measuring gene expression December 5, 2017
|
|
- Noel Gilbert
- 6 years ago
- Views:
Transcription
1 measuring gene expression December 5, 2017
2
3 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA do not encode proteins
4 RNA encodes proteins
5
6 Early studies indicated that gene lengths could sometimes be much greater than mrna lengths
7 Early studies indicated that gene lengths could sometimes be much greater than mrna lengths processed transcript (mrna) unprocessed transcript (pre-mrna)
8 eukaryotic gene structure was quite a surprise!
9 Enhancer Promoter exon intron exon intron exon polya signal 5 UTR 3 UTR CAAT TATA 5 3 Start point for transcription Start point for Translation (AUG) Terminator for translation (UGA, UAA, UAG)
10 Enhancer Promoter exon intron exon intron exon polya signal 5 UTR 3 UTR CAAT TATA 5 transcription 3 Pre-mRNA
11 Enhancer Promoter exon intron exon intron exon polya signal 5 UTR 3 UTR CAAT TATA 5 transcription 3 Pre-mRNA mrna splicing
12 Enhancer Promoter exon intron exon intron exon polya signal 5 UTR 3 UTR CAAT TATA 5 transcription 3 Pre-mRNA mrna splicing translation
13 Intervening Sequences (introns): how does the cell get rid of them? Splicing!!! Highly conserved ribonucleoprotein complex recognizes intron/exon junctions and guides intron excision. This process is responsible for much of the diversity of proteins, and is closely regulated.
14 Intervening Sequences (introns): what are they good for? When introducing a sequence into a cell system for overexpression, things work better if the sequence has an intron. nonsense mediated decay requires introns may be a buffer for mutation or a way to shuffle protein domains creating variation by alternative splicing
15 Alternative Splicing
16 Alternative Splicing
17 gene expression analysis what genomic regions are being transcribed? which transcripts are being made, from those regions? what is the rate/level of transcription from a region? does expression from those regions change under certain conditions? remember, though, that gene expression!= cell function
18 challenges in studying gene expression transcript abundance mapping annotation quantitation comparing across experiments technical variability biological variability
19 annotation how can we find genes? observe RNA product observe protein product orthology (reciprocal best hit or similar method) de novo prediction
20 laboratory methods abundance measurement variety of transcripts throughput protein methods quantitative low low Northern blot qualitative predetermined low cdna subtraction poorly quantitative comparative low differential display poorly quantitative comparative low ESTs/cDNA sequencing qualitative moderate moderate SAGE quantitative moderate moderate RT-PCR quantitative predetermined moderate microarray quantitative predetermined high RNAseq quantitative high high
21 SAGE (serial analysis of gene expression) generate a 9-10bp sequence tag for each transcript, concatenate tags and sequence them. Tags will be near 3 end of genes, increasing the specificity of the method.
22
23 SAGE (serial analysis of gene expression) key points: ditags should be unique, so multiple observations of the same ditag are assumed to be PCR duplicates. Identification of tagged genes relies on having good annotation.
24 gene expression analysis by microarray
25 gene expression analysis by microarray ~100M oligonucleotides fixed to a microscope slide. Labeled cdna is hybridized to the array and scanned. Because the background isn t consistent, signal intensity is typically defined by the foreground:background ratio for each spot B F
26 gene expression analysis by microarray advantages: relatively inexpensive (lots of replicates possible), statistical properties are well-described disadvantages: requires high input quantity, limited dynamic range, limited range of genomic targets, typically not useful for spliceoform detection
27 gene expression analysis by sequencing (RNAseq) advantages: allows very, very low input quantity, excellent dynamic range, genomic targets are not preselected, theoretically extraordinarily sensitive for splice site detection disadvantages: expensive, statistical properties not at all clear
28 RNAseq total RNA (rrna, mrna, trna, microrna etc) library preparation and sequencing rrna depletion strand specificity paired end vs single end read length coverage mapping splice-aware with or without annotation transcript count assignment, normalization compare transcript abundance between samples
29
30 alignment approaches map to transcriptome (RSEM and others) splice-aware alignment (TopHat, STAR and others) transcriptome assembly kmer/word counting without alignment (Sailfish and others) segment genome by differentially expressed regions (derfinder)
31 RNAseq alignment challenge reads are not contiguous with the reference genome transcript genome this read does not map contiguously to the reference genome paired ends spanning junctions may map very far apart on reference genome
32 RNAseq and alternative splicing some reads can be unambiguously assigned to a transcript, but others cannot.
33 Used by TCGA. RNAseq by expectation maximization Can use a reference genome with or without annotation. In either mode, multimapping reads are explicitly considered and the transcript abundance is derived at every position using a maximum likelihood model. Finally, Bayesian estimates of transcript abundance are provided. (and often paired with EBSeq)
34 EBSeq
35 EBSeq
36 uncertainty is proportional to the number of spliceoforms
37 TopHat: splice-aware aligner
38
39 TopHat
40 splice-aware alignment: STAR
41 splice-aware alignment: STAR
42 used in TCGA as second processing step
43
44
45
46 Scripture: hybrid alignment/transcriptome assembly
47
48
49
50 HMM-based method: segment genomic regions according to sequencing coverage, then estimate abundance from observations (a mixture of background signal, measurement error, and true signal) Analyses are done across multiple samples, without considering annotation.
51
52 steps in RNAseq analysis alignment and transcript assignment quantitation comparison among experiments (differential expression)
53 normalization when comparing two RNAseq experiments, read depth is a critical factor (nonbiological effect). Options for normalizing for read depth: 1) Reads per kilobase per million reads (RPKM) normalizes for read depth and gene size 2) trimmed mean of M-values (TMM) 3) DESeq size factor 4) quantile-based normalizations such as upper quartile normalization
54 upper quartile normalization Table 1 How do you know whether the increased counts in condition 2 for the first gene reflect higher transcription? it s possible that there were just more reads for this experiment. gene condition 1 condition 2 ENST ENST ENST ENST ENST ENST ENST ENST idea: gene expression measurements are more robust for highly expressed genes. Find the normalization factor for these genes and apply it to all genes measured. ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST
55 upper quartile normalization remove genes that have no counts in all experiments rank genes by expression, for each experiment separately identify the gene at the 75th percentile in each experiment. This will be the size factor for that experiment. divide expression levels for all genes by the expression of the gene at the 75th percentile, for each experiment can multiply by mean expression level of top quartile to restore counts to larger numbers if needed
56 sorted normalized gene condition 1 condition2 ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST gene condition 1 condition 2 ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST
57 normalization other nonbiological factors include gene length and GC content. These are gene-specific and are often assumed to cancel out if comparisons are done gene by gene.
58
59 normalization: GC content doesn t cancel out
60 normalization: BASP1 isoform levels vary by center!?
61 methods for comparing expression levels Let s assume that RNAseq reads can be modeled with a Poisson distribution (drawing randomly from all possible RNA fragments) Then, for each gene, the mean expression is measured across replicates, and the variance is set to be equal to the mean (the lambda parameter). Comparing the expression of the gene between two conditions is then fairly straightforward.
62 methods for comparing expression levels Problem: the variance in gene expression is usually much greater than the mean (overdispersion) Solution: Use a negative binomial model. This can be derived as a gamma Poisson mixture model, assuming that technical replicates follow a Poisson distribution, and biological replicates follow a gamma distribution (accounts for overdispersion) DESeq and DESeq2 are excellent implementations of this method.
63 methods for comparing expression levels Many other methods exist, including Bayesian approaches, beta binomial estimation, and nonparametric. Different methods are often optimized for particular types of data.
measuring gene expression December 11, 2018
measuring gene expression December 11, 2018 Intervening Sequences (introns): how does the cell get rid of them? Splicing!!! Highly conserved ribonucleoprotein complex recognizes intron/exon junctions and
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationTranscriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationRNA-Seq Analysis. Simon Andrews, Laura v
RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+
More informationAnalysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationRNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)
RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their
More information1. Introduction Gene regulation Genomics and genome analyses
1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationMODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationDeep sequencing of transcriptomes
1 / 40 Deep sequencing of transcriptomes An introduction to RNA-seq Michael Dondrup UNI BCCS 2. november 2010 2 / 40 Transcriptomics by Ultra-Fast Sequencing Microarrays have been the primary transcriptomics
More informationSequence Analysis 2RNA-Seq
Sequence Analysis 2RNA-Seq Lecture 10 2/21/2018 Instructor : Kritika Karri kkarri@bu.edu Transcriptome Entire set of RNA transcripts in a given cell for a specific developmental stage or physiological
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationAnalysis of RNA-seq Data. Bernard Pereira
Analysis of RNA-seq Data Bernard Pereira The many faces of RNA-seq Applications Discovery Find new transcripts Find transcript boundaries Find splice junctions Comparison Given samples from different experimental
More informationAnalysis of RNA-seq Data
Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationAn introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy
An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular
More informationIntroduction of RNA-Seq Analysis
Introduction of RNA-Seq Analysis Jiang Li, MS Bioinformatics System Engineer I Center for Quantitative Sciences(CQS) Vanderbilt University September 21, 2012 Goal of this talk 1. Act as a practical resource
More informationRNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
More informationAnalysis of Biological Sequences SPH
Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationAnalysis of Biological Sequences SPH
Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,
More informationWheat CAP Gene Expression with RNA-Seq
Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationFinding Genes with Genomics Technologies
PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License
More informationRNA-Seq de novo assembly training
RNA-Seq de novo assembly training Training session aims Give you some keys elements to look at during read quality check. Transcriptome assembly is not completely a strait forward process : Multiple strategies
More informationRNA
RNA sequencing Michael Inouye Baker Heart and Diabetes Institute Univ of Melbourne / Monash Univ Summer Institute in Statistical Genetics 2017 Integrative Genomics Module Seattle @minouye271 www.inouyelab.org
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationStatistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies
Statistical Genomics and Bioinformatics Workshop: Genetic Association and RNA-Seq Studies RNA Seq and Differential Expression Analysis Brooke L. Fridley, PhD University of Kansas Medical Center 1 Next-generation
More informationExperimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis
Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationHigh performance sequencing and gene expression quantification
High performance sequencing and gene expression quantification Ana Conesa Genomics of Gene Expression Lab Centro de Investigaciones Príncipe Felipe Valencia aconesa@cipf.es Next Generation Sequencing NGS
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationSO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop
More informationless sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput
Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationPrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationRNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More information9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationExperimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
More informationAssessing De-Novo Transcriptome Assemblies
Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sortilin 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORT1 Human This gene encodes a protein that is a multi-ligand type-1
More informationRNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
More informationIntro to RNA-seq. July 13, 2015
Intro to RNA-seq July 13, 2015 Goal of the course To be able to effectively design, and interpret genomic studies of gene expression. We will focus on RNA-seq, but the class will provide a foothold into
More informationGRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION
GRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION Do Now 1. What was the DNA template for this mrna: 5 -A-A-C-G-U-3? (Write it 5 to 3 ) 2. State the Central Dogma of biology. 3. Name 3 differences
More informationSingle-Cell Whole Transcriptome Profiling With the SOLiD. System
APPLICATION NOTE Single-Cell Whole Transcriptome Profiling Single-Cell Whole Transcriptome Profiling With the SOLiD System Introduction The ability to study the expression patterns of an individual cell
More informationMODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
More informationComputational & Quantitative Biology Lecture 6 RNA Sequencing
Peter A. Sims Dept. of Systems Biology Dept. of Biochemistry & Molecular Biophysics Sulzberger Columbia Genome Center October 27, 2014 Computational & Quantitative Biology Lecture 6 RNA Sequencing We Have
More informationSCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318
SCBC203 Gene Expression Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 Rutaiwan.toh@mahidol.ac.th 1 Gene Expression Gene expression is a process where by the genetic
More informationGenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs
Gene Finding GenBank Growth GenBank Growth In 2003 ~ 31 million sequences ~ 37 billion base pairs GenBank: Exponential Growth Growth of GenBank in billions of base pairs from release 3 in April of 1994
More informationThe Central Dogma. DNA makes RNA makes Proteins
The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationApplications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
More informationBackground Wikipedia Lee and Mahadavan, JCB, 2009 History (Platform Comparison) P Park, Nature Review Genetics, 2009 P Park, Nature Reviews Genetics, 2009 Rozowsky et al., Nature Biotechnology, 2009
More informationProtein Synthesis ~Biology AP~
Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationAnalyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationAnalysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)
Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationDavid M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis
David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis Outline RNA-Seq for differential expression analysis Statistical methods for RNA-Seq: Structure
More informationRNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
More informationSequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq
Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationPrimePCR Assay Validation Report
Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationRNA-Seq analysis workshop
RNA-Seq analysis workshop Zhangjun Fei Boyce Thompson Institute for Plant Research USDA Robert W. Holley Center for Agriculture and Health Cornell University Outline Background of RNA-Seq Application of
More informationIntroduction to RNAseq Analysis. Milena Kraus Apr 18, 2016
Introduction to RNAseq Analysis Milena Kraus Apr 18, 2016 Agenda What is RNA sequencing used for? 1. Biological background 2. From wet lab sample to transcriptome a. Experimental procedure b. Raw data
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationYou are genetically unique
BNF 5106 - Lecture 1 Genetics, Genes, Genetic codes, and Mutations You are genetically unique Since each parent has 23 pairs of chromosomes, the probability that each parent gives twice the same chromosomes
More informationExam 2 BIO200, Winter 2012
Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More information