Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Size: px
Start display at page:

Download "Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)"

Transcription

1 Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on agarose gels and after transfer to a nitrocellulose membranes probing with radioactively labeled DNA corresponding to gene/sequence of interest. Hybridization of the labeled DNA with mrna is recognized via radioactive detection (i.e. autoradiography). The band position provides information about message size and its intensity provides an estimate of the level of expression. Analysis of various samples collected at different time points or tissue/organs provides information on the developmental regulation of expression. Main problems with Northern analysis: Slow and laborious to perform Not applicable to high throughput genomics scale analysis Microarrays Microarrays are physically ordered sets of DNA molecules Each DNA molecule is placed onto the array at a precisely defined location Allow assay of thousands of genes/sequences simultaneously, quickly and efficiently Microarrays analysis was developed in response to the availability of large and expanding databases of anonymous sequences (mostly cdna and ESTs). Microarray analysis provides information on the genes pattern of expression as a function of time, physiological treatment, the tissue topology and histology in a massively-parallel manner. Two basic types of microarrays Frequently composed of EST library clones Transcription profiling (Expression analysis) Oligonucleotide arrays Also called DNA Chips 10-mer sequences synthesized in situ Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Robotically spoted cdnas in the form of an arrayed grid onto a microscope slide. The spots are spaced at microscopic ( micron) intervals and have an initial volume of about 1-5 nl. Method of spotting Precision positioning robot, carrying printing quill(s)

2 Probes and the printing process print head microtiter plates slides (100) A DNA microarray is a solid surface containing a number of different DNA molecules These molecules (termed probes ) are individually printed onto the solid surface, using robotic techniques The individual array elements are circles, having diameters of about 100 µm, and spaced at center-to-center distances of about 180 µm This means a standard glass slide can contain as many as 25,00 different elements

3 The microarray probes are produced by PCR amplification either of different inserts from cdna libraries or genomic DNA High throughput methods are needed for the amplification and purification procedures, to ensure quality control and to keep track of different amplicons Alternatively, synthetic oligonucleotide sequences can be deposited on the surface Oligonucleotide arrays (DNA Chips) A DNA chip is a solid surface, on which are immobilized a large number of different DNA molecules The molecules are produced by step wise synthesis in situ Two companies have competing methods: Affymetrix using photolithographic techniques Agilent using modified ink-jet deposition technologies Microarray analysis DNA microarrays and DNA chips are analyzed by hybridization, using fluorescent targets produced from mrna extracted from the tissue, at a time point and condition of interest. The mrna molecules are typically extracted pair-wise from two different tissues, corresponding to the treatment and the control. The mrnas are separately converted into fluorescent molecules by reverse-transcription in the presence of two different fluorochromes (Cy3 and Cy5). The targets are mixed and hybridized to the arrays. The intensities of the hybridization signals are then measured. The hybridiztion is done at high stringency, and the slide is then scanned at the two fluorescent emission wavelengths to measure the fluorescence intensities in the different spots The high sensitivity results from small hybridization volume, so that you can employ high target concentration. This exceeds the concentration typically used in Northern blots by about This means you can potentially detect nearly all cellular transcripts. The high specificity results from use of long hybridization targets, and stringent hybridization and wash conditions. No detectable cross-hybridization is observed between closely related members of gene families (>70% nucleotide identity over long regions). Microarrays therefore provide a means to globally analyze the concentrations of different RNA within cells.

4 Arabidopsis thaliana microarray: >18,000 EST elements Considerations when working with microarrays: Choice of format Microarray printing Microarray hybridization Microarray scanning Data analysis and archiving Cy3 image Extract RNA from cells under first condition Prepare cdna in the presence of Cy3 dutp Extract RNA from cells under second condition (control) Prepare cdna in the presence of Cy5 dutp Mix fluorescent cdnas, hybridize to arrays and scan image. Cy5 image

5 Microarray analysis The intensity values for the two channels (Cy3 and Cy5) are determined and the values exported to spreadsheets. Massively-parllel global analysis of gene expression changes becomes possible. In statistics, traditional paradigm is a few variables and many replicates. With microarrays, you have many variables and few replicates. Analysis of massivelyparallel information is very difficult to address. Clustering techniques can be used to infer functions of unknown genes, and to define hierarchical patterns of gene regulation. Analyzing microarray data Microarray based results need to be data-based and made widely available Standardization- how to construct a fingerprint record again which to compare new array data Need for community-wide standards and controls Need to create a structured controlled vocabulary for microarray data Need for open systems architecture A schematic representation of six components of a microarray experiment (MIAME Standards).. Minimum information about a microarray experiment (MIAME) Brazma et al Minimum information about a microarray experiment (MIAME) toward standards for microarray data. Nature Genetics 29:

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

DNA Microarray Technology

DNA Microarray Technology 2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from

More information

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Clones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization.

Clones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization. Terminologies Reporter: the nucleotide sequence present in a particular location on the array (a.k.a. probe) Feature: the location of a reporter on the array Composite sequence: a set of reporters used

More information

DNA Microarrays and Clustering of Gene Expression Data

DNA Microarrays and Clustering of Gene Expression Data DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

Moc/Bio and Nano/Micro Lee and Stowell

Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Methods for Working with DNA and RNA

Methods for Working with DNA and RNA Methods for Working with DNA and RNA 1. Gel electrophoresis A. Materials: agarose (large DNAs) vs. acrylamide (high resolution, DNA sequencing) B. Separated by its sieving property and charge: both are

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations

More information

Gene expression profiling experiments:

Gene expression profiling experiments: Gene expression profiling experiments: Problems, pitfalls, and solutions. Heli Borg The Alternatives in Microarray Experiments bacteria - eucaryots non poly(a) + - poly(a) + oligonucleotide Affymetrix

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Then, we went on to discuss genome expression and described: Microarrays

Then, we went on to discuss genome expression and described: Microarrays In the previous lecture, we have discussed: - classical sequencing methods - newer authomatic sequencing methods - solid-phase parallel sequencing - Next Generation mass-sequencing methods Then, we went

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Introduction to DNA microarrays. DTU - January Hanne Jarmer

Introduction to DNA microarrays. DTU - January Hanne Jarmer Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go Microarrays - The Concept Measure

More information

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU. Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Gene expression. What is gene expression?

Gene expression. What is gene expression? Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying

More information

Computing with large data sets

Computing with large data sets Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places

More information

Soybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms

Soybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing

More information

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence

More information

Chapter 20 DNA Technology & Genomics. If we can, should we?

Chapter 20 DNA Technology & Genomics. If we can, should we? Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant

More information

Microarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation

Microarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this

More information

7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes

7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect

More information

Chapter 20 Biotechnology

Chapter 20 Biotechnology Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the

More information

Lecture 22 Eukaryotic Genes and Genomes III

Lecture 22 Eukaryotic Genes and Genomes III Lecture 22 Eukaryotic Genes and Genomes III In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand full of genes.

More information

MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE

MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes? 2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics

More information

Microarrays & Gene Expression Analysis

Microarrays & Gene Expression Analysis Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Outline. Array platform considerations: Comparison between the technologies available in microarrays

Outline. Array platform considerations: Comparison between the technologies available in microarrays Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

7.03, 2006, Lecture 23 Eukaryotic Genes and Genomes IV

7.03, 2006, Lecture 23 Eukaryotic Genes and Genomes IV 1 Fall 2006 7.03 7.03, 2006, Lecture 23 Eukaryotic Genes and Genomes IV In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that

More information

7.05, 2005, Lecture 23 Eukaryotic Genes and Genomes IV

7.05, 2005, Lecture 23 Eukaryotic Genes and Genomes IV 7.05, 2005, Lecture 23 Eukaryotic Genes and Genomes IV In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Microarrays The technology

Microarrays The technology Microarrays The technology Goal Goal: To measure the amount of a specific (known) DNA molecule in parallel. In parallel : do this for thousands or millions of molecules simultaneously. Main components

More information

What is a microarray

What is a microarray DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective

More information

An Introduction to printing spotted microarrays

An Introduction to printing spotted microarrays http://www.flychip.org.uk/printingintroduction.php An Introduction to printing spotted microarrays Overview Microarrays are typically produced by transferring gene or transcript specific PCR amplified

More information

Gene expression analysis: Introduction to microarrays

Gene expression analysis: Introduction to microarrays Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is

More information

PETER PAZMANY CATHOLIC UNIVERSITY Consortium members SEMMELWEIS UNIVERSITY, DIALOG CAMPUS PUBLISHER

PETER PAZMANY CATHOLIC UNIVERSITY Consortium members SEMMELWEIS UNIVERSITY, DIALOG CAMPUS PUBLISHER PETER PAZMANY CATHOLIC UNIVERSITY SEMMELWEIS UNIVERSITY Development of Complex Curricula for Molecular Bionics and Infobionics Programs within a consortial* framework** Consortium leader PETER PAZMANY

More information

The Agilent Total RNA Isolation Kit

The Agilent Total RNA Isolation Kit Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

Computational Biology I

Computational Biology I Computational Biology I Microarray data acquisition Gene clustering Practical Microarray Data Acquisition H. Yang From Sample to Target cdna Sample Centrifugation (Buffer) Cell pellets lyse cells (TRIzol)

More information

Factors for consideration in developing research initiatives for DNA microarray development and experimentation.

Factors for consideration in developing research initiatives for DNA microarray development and experimentation. Factors for consideration in developing research initiatives for DNA microarray development and experimentation. Robert Fleischmann and Scott Peterson The Institute for Genomic Research The recent development

More information

Finding Genes with Genomics Technologies

Finding Genes with Genomics Technologies PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

earray 5.0 Create your own Custom Microarray Design

earray 5.0 Create your own Custom Microarray Design earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Separation and Detection, Part

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the

More information

LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING. Leona Samson. MODULE 2 EXPRESSION ENGINEERING Lecture # 3.

LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING. Leona Samson. MODULE 2 EXPRESSION ENGINEERING Lecture # 3. 20.109 LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING MODULE 2 EXPRESSION ENGINEERING Lecture # 3 Leona Samson March 31 st 2009 Snapshot of the next four weeks We will eliminate the expression of various

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Analysis of Cancer Gene Expression Profiling in DNA Microarray Data using Clustering Technique

Analysis of Cancer Gene Expression Profiling in DNA Microarray Data using Clustering Technique Analysis of Cancer Gene Expression Profiling in DNA Microarray Data using Clustering Technique 1 C. Premalatha, 2 D. Devikanniga 1, 2 Assistant Professor, Department of Information Technology Sri Ramakrishna

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Differential gene expression. General Introduction. Overview (1) Biology Fundamentals - Genes

Differential gene expression. General Introduction. Overview (1) Biology Fundamentals - Genes Differential gene expression General Introduction Overview (1) Reminder of biology Major steps in microarray analysis Microarray preparation design, clone/probe selection RNA extraction, hybridization

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Background Analysis and Cross Hybridization. Application

Background Analysis and Cross Hybridization. Application Background Analysis and Cross Hybridization Application Pius Brzoska, Ph.D. Abstract Microarray technology provides a powerful tool with which to study the coordinate expression of thousands of genes in

More information

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

More information

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Spotted DNA Array Design. Todd Lowe BME/Bio 210 Sept 30, 2008

Spotted DNA Array Design. Todd Lowe BME/Bio 210 Sept 30, 2008 Spotted DNA Array Design Todd Lowe BME/Bio 210 Sept 30, 2008 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations For

More information

3. Microarrays: experimental design, statistical analysis and gene clustering

3. Microarrays: experimental design, statistical analysis and gene clustering WUEMED Drought Course 3. Microarrays: experimental design, statistical analysis and gene clustering John Bennett International Rice Research Institute Los Baños, Philippines 3.1: Experimental overview

More information

Human Genomics. 1 P a g e

Human Genomics. 1 P a g e Human Genomics What were the aims of the human genome project? To identify all the approximately 20,000-25,000 genes in Human DNA. To find where each gene is located To determine the sequences of the 3

More information

10.1 The Central Dogma of Biology and gene expression

10.1 The Central Dogma of Biology and gene expression 126 Grundlagen der Bioinformatik, SS 09, D. Huson (this part by K. Nieselt) July 6, 2009 10 Microarrays (script by K. Nieselt) There are many articles and books on this topic. These lectures are based

More information

Introduction to Bioinformatics. Fabian Hoti 6.10.

Introduction to Bioinformatics. Fabian Hoti 6.10. Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

CodeLink Human Whole Genome Bioarray

CodeLink Human Whole Genome Bioarray CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it

More information

MIAME. URL: Relationships between samples, arrays and hybridizations:

MIAME. URL:   Relationships between samples, arrays and hybridizations: MIAME 1. Experimental design 1a) authors T.G. Fazzio M.E. Gelbart T. Tsukiyama Fred Hutchinson Cancer Research Center A1-175 1100 Fairview Ave N Seattle, WA 98109, U.S.A. URL: http://www.fhcrc.org/labs/tsukiyama/supplemental-data/h4basicpatch/

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist

More information

SGN-6106 Computational Systems Biology I

SGN-6106 Computational Systems Biology I SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th

More information

DNA arrays for early disease detection

DNA arrays for early disease detection DNA arrays for early disease detection Chem 395 Bioanalytical chemistry Instructor Prof.James F.Rusling Presented by Vigneshwaran Mani Outline What is a Microarray? Types of Microarray Steps involved in

More information

STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from

STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated

More information