 AvDiff A PM j A j MM j MM j 3 A is the subset of probes where d j PMisj within d 2,..., d J 1 SDs of the average of Excludes outliers, but not a robust averaging method.
6 Affymetrix MicroArray Suite (MAS) v5.0 Current method employed by Affymetrix. Weighted mean using one-step Tukey Biweight Estimate: signal log 1 Tukey Biweight log PM j CT j CTj is a quantity derived from MMj never larger than PMj. Weights each probe intensity based on it s distance from the mean. Robust average (insensitive to small changes from any assumptions made).
7 Tukey Biweight
8 Problems with Mis-Match data MM intensity levels are greater than PM intensity levels in ~1/3 of all probes. Suggests that MM probes measure actual signal, and not just NSB. Removal of MM results in negative signal values. Subtracting MM data will result in loss of interesting signal in many probes. Several methods have been proposed using only PM data.
9 Problems with Mis-Match data
10 Problems with MAS5.0 Loss of probe-level information. Background estimate may cause noise at low intensity levels due to subtraction of MM data.
11 Robust Multiarray Average (RMA) Subtraction of MM data corrects for NSB, but introduces noise. Want a method that gives positive intensity values. Normalising at probe level avoids the loss of information.
12 Robust Multiarray Average (RMA) 1) Background correction. 2) Normalization (across arrays). Probe level intensity calculation. 4) Probe set summarization. 3)
13 Robust Multiarray Average (RMA) PM data is combination of background and signal. B PM ijn Sijn PM ijn Assume strictly positive distribution for signal. Then background corrected signal is also positively distributed. Background correction performed on each array seperately.
14 Robust Multiarray Average (RMA) 1) 2) Background correction. Normalization (across arrays). 3) Probe level intensity calculation. 4) Probe set summarization.
15 Robust Multiarray Average (RMA) Normalises across all arrays to make all distributions the same. Quantile Normalization used to correct for array biases. Compares expression levels between arrays for various quantiles. Can view this on quantile-quantile plot. Protects against outliers.
16 Robust Multiarray Average (RMA) Background correction. Normalization (across arrays). 1) 2) 3) Probe level intensity calculation. 4) Probe set summarization.
17 Robust Multiarray Average (RMA) Linear model. Uses background corrected, normalised, log transformed probe intensities (Yijn). Yijn in jn ijn μin = Log scale expression level (RMA measure). αjn = Probe affinity affect. εijn = Independent identically distributed error term (with mean 0).
18 Robust Multiarray Average (RMA) Background correction. Normalization (across arrays). Probe level intensity calculation. 1) 2) 3) 4) Probe set summarization.
19 Robust Multiarray Average (RMA) Combine intensity values from the probes in the probe set to get a single intensity value for each gene. Uses Median Polishing. Each chip normalised to its median. Each gene normalised to its median. Repeated until medians converge. Maximum of 5 iterations to prevent infinate loops.
20 Robust Multiarray Average (RMA) Pre-Normalisation
21 Robust Multiarray Average (RMA) Post-Normalisation
22 GC-RMA Corrects for background noise as well as NSB. Probe affinity calculated using position dependant base effects: MM data adjusted based on probe affinity, then subtracted from PM. Does not lose MM data.
23 Advantages of RMA/GC-RMA Gives less false positives than MAS5.0. See less variance at lower expression levels than MAS5.0. Provides more consistent fold change estimates. Exclusion of MM data in RMA reduces noise, but loses information. Inclusion of adjusted MM data in GC-RMA reduces noise, and retains MM data.
24 Disadvantages of RMA/GC-RMA May hide real changes, especially at low expression levels (false negatives). Makes quality control after normalisation difficult. Normalisation assumes equal distribution which may hide biological changes.
25 Conclusions RMA is more precise than MAS5.0, but may result in false negatives at low expression levels. Useful for fold change analysis, but not for studying statistical significance. Makes quality control difficult. Ideal solution Use standard MAS5.0 techniques for quality control. Then go back and perform probe level normalisation on quality controlled genes.
Preprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
Preprocessing Affymetrix GeneChip Data Credit for some of today s materials: Ben Bolstad, Leslie Cope, Laurent Gautier, Terry Speed and Zhijin Wu Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
More informationIntroduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
More informationDNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationParameter Estimation for the Exponential-Normal Convolution Model
Parameter Estimation for the Exponential-Normal Convolution Model Monnie McGee & Zhongxue Chen cgee@smu.edu, zhongxue@smu.edu. Department of Statistical Science Southern Methodist University ENAR Spring
More informationSPH 247 Statistical Analysis of Laboratory Data
SPH 247 Statistical Analysis of Laboratory Data April 14, 2015 SPH 247 Statistical Analysis of Laboratory Data 1 Basic Design of Expression Arrays For each gene that is a target for the array, we have
More informationBioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis PART II: Genome Analysis Chapter 7. DNA Microarrays 7.1 Motivation 7.2 DNA Microarray History and current states 7.3 DNA Microarray Techniques
More informationExploration, normalization, and summaries of high density oligonucleotide array probe level data
Biostatistics (2003), 4, 2,pp. 249 264 Printed in Great Britain Exploration, normalization, and summaries of high density oligonucleotide array probe level data RAFAEL A. IRIZARRY Department of Biostatistics,
More informationWhat does PLIER really do?
What does PLIER really do? Terry M. Therneau Karla V. Ballman Technical Report #75 November 2005 Copyright 2005 Mayo Foundation 1 Abstract Motivation: Our goal was to understand why the PLIER algorithm
More informationHumboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture
Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization
More informationaffy: Built-in Processing Methods
affy: Built-in Processing Methods Ben Bolstad October 30, 2017 Contents 1 Introduction 2 2 Background methods 2 2.1 none...................................... 2 2.2 rma/rma2...................................
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationPredicting Microarray Signals by Physical Modeling. Josh Deutsch. University of California. Santa Cruz
Predicting Microarray Signals by Physical Modeling Josh Deutsch University of California Santa Cruz Predicting Microarray Signals by Physical Modeling p.1/39 Collaborators Shoudan Liang NASA Ames Onuttom
More informationWhat you still might want to know about microarrays. Brixen 2011 Wolfgang Huber EMBL
What you still might want to know about microarrays Brixen 2011 Wolfgang Huber EMBL Brief history Late 1980s: Lennon, Lehrach: cdnas spotted on nylon membranes 1990s: Affymetrix adapts microchip production
More informationADVANCED STATISTICAL METHODS FOR GENE EXPRESSION DATA
ADVANCED STATISTICAL METHODS FOR GENE EXPRESSION DATA Veera Baladandayuthapani & Kim-Anh Do University of Texas M.D. Anderson Cancer Center Houston, Texas, USA veera@mdanderson.org Course Website: http://odin.mdacc.tmc.edu/
More informationDescription of Logit-t: Detecting Differentially Expressed Genes Using Probe-Level Data
Description of Logit-t: Detecting Differentially Expressed Genes Using Probe-Level Data Tobias Guennel October 22, 2008 Contents 1 Introduction 2 2 What s new in this version 3 3 Preparing data for use
More informationProbe-Level Data Analysis of Affymetrix GeneChip Expression Data using Open-source Software Ben Bolstad
Probe-Level Data Analysis of Affymetrix GeneChip Expression Data using Open-source Software Ben Bolstad bmb@bmbolstad.com http://bmbolstad.com August 7, 2006 1 Outline Introduction to probe-level data
More informationGene Expression Data Analysis (I)
Gene Expression Data Analysis (I) Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Bioinformatics tasks Biological question Experiment design Microarray experiment
More informationGene Signal Estimates from Exon Arrays
Gene Signal Estimates from Exon Arrays I. Introduction: With exon arrays like the GeneChip Human Exon 1.0 ST Array, researchers can examine the transcriptional profile of an entire gene (Figure 1). Being
More informationOligonucleotide microarray data are not normally distributed
Oligonucleotide microarray data are not normally distributed Johanna Hardin Jason Wilson John Kloke Abstract Novel techniques for analyzing microarray data are constantly being developed. Though many of
More informationExploration and Analysis of DNA Microarray Data
Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate
More informationAnalysis of a Tiling Regulation Study in Partek Genomics Suite 6.6
Analysis of a Tiling Regulation Study in Partek Genomics Suite 6.6 The example data set used in this tutorial consists of 6 technical replicates from the same human cell line, 3 are SP1 treated, and 3
More informationComparative analysis of microarray normalization procedures: effects on reverse engineering gene networks
BIOINFORMATICS Vol. 23 ISMB/ECCB 2007, pages i282 i288 doi:10.1093/bioinformatics/btm201 Comparative analysis of microarray normalization procedures: effects on reverse engineering gene networks Wei Keat
More informationPhilippe Hupé 1,2. The R User Conference 2009 Rennes
A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationA GENOTYPE CALLING ALGORITHM FOR AFFYMETRIX SNP ARRAYS
Bioinformatics Advance Access published November 2, 2005 The Author (2005). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org
More informationClass Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1
This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationAnalyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek
Analyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek This example data set consists of 20 selected HapMap samples, representing 10 females and 10 males, drawn from a mixed ethnic population of
More informationBioconductor tools for microarray analysis Preprocessing : normalization & error models. Wolfgang Huber EMBL
Bioconductor tools for microarray analysis Preprocessing : normalization & error models Wolfgang Huber EMBL An international open source and open development software project for the analysis of genomic
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationHELP Microarray Analytical Tools
HELP Microarray Analytical Tools Reid F. Thompson October 30, 2017 Contents 1 Introduction 2 2 Changes for HELP in current BioC release 3 3 Data import and Design information 4 3.1 Pair files and probe-level
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationMulCom: a Multiple Comparison statistical test for microarray data in Bioconductor.
MulCom: a Multiple Comparison statistical test for microarray data in Bioconductor. Claudio Isella, Tommaso Renzulli, Davide Corà and Enzo Medico May 3, 2016 Abstract Many microarray experiments compare
More informationTechnical Note. Performance Review of the GeneChip AutoLoader for the Affymetrix GeneChip Scanner Introduction
GeneChip AutoLoader AFFYMETRIX PRODUCT FAMILY > > Technical Note Performance Review of the GeneChip AutoLoader for the Affymetrix GeneChip ner 3000 Designed for use with the GeneChip ner 3000, the GeneChip
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationUse of DNA microarrays, wherein the expression levels of
Modeling of DNA microarray data by using physical properties of hybridization G. A. Held*, G. Grinstein, and Y. Tu IBM Thomas J. Watson Research Center, Yorktown Heights, NY 10598 Communicated by Charles
More informationData Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds. Overview. Data Analysis Tutorial
Data Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds Overview In order for accuracy and precision to be optimal, the assay must be properly evaluated and a few
More informationMAOSA: A new procedure for detection of differential gene expression
Statistical Methodology 3 (2006) 42 54 www.elsevier.com/locate/stamet MAOSA: A new procedure for detection of differential gene expression Greg Dyson a,,c.f.jeffwu b a Department of Human Genetics, University
More informationCustom Design and Analysis of High-Density Oligonucleotide Bacterial Tiling Microarrays
Custom Design and Analysis of High-Density Oligonucleotide Bacterial Tiling Microarrays Gard O. S. Thomassen 1,2, Alexander D. Rowe 2, Karin Lagesen 2, Jessica M. Lindvall 3, Torbjørn Rognes 2,3 * 1 Centre
More informationGuidelines for setting up microrna profiling experiments v2.0
Guidelines for setting up microrna profiling experiments v2.0 December 2010 Table of contents 2 Experimental setup................................................ 3 Single-color experiments........................................
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationMentor: Dr. Bino John
MAT Shiksha Mantri Mentor: Dr. Bino John Model-based Analysis y of Tiling-arrays g y for ChIP-chip X. Shirley Liu et al., PNAS (2006) vol. 103 no. 33 12457 12462 Tiling Arrays Subtype of microarray chips
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationIntroduction to microarrays. Overview The analysis process Limitations Extensions (NGS)
Introduction to microarrays Overview The analysis process Limitations Extensions (NGS) Outline An overview (a review) of microarrays Experiments with microarrays The data analysis process Microarray limitations
More informationA comparative analytical assay of gene regulatory networks inferred using microarray and RNA-seq datasets
www.bioinformation.net Volume 12(6) Hypothesis A comparative analytical assay of gene regulatory networks inferred using microarray and RNA-seq datasets Fereshteh Izadi *, Hamid Najafi Zarrini, Ghaffar
More informationComparison of mrna Gene Expression Analysis between Quantitative-real time PCR Assay and DNA Microarray Based Assay
2011 International Conference on Agricultural and Natural Resources Engineering Advances in Biomedical Engineering, Vol.3-5 Comparison of mrna Gene Expression Analysis between Quantitative-real time PCR
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationDNA Microarray Data Analysis and Mining: Affymetrix Software Package and In-House Complementary Packages
University of New Orleans ScholarWorks@UNO University of New Orleans Theses and Dissertations Dissertations and Theses 12-19-2003 DNA Microarray Data Analysis and Mining: Affymetrix Software Package and
More informationNew Stringent Two-Color Gene Expression Workflow Enables More Accurate and Reproducible Microarray Data
Application Note GENOMICS INFORMATICS PROTEOMICS METABOLOMICS A T C T GATCCTTC T G AAC GGAAC T AATTTC AA G AATCTGATCCTTG AACTACCTTCCAAGGTG New Stringent Two-Color Gene Expression Workflow Enables More
More informationData Mining Whole-Genome Expression Profiling
Data Mining Whole-Genome Expression Profiling Internship Presentation Computational Biosciences Arizona State University Advisors: Dr. Seth Dobrin Dr. Dietrich Stephan Intern: Shruti Lal Outline Introduction
More informationTRANSCRIPTOME ANALYSIS IN PRETERM INFANTS DEVELOPING BRONCHOPULMONARY DYSPLASIA
TRANSCRIPTOME ANALYSIS IN PRETERM INFANTS DEVELOPING BRONCHOPULMONARY DYSPLASIA Data processing and statistical analysis of microarray data Inauguraldissertation zur Erlangung des Grades eines Doktors
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationCS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer
CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer T. M. Murali January 31, 2006 Innovative Application of Hierarchical Clustering A module map showing conditional
More informationDNA Microarray Experiments: Biological and Technological Aspects
DNA Microarray Experiments: Biological and Technological Aspects Danh V. Nguyen 1, A. Bulak Arpat 2, Naisyin Wang 1, and Raymond J. Carroll 1 1 Department of Statistics, Texas A&M University, College Station,
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationADNA barcode is a short DNA sequence that uniquely
Design of 240,000 orthogonal 25mer DNA barcode probes Qikai Xu a, Michael R. Schlabach a, Gregory J. Hannon b, and Stephen J. Elledge a,1 a Department of Genetics, Center for Genetics and Genomics, Brigham
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationUNIVERSITY OF TORINO. Department of Clinical and Biological Sciences. Doctoral School in Complex Systems in Medicine and Life Sciences
UNIVERSITY OF TORINO Department of Clinical and Biological Sciences Doctoral School in Complex Systems in Medicine and Life Sciences Ph.D. in COMPLEX SYSTEMS IN POST-GENOMIC BIOLOGY XXIII cycle Computational
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationA Comparative Performance Survey on Microarray Data Analysis Techniques for Colon Cancer Classification
International Journal of Computer Applications (975 8887) Volume 93 No.17, May 214 A Comparative Performance Survey on Microarray Data Analysis Techniques for Colon Cancer Classification Kshipra Chitode
More informationBauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
More informationIdentifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer
Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Nagwan M. Abdel Samee 1, Nahed H. Solouma 2, Mahmoud Elhefnawy 3, Abdalla S. Ahmed 4, Yasser M. Kadah 5 1 Computer Engineering
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationIdentifying the binding sites and regulatory targets of a transcription
Model-based analysis of tiling-arrays for ChIP-chip W. Evan Johnson*, Wei Li*, Clifford A. Meyer*, Raphael Gottardo, Jason S. Carroll, Myles Brown, and X. Shirley Liu* *Department of Biostatistics and
More informationElectrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008
Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationGene Expression Analysis Superior Solutions for any Project
Gene Expression Analysis Superior Solutions for any Project Find Your Perfect Match ArrayXS Global Array-to-Go Focussed Comprehensive: detect the whole transcriptome reliably Certified: discover exceptional
More informationMicroarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6
Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...
More informationDesigning Complex Omics Experiments
Designing Complex Omics Experiments Xiangqin Cui Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham 6/15/2015 Some slides are from previous lectures given by
More informationImmGen microarray gene expression data: Data Generation and Quality Control pipeline.
ImmGen microarray gene expression data: Data Generation and Quality Control pipeline. Jeff Ericson*, Scott Davis*, Jon Lesh #, Melissa Howard #, Diane Mathis and Christophe Benoist Division of Immunology,
More informationA Data Warehouse for Multidimensional Gene Expression Analysis
Leipzig Bioinformatics Working Paper No. 1 November 2004 A Data Warehouse for Multidimensional Gene Expression Analysis Data Sources Data Integration Database Data Warehouse Analysis and Interpretation
More informationUniversity of Groningen
University of Groningen Evaluation of an Affymetrix High-density Oligonucleotide Microarray Platform as a Measurement System van den Heuvel, Edwin; Geeven, Geert; Bauerschmidt, Susanne; Polman, Jan E.M.
More informationSort-seq under the hood: implications of design choices on largescale characterization of sequence-function relations
Sort-seq under the hood: implications of design choices on largescale characterization of sequence-function relations The Harvard community has made this article openly available. Please share how this
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationQuality assessment for short oligonucleotide microarray data
Julia Brettschneider, François Collin, Benjamin M. Bolstad, Terence P. Speed Quality assessment for short oligonucleotide microarray data Quality of microarray gene expression data has emerged as a new
More informationData Sheet. GeneChip Human Genome U133 Arrays
GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array
More informationDNA CHIPS- Technology and Utility
DNA CHIPS- Technology and Utility Yanal Alkuddsi Ph.D Student Dept. of Genetics and Plant Breeding University of Agricultural Sciences Dharwad, Karnataka, India, 580005 1.INTRODUCTION CONTENT 2.MICROARRAYS:
More informationRNA spike-in controls & analysis methods for trustworthy genome-scale measurements
RNA spike-in controls & analysis methods for trustworthy genome-scale measurements Sarah A. Munro, Ph.D. Genome-Scale Measurements Group ABRF Meeting March 29, 2015 Overview External RNA Controls Consortium
More informationGEOsubmission. Alexandre Kuhn October 30, 2017
GEOsubmission Alexandre Kuhn (kuhnam@mail.nih.gov) October 30, 2017 1 Summary The goal of GEOsubmission is to ease the submission of microarray datasets to the GEO repository. It generates a single file
More informationChromosome Analysis Suite 3.0 (ChAS 3.0)
Chromosome Analysis Suite 3.0 (ChAS 3.0) FAQs related to CytoScan Cytogenetics Suite 1. What is required for processing and viewing CytoScan array CEL files? CytoScan array CEL files are processed and
More informationImportance of replication in microarray gene expression studies: Statistical methods and evidence from repetitive cdna hybridizations
Importance of replication in microarray gene expression studies: Statistical methods and evidence from repetitive cdna hybridizations Mei-Ling Ting Lee*, Frank C. Kuo, G. A. Whitmore, and Jeffrey Sklar
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationStatistical issues with microarrays: processing and analysis
Statistical issues with microarrays: processing and analysis 265 Robert Nadon and Jennifer Shoemaker The study of gene expression with printed arrays and prefabricated chips is evolving from a qualitative
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Separation and Detection, Part
More informationInterpretation of Results. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010
Interpretation of Results Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 Instrumentation Cepheid Smartcycler Training Diagnostic testing Equivalency testing for
More informationImmunome TM Protein Array
Immunome TM Protein Array User Manual Last Revised, September 7 th 2016 Product code: 9PAH-IMM-1631 ISO 13485 & GLP Certified Tel: (Toll Free) 1-888-494-8555 or 770-729-2992; Fax: 770-206-2393 Web: www.raybiotech.com
More informationFirePlex mirna Assay. Multiplex microrna profiling from low sample inputs
FirePlex mirna Assay Multiplex microrna profiling from low sample inputs Abstract We introduce a new assay for multiplex microrna (mirna) discovery and verification that enables simultaneous profiling
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationDesign Microarray Probes
Design Microarray Probes Erik S. Wright October 30, 2017 Contents 1 Introduction 1 2 Getting Started 1 2.1 Startup................................................ 1 2.2 Creating a Sequence Database....................................
More informationMADSCAN ONLINE version6.1 Tutorial for MicroArray Data Suite of Computed Analysis
CENTRE HOSPITALIER UNIVERSITAIRE DE NANTES MADSCAN ONLINE version6.1 Tutorial for MicroArray Data Suite of Computed Analysis * Nolwenn LE MEUR * Copyright 2005 Le Meur, N., Leger, J.J. All rights reserved
More information