The reverse in-gel kinase assay for profiling physiological kinase substrates

Size: px
Start display at page:

Download "The reverse in-gel kinase assay for profiling physiological kinase substrates"

Transcription

1 The reverse in-gel kinase assay for profiling physiological kinase substrates Xiang Li, Bin Guan, Minu K Srivastava, Achuth Padmanabhan, Brian S Hampton & Charles J Bieberich Supplementary figures and text: Supplementary Figure 1 ERK2, Aurora A and GSK-3β substrates revealed by RIKA Supplementary Figure 2 Comparison of 2D KESTREL and 2D RIKA for fraction 12 and 13. Supplementary Figure 3 CK2 RIKA for TBB treated LNCaP lysates Supplementary Figure 4 Alignment of silver stained gel and RIKA autoradiogram. Supplementary Figure 5 Matching a silver-stained RIKA gel with a RIKA autoradiogram. Supplementary Table 1 Summary of CK2 substrates identified by Mass Spectrometry Supplementary Table 2 Summary of PKA substrates identified by Mass Spectrometry Supplementary Methods

2 Supplementary Figure 1 ERK2, Aurora A and GSK-3β substrates revealed by RIKA Supplementary Figure 1a ERK2 substrates revealed by RIKA. ERK2 Control 3 11 To reveal ERK2 substrates, a 2D ERK2 RIKA was performed using a HeLa cell nuclear extract (150 µg protein) as a source of potential substrates. Recombinant wild type rat ERK2 (upper panel) was activated in vitro by a constitutively active form of MEK1 and the activated ERK2 was polymerized in the gel at a final concentration of 25 µg/ml. A kinase activity-deficient ERK2 mutant was used as a negative control (lower panel). The arrow denotes autophosphorylation of an endogenous kinase detected in both gels.

3 Supplementary Figure 1b Aurora A substrates revealed by RIKA. Aurora Control A whole cell LNCaP extract (400 µg) was resolved on a gel containing 50 µg/ml Aurora A (upper panel). A parallel gel without kinase served as the negative control (lower panel). The arrow designates autophosphorylation of a endogenous kinase. The dashed rectangle denotes technical background that was not reproducible.

4 Supplementary Figure 1c GSK-3β substrates revealed by RIKA. MW(kDa) GSK3-β * * Control * 3 11 * A whole cell LNCaP extract (300 µg) was resolved on a gel containing constitutively active GSK3-β (25 µg/ml) (upper panel). A kinase activity-deficient form of GSK-3β was used as a negative control (lower panel). Signal designated by the red asterisks is due to activity of the endogenous kinases NM23 H1 (left) and NM23 H2 (right). The relatively low number of substrates revealed in this experiment may be due to the fact that phosphorylation by GSK- 3β generally requires priming by another kinase, for example CK1. The apparent increase in the extent of endogenous kinase activity detected in this assay compared to RIKAs with other kinases is likely due to the fact that detection of GSK-3β substrates required a longer exposure time for the RIKA gel.

5 Supplementary Figure 2 Comparison of 2D KESTREL and 2D RIKA for fraction 12 and 13. a b c d e f g

6 (a) 2D KESTREL for fraction 12 shown in Fig. 2. An aliquot from fraction 12 was incubated with (upper panel) or without (lower panel) 4 µg of CK2α as described in Methods. Spots in hatched oval, signal due to autophosphorylation of recombinant CK2α. Hatched boxes represent areas shown in Fig. 2c in the manuscript. (b) Twodimensional RIKA of fraction 12. An aliquot from fraction 12 was precipitated with TCA and focused on an 18 cm ph 4-7 IPG strip. The strip was then analyzed by RIKA with 25 µg of active (upper panel) or kinase activity-deficient (lower panel) CK2α present in the gel. Hatched boxes represent areas shown in Fig. 2d in the manuscript. (c) 2D KESTREL for fraction 13. Lysate from fraction 13 was incubated with (upper panel) or without (lower panel) 4 µg of CK2α as described in Methods. Spots in hatched oval, signal due to autophosphorylation of recombinant CK2α. (d) Two-dimensional RIKA of fraction 13. Lysate from fraction 13 was precipitated with TCA and focused on an 18 cm ph 4-7 IPG strip. The strip was then analyzed by RIKA with 25 µg of active (upper panel) or kinase activity-deficient (lower panel) CK2α present in the gel. (e) Inset in (c) (upper panel). (f) Inset in (c) (lower panel). Red arrows in (e) and (f), signal unique to the KESTREL reaction when recombinant CK2α was present. (g) Inset in (d). Red arrows designate corresponding substrates phosphorylated by recombinant CK2α in (e). Substrate 2 was not detected in the 2D RIKA gel. Multiple exposures of the 2D KESTREL autoradiogram revealed at best 15 potential CK2 substrates, while multiple exposures of the 2D RIKA radiogram revealed at least 70 CK2 substrates.

7 Supplementary Figure 3 CK2 RIKA for TBB treated LNCaP lysates a b c d e f (a-d) CK2α RIKA of a TBB-treated LNCaP extract. LNCaP cells at 80% confluence were treated with 100 µm TBB or vehicle (DMSO). 300 µgs protein from a whole-cell lysate from each treatment was analyzed in a 2D RIKA gel containing 25 µg/ml recombinant CK2α. (a) Autoradiogram of RIKA gel from the vehicle-treated LNCaP lysate. (b) Autoradiogram of a RIKA gel from the TBB-treated LNCaP lysate. (c) Inset in (a). (d) Inset in (b). Arrowheads in (d) highlight signal observed only in the RIKA using lysate from TBB-treated LNCaP cells. (e) PKA RIKA for the same untreated LNCaP lysate shown in (a), which serves as a specificity control for the TBB treatment. (f) PKA RIKA for the same TBB-treated LNCaP lysate shown in (b). Note that TBB treatment does not alter the pattern of substrate phosphorylation. Black arrows designate the activity of the endogenous kinases NM23 H1 and H2.

8 Supplementary Figure 4 Alignment of silver stained gel and RIKA autoradiogram. a b c d An LNCaP lysate ion-exchange fractionation was analyzed in a 2D RIKA gel containing 25 µg/ml of CK2α (a). An equal volume of the same lysate was applied to a 2D SDS-PAGE and silver-stained (b). Spots were excised from the silver-stained gel by aligning the gel with the autoradiogram and the identities of these spots were determined by MALDI-TOF mass-spectrometry. (c). Inset in (a). (d). Inset in (b). Arrows in (c) and (d) designate substrates matched on the gel and in the autoradiogram. Spots 1-4 were not successfully identified using MALDI. Spots 5, 6 and 7 were identified as isoforms of Nucleophosmin.

9 Supplemetary Figure 5 Matching a silver-stained RIKA gel with a RIKA autoradiogram. a b 4 7 c 4 7 d

10 An ion-exchange fraction of a whole cell LNCaP lysate was analyzed in a 2D RIKA with 1 µg/ml CK2α in the gel. The gel was silver stained (a) directly after the RIKA reaction and an autoradiogram (b) was obtained after the gel was dried. Spots were excised from the gel by matching the gel with the radiogram and the identities of these spots were determined by MALDI-TOF mass-spectrometry. (c). Inset in (a). (d). Inset in (b). Arrows in (c) and (d) designate substrates matched on the gel and in the autoradiogram. Spots 1 and 4 were not successfully identified using MALDI. Spots 2 and 3 were identified as two isoforms of the β subunit of CK2 holoenzyme, and spots 5 and 6 were identified as Ras-related protein Rab- 11A and GTP-binding protein SAR1a respectively.

11 Supplementary table 1 Summary of CK2 substrates identified by Mass Spectrometry CK2 substrates identified by LC-MS/MS Protein name Accession No. Rank Log(e) Peptides matched Sequence coverage Predicted mass (kda)/pi Known CK2 substrate? Annexin A5 P % 35.8/4.7 Yes, in the loach M. fossilis GRP94 P % 92.4/4.8 Yes HnRNP C1/C2 P % 25.2/5.0 Yes, in rat Nucleolin (C23) P % 76.4/4.6 Yes CK2 substrates excised from silver stained parallel gel and identified by MALDI-TOF Protein name Accession No. Rank Mascot score Peptides matched Sequence coverage Predicted mass (kda)/pi Known CK2 substrate? Acidic leucine-rich nuclear phosphoprotein Q % 28.8/3.9 No 32 B/ANP 32B ATP synthase subunit beta/atpb P % 56.6/5.3 No Cytosolic prostaglandin E2 synthase/pges Q % 18.7/4.4 Yes GRP94 variant 1 # Q59FC % 65.9/5.1 Yes Hepatoma-derived growth factor (HDGF) P % 26.8/4.7 No novel DNA binding/efhand/leucine zipper P % 50.3/5.1 No protein /NEFA* Nucleophosmin/B23 Q9BYG % 28.5/4.6 Yes Semenclotin * S % 40.8/9.9 No CK2 substrates excised from silver stained RIKA gel and identified by MALDI-TOF Protein name Accession No. Rank Mascot score Peptides matched Sequence coverage Predicted mass (kda)/pi Known CK2 substrate? Alpha-actinin-4 O % 104.8/5.3 No Protein disulfideisomerase A6 Q % 48/5.0 No Protein kinase C and casein kinase substrate Q9UNF % 55.7/5.1 Yes in neurons protein 2 Casein kinase II subunit beta P % 24.9/5.3 Yes 26S protease regulatory subunit 6B P % 47.3/5.1 No GTP-binding protein SAR1a Q9NR % 22.4/6.2 No Ras-related protein Rab-11A P % 24.4/6.1 No Nucleophosmin P % 32.6/4.6 Yes Summary of proteins identified by Mass Spectrometry. Top, proteins identified by LC-MS/MS from RIKA gels. In each case, CK2α was also identified and ranked either as the first or second hit. Middle, proteins identified by MALDI-TOF MS from parallel silver-stained gels. A parallel gel was run

12 together with a RIKA gel. Mascot score is -10*Log(P), where P is the probability that the observed match is a random event. Mascot scores greater than 64 are significant (p<0.05). #, This is a fragment of GRP94 including the putative CK2 sites. *, Proteins from mouse seminal vesicle extracts. The theoretical molecular weights and pis of these identified proteins are consistent with the observed molecular weight and pi on the 2D gels. Bottom, proteins identified by MALDI- TOF from silver-stained RIKA gels. Supplementary Table 2 Summary of PKA substrates identified by Mass Spectrometry PKA substrates excised from silver stained parallel gels and identified by MALDI-TOF Protein Name Accession No. Rank Mascot Score Peptides matched Sequence Coverage Predicted Mass (kda)/pi Known PKA substrate? ATP synthase subunit beta/atpb P % 56.5/5.2 No Actin, cytoplasmic 1 (Beta-actin) P % 41.7/5.3 Yes Triose Phosphate Isomerase I/ TPI I P % 26.6/6.4 No PKA substrate identified by LC-MS/MS Protein Name Accession No. Rank Score Peptides Matched Histone H2B CAB Matched Sequences R.LLLPGELAK.H R.KESYSVYVYK.V K.VLKQVHPDTGISSK.A K.AMGIMNSFVNDIFER.I Predicted Mass (kda)/pi Known PKA substrate? 13.9/10.3 Yes

13 Supplementary Methods Cell culture and TBB treatment of LNCaP cells. LNCaP cells were cultured in RPMI 1640 with 10% FBS in a humidified incubator at 37 C. Cells were treated with TBB at 100 µm (Sigma, Steinheim, Germany) or DMSO (vehicle) for 30 minutes. Plasmid construction. A clone containing the full-length human HDGF cdna was purchased from ATCC (Manassas, VA). Clones containing full-length human ANP32B, human ATPB, mouse Semenclotin, and mouse NEFA cdnas, were purchased from Open Biosystems (Huntsville, AL 35806). The open reading frame of HDGF, ANP32B and ATPB were amplified by PCR. Since the mouse Semenclotin and NEFA genes encode secretory proteins, partial sequences lacking the signal peptide were amplified by PCR. PCR products were digested with specific restriction enzymes and cloned into the 6X His-tagged protein expression vector pqe-80l (Qiagen, Valencia, CA 91355). Human PGES was amplified from LNCaP cell mrna by RT-PCR. The PCR product was cloned in a TA cloning vector (Invitrogen, Carlsbad, CA) and re-cloned into the 6X His-tagged protein expression vector prset-a (Invitrogen, Carlsbad, CA). Human wild type CK2α and kinase activity-deficient CK2α (K68M) were PCR-amplified from plasmids pzw6 and pgv15 respectively (Ref. S1, gift from D. Litchfield). PCR products were TA cloned and re-cloned into pproex-hta (Invitrogen, Carlsbad, CA). PKA (catalytic subunit α) was PCR-amplified from a clone purchased from ATCC and cloned into pqe-80l. A kinase activity-deficient PKA mutant (K72H) was derived by PCRmediated mutagenesis. Phosphatase treatment. LNCaP lysates were incubated with λ-phosphatase (New England Biolabs, Beverly, MA) at 30 C for 1 hour and precipitated with TCA. Protein IEF. Protein lysates were precipitated with TCA (Sigma, Steinheim, Germany) at a final concentration of 15%. Protein pellets were resuspended in 7 M urea, 2 M thiourea, 1% C 7 BZO (Sigma, Steinheim, Germany), 50 mm DTT, 1% IEF buffer (GE Health, Piscataway, NJ). Lysates were then applied to an immobilized ph gradient (IPG) strip and focused on an IEF cell (Bio-Rad Laboratories, Hercules, CA). Ampholytes of the same ph range were added to a final concentration of 0.5%. No additional ampholytes were added when ph 3-11 IPG strips were used. Purification of His-tagged proteins. His-tagged proteins were purified using nickel chromatography under standard conditions. In vitro kinase assays of recombinant CK2α substrates. Recombinant putative CK2α substrates purified from E. coli were dialyzed against 150 mm NaCl, 20 mm Tris, ph 7.5 prior to in vitro kinase assay. To label a recombinant protein by CK2α, approximately 5-10 µg of each recombinant protein was incubated with 0.5 µg CK2α at room temperature for 60 minutes in a 1X CK2α reaction buffer (New England Biolab, Beverly, MA) in the presence of 30 nm [γ-32p]atp and 200 µm cold ATP. The reactions were stopped by adding an equal volume of 2X Laemmli buffer. The reaction mixture was resolved by SDS-PAGE and transferred to a PVDF membrane. The PVDF

14 membrane was stained with Coommassie brilliant blue and dried prior to autoradiography. Fractionation of LNCaP lysates for RIKA. LNCaP cell lysate in 50 mm diethanolamine ph 8.8 were cleared and protein (50 mg) was applied to a 2-ml Source 15 (GE Health, Piscataway, NJ) column at 4 ºC. Proteins were eluted with a NaCl step gradient from 50 mm to 1 M. Extraction and fractionation of mouse seminal vesicle proteins. Seminal vesicles were homogenized in 50 mm Tris ph 7.5, 150 mm NaCl, 0.5% NP40 containing protease inhibitor cocktail (Roche Dignostics, Mannheim, Germany). The homogenate was centrifuged and the pellet was resuspended in 8 M urea, 20 mm glycine, ph 10.0 and homogenized again. The homogenate was centrifuged and the supernatant was mixed with 8 M urea, 20 mm, ph 10.0 to a final volume of 15 mls and applied to a 1-ml Source 15 column. The column was washed with the same buffer and eluted with a NaCl step gradient in 8 M urea. KESTREL. LNCaP lysates resuspended in 50 mm Tris, ph 7.5 were fractionated on a 1 ml Source 15 column prior to KESTREL reactions. CK2α KESTREL reactions were performed as described 7. In brief, a 15 µl aliquot of each fraction was incubated with 4 µg recombinant CK2α at room temperature for 4 minutes in the presence of 30 nm [γ- 32 P]ATP in a 30 µl reaction volume with a protease inhibitor cocktail. Reactions without recombinant CK2α were set up in parallel. All reactions were stopped with equal volume of 2X Laemmli buffer. Lysates were resolved by SDS-PAGE and subsequently transferred to PVDF membranes. For 2D KESTREL, aliquots from fractions 12 and 13 were incubated with 4 µg recombinant CK2α at room temperature for 4 minutes in the presence of 30 nm of [γ- 32 P]ATP. The reactions were stopped by precipitation with 15% TCA and prepared for 2D SDS-PAGE. Mass Spectrometry. Signal spots on RIKA gels were excised, trypsin-digested and processed on a Finnigan LCQ LC-MS/MS. MS/MS mass spectra were searched against the NCBI non-redundant protein database using the X!-tandem algorithm (thegpm.org). Spots matching signals on RIKA gels were excised, digested by trypsin, desalted by Ziptip µc18 tips, and deposited for MALDI-TOF MS peptide-mass fingerprinting using a Bruker Dalton Autoflex MS. Peptide lists were searched against SwissProt database or NCBInr database using Mascot. References. S1. Vilk, G. Saulnier, R. B. St Pierre, R.Litchfield, D. W. Inducible expression of protein kinase CK2 in mammalian cells. Evidence for functional specialization of CK2 isoforms. J Biol Chem 274, (1999).

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA). 175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further

More information

Lecture 8: Affinity Chromatography-III

Lecture 8: Affinity Chromatography-III Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Advances in analytical biochemistry and systems biology: Proteomics

Advances in analytical biochemistry and systems biology: Proteomics Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current

More information

Ni-NTA Agarose. User Manual. 320 Harbor Way South San Francisco, CA Phone: 1 (888) MCLAB-88 Fax: 1 (650)

Ni-NTA Agarose. User Manual. 320 Harbor Way South San Francisco, CA Phone: 1 (888) MCLAB-88 Fax: 1 (650) Ni-NTA Agarose User Manual 320 Harbor Way South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 871-8796 www. Contents Introduction -----------------------------------------------------------------------

More information

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

Dynamic High Capacity Mustang Q Membrane Units for Scaleable Anion Exchange Chromatography Purification of Adenoviral Vectors

Dynamic High Capacity Mustang Q Membrane Units for Scaleable Anion Exchange Chromatography Purification of Adenoviral Vectors Contact Us: www.pall.com/contact Dynamic High Capacity Mustang Q Membrane Units for Scaleable Anion Exchange Chromatography Purification of Adenoviral Vectors Dynamic High Capacity Mustang Q Membrane Units

More information

Supplemental Materials and Methods:

Supplemental Materials and Methods: Supplemental Materials and Methods: Cloning: Oligonucleotides used in the subcloning steps are listed in Supplemental Table 1. Human FANCI (isoform 1, KIAA1794) was subcloned from pcmv6-xl4 [FANCI] in

More information

Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis

Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis 2D gel electrophoresis remains a dominant technique in proteomics. Obtaining high quality gels requires careful and tedious

More information

O-GlcNAcase Activity Assay

O-GlcNAcase Activity Assay O-GlcNAcase Activity Assay Prepared by Jen Groves and Junfeng Ma, The Johns Hopkins Unviersity School of Medicine Based on: Macauley MS et al., 2005. O-GlcNAcase uses substrate-assisted catalysis: kinetic

More information

AmpliScribe T7-Flash Transcription Kit

AmpliScribe T7-Flash Transcription Kit AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction

More information

OPPF-UK Standard Protocols: Mammalian Expression

OPPF-UK Standard Protocols: Mammalian Expression OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) 1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) DESCRIPTION Nickel NTA Magnetic Agarose Beads are products that allow rapid and easy small-scale purification of

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

Supplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock

Supplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Proteins and reagents Proteins were purified as described previously: RecA, RecQ, and SSB proteins (Harmon and Kowalczykowski 1998); RecF protein (Morimatsu and Kowalczykowski

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Small-Molecule Drug Target Identification/Deconvolution Technologies

Small-Molecule Drug Target Identification/Deconvolution Technologies Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily

More information

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein

More information

The preparation of native chromatin from cultured human cells.

The preparation of native chromatin from cultured human cells. Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010.

DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. Technical Bulletin DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. PRINTED IN USA. Revised 12/12 DNA 5 End-Labeling System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

SUMOylated protein capture kit

SUMOylated protein capture kit SUMOylated protein capture kit Cat no. A010-100 Capture and detect SUMOylated proteins High capacity, high specificity SUMO binding matrix Fast, convenient protein isolation using purification system provided

More information

Mitochondrial DNA Isolation Kit

Mitochondrial DNA Isolation Kit Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

Kinase Reaction and Alkylation Protocol

Kinase Reaction and Alkylation Protocol Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic

More information

ChIP-chip protocol adapted for the mod-encode project

ChIP-chip protocol adapted for the mod-encode project ChIP-chip protocol adapted for the mod-encode project Version 1.2 : August 2007 Nicolas Nègre, Xiaochun Ni, Sergey Lavrov, Giacomo Cavalli and Kevin P. White University of Chicago, Department of Human

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract

Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract Purification: Step 1 Lecture 11 Protein and Peptide Chemistry Cells: Break them open! Crude Extract Total contents of cell Margaret A. Daugherty Fall 2003 Big Problem: Crude extract is not the natural

More information

Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open!

Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open! Lecture 11 Protein and Peptide Chemistry Margaret A. Daugherty Fall 2003 Purification: Step 1 Cells: Break them open! Crude Extract Total contents of cell Big Problem: Crude extract is not the natural

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Nickel NTA Agarose Cartridges 5ml are used for purification of histidine-tagged proteins in native or denaturing conditions. This cartridge can be used with an automated chromatography system,

More information

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications

More information

96-well Checkpoint Kinase Activity Assay Kit

96-well Checkpoint Kinase Activity Assay Kit Product Manual 96-well Checkpoint Kinase Activity Assay Kit Catalog Number STA-414 STA-414-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

Supporting Information

Supporting Information Supporting Information Copper and zinc ions specifically promote non-amyloid aggregation of the highly stable human γ-d crystallin Liliana Quintanar, 1,* José A. Domínguez-Calva, 1 Eugene Serebryany, 2

More information

Rotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein

Rotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein Rotation Report Sample Version 2 Due Date: August 9, 1998 Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein Anita H. Corbett Advisor: Amy Jones Rotation 1 Abstract:

More information

Proteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples

Proteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and

More information

Site-directed mutagenesis of proteins

Site-directed mutagenesis of proteins IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction

More information

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription

More information

Cellular Fractionation

Cellular Fractionation Cellular Fractionation Lamond Lab Protocol 2007 More detailed protocol can be found here: http://www.lamondlab.com/f7nucleolarprotocol.htm This protocol has been adapted to fractionate a variety of different

More information

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

More information

QIAGEN Supplementary Protocol: Isolation of genomic DNA from tissue using the QIAGEN-tip Storage of tissue samples.

QIAGEN Supplementary Protocol: Isolation of genomic DNA from tissue using the QIAGEN-tip Storage of tissue samples. QIAGEN Supplementary Protocol: Isolation of genomic DNA from tissue using the QIAGEN-tip 2500 This protocol is designed for the rapid, easy, and non-toxic preparation of up to 2 mg genomic DNA from not

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Figure 1: E. Coli lysate transfer using liquid handling automation

Figure 1: E. Coli lysate transfer using liquid handling automation Figure 1: E. Coli lysate transfer using liquid handling automation Figure 1 - E. coli lysate transfer using liquid handling automation. Following the manufacturer s procedures, a 96-well plate miniprep

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

Figure 1. Schematic of Ats1p expression plasmid.

Figure 1. Schematic of Ats1p expression plasmid. Abstract: Anita Corbett page 2 The goal of my rotation project was to express, purify, and examine the exchange activity of a putative guanine nucleotide exchange factor, Ats1p. The S. cerevisiae ATS1

More information

Active targeting of the nucleus using non-peptidic boronate tags

Active targeting of the nucleus using non-peptidic boronate tags Supporting Information Active targeting of the nucleus using non-peptidic boronate tags Rui Tang 1, Ming Wang 2, Moumita Ray 1, Ying Jiang 1, Ziwen Jiang 1, Qiaobing Xu 2 *, Vincent M. Rotello 1 * 1 Department

More information

Supplemental Information. OprG Harnesses the Dynamics of its Extracellular. Loops to Transport Small Amino Acids across

Supplemental Information. OprG Harnesses the Dynamics of its Extracellular. Loops to Transport Small Amino Acids across Structure, Volume 23 Supplemental Information OprG Harnesses the Dynamics of its Extracellular Loops to Transport Small Amino Acids across the Outer Membrane of Pseudomonas aeruginosa Iga Kucharska, Patrick

More information

MEK1/2 (MAPK Kinase) Activity Assay Kit

MEK1/2 (MAPK Kinase) Activity Assay Kit MEK1/2 (MAPK Kinase) Activity Assay Kit For 96 tests Cat. No. SGT440 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0)

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous suspension containing 30 vol % ethanol. INSTRUCTIONS The resins are adapted

More information

One-step split GFP staining for sensitive protein detection and localization in mammalian cells

One-step split GFP staining for sensitive protein detection and localization in mammalian cells Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,

More information

Amersham * ECL * Gel horizontal electrophoresis system

Amersham * ECL * Gel horizontal electrophoresis system GE Healthcare Life Sciences Data file 28-9970-20 AB Electrophoresis products Amersham * ECL * Gel horizontal electrophoresis system Amersham ECL Gel and Amersham ECL Gel Box constitute a horizontal mini-gel

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Description...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...

Description...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting... QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the

More information

Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions

Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions www.iba-biotagnology.com Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions Strep-tag and One-STrEP-tag PPI Analysis with the co-precipitation/ mass spectrometry approach 3 Background

More information

Purification and characterization of proteolytic enzymes from normal and opaque-2 Zea mays L. developing endosperms*

Purification and characterization of proteolytic enzymes from normal and opaque-2 Zea mays L. developing endosperms* J. Biosci., Vol. 10, Number 2, June 1986, pp. 257 266. Printed in India. Purification and characterization of proteolytic enzymes from normal and opaque-2 Zea mays L. developing endosperms* P. C. RAM,

More information

INSECT CELL/BACULOVIRUS PRODUCTION

INSECT CELL/BACULOVIRUS PRODUCTION INSECT CELL/BACULOVIRUS PRODUCTION PEF # GENE NAME TRANSFER VECTOR BEVS MOLECULAR WEIGHT 2015-XXXX XXXX pbac1 flashbacultra TM 36.0 kda EXPRESSION METHOD OVERVIEW: Insect cells Spodoptera frugiperda (Sf9)

More information

Purification of cytoplasmic RNA from animal cells using the RNeasy Mini Kit

Purification of cytoplasmic RNA from animal cells using the RNeasy Mini Kit QIAGEN Supplementary Protocol: Purification of cytoplasmic RNA from animal cells using the RNeasy Mini Kit This protocol requires the RNeasy Mini Kit. IMPORTANT: Please consult the Safety Information and

More information

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions

More information

Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03

Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03 Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays AfCS Procedure Protocol PP00000184 Version 1, 10/20/03 The following procedure details the preparation of fluorescently labeled

More information

Myers Lab ChIP-seq Protocol v Modified January 10, 2014

Myers Lab ChIP-seq Protocol v Modified January 10, 2014 Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Complete kit for the systematic analysis of protein kinases from a proteome such as cell lysate, tissue or microorganisms.

Complete kit for the systematic analysis of protein kinases from a proteome such as cell lysate, tissue or microorganisms. Protein Kinase Landscape (Large Format PEP) Catalog # AB000504 Complete kit for the systematic analysis of protein kinases from a proteome such as cell lysate, tissue or microorganisms. Please read this

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

Supplementary Information

Supplementary Information Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Supporting Online Material, Matsumoto et al.

Supporting Online Material, Matsumoto et al. Supporting Online Material, Matsumoto et al. Material and Methods Library. Poly(A) + mrna was purified from RAW264.7 cells stimulated with murine IFN-γ (100 units/ml) and bacterial LPS (100 ng/ml) for

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

Technical tips Session 5

Technical tips Session 5 Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation

More information

NoviPure Microbial Protein Kit (50)

NoviPure Microbial Protein Kit (50) Saving You Time For Life NoviPure Microbial Protein Kit (50) Catalog No. 47044 Quantity: 50 preps INSTRUCTION MANUAL Version 04202016 Please recycle www.mobio.com T: 800-606-6246 T: 760-929-9911 technical@mobio.com

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Score winning cdna yields with SuperScript III RT

Score winning cdna yields with SuperScript III RT Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How

More information

hfab Rhodamine Housekeeping Antibodies

hfab Rhodamine Housekeeping Antibodies hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine

More information

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11 Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae for PCR-based template generation Cat. No. EGE-2010-15 FOR RESEARCH USE ONLY. NOT INTENDED

More information

Nickel-NTA Agarose Suspension

Nickel-NTA Agarose Suspension Nickel-NTA Agarose Suspension Agarose beads for purification of His-tagged proteins Product No. A9735 Description Nickel-NTA Agarose Suspension is an agarose-based affinity chromatography resin allowing

More information

NEBNext Magnesium RNA Fragmentation Module

NEBNext Magnesium RNA Fragmentation Module SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008

Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008 Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008 INTRODUCTION DNA Plasmids. A plasmid is a small double-stranded, circular DNA molecule

More information

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only Plasmid Midiprep Plus Purification Kit Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only 1 Description: The Plasmid Midiprep Plus Purification Kit provides simple

More information

E.Z.N.A. Bacterial RNA Kit. R preps R preps

E.Z.N.A. Bacterial RNA Kit. R preps R preps E.Z.N.A. Bacterial RNA Kit R6950-00 5 preps R6950-01 50 preps July 2017 E.Z.N.A. Bacterial RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Before Beginning...4

More information

E.Z.N.A. Tissue RNA Kit. R preps R preps

E.Z.N.A. Tissue RNA Kit. R preps R preps E.Z.N.A. Tissue RNA Kit R6688-00 5 preps R6688-01 50 preps May 2015 E.Z.N.A. Tissue RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Important Notes...4 Homogenization

More information

N-terminal dual protein functionalization by strainpromoted alkyne nitrone cycloaddition

N-terminal dual protein functionalization by strainpromoted alkyne nitrone cycloaddition Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry -terminal dual protein functionalization by strainpromoted alkyne nitrone cycloaddition Rinske P. Temming, a Loek Eggermont,

More information

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No for preparation of 100 nucleic acid samples Cat. No. 1 796 88 Principle Cells are lysed during a short incubation with Proteinase K in the presence of a chaotropic salt (guanidine HCl), which immediately

More information

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase Why adapter ligation? Ligases Introduction to s in general, and RA 1 / RA 2, truncated in particular mira bacterial mra -P unknown sequence 3 -H -PPP unknown sequence 3 -H 3 adapter LIGASE catalyzed known

More information

BIOC 463A Protein Purification Concepts General Concepts about Protein Purification

BIOC 463A Protein Purification Concepts General Concepts about Protein Purification General Concepts about Protein Purification Initial Considerations: Why do you want the protein (ie. what is your project all about)? How much protein do you need (ng, ug, mg, g)? How homogenous or pure?

More information

Ral Activation Assay Kit

Ral Activation Assay Kit Product Manual Ral Activation Assay Kit Catalog Number STA-408 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family of

More information

ab GAPDH SimpleStep ELISA Kit

ab GAPDH SimpleStep ELISA Kit ab176642 GAPDH SimpleStep ELISA Kit Instructions for Use For the semi-quantitative measurement of GAPDH in Human and mouse cell lysates. This product is for research use only and is not intended for diagnostic

More information

Purification of mfp. from an Overnight Culture. Laboratory 17

Purification of mfp. from an Overnight Culture. Laboratory 17 Purification of mfp from an Overnight Culture When scientists at a therapeutics company, like Amgen, have successfully identified a promising therapeutic protein, two objectives would be to locate and

More information

Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab)

Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab) Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau 09162008 Page 1 of 5 General Cloning Protocol: Gel-purification 1. Pour 1mm thick, urea denaturing 10% or 15% polyacrylamide gels, with

More information

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a

More information

Intracellular receptors specify complex patterns of gene expression that are cell and gene

Intracellular receptors specify complex patterns of gene expression that are cell and gene SUPPLEMENTAL RESULTS AND DISCUSSION Some HPr-1AR ARE-containing Genes Are Unresponsive to Androgen Intracellular receptors specify complex patterns of gene expression that are cell and gene specific. For

More information

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 5.0 Rev 03/25/205 Table of Contents Introduction 2 Limitations of Use 2 Features 2 Applications 2 Storage 2

More information

Investigation of a Mammalian Cellular Model for Differential Protein Expression Analysis Using 1D PAGE and Cleavable ICAT Reagents

Investigation of a Mammalian Cellular Model for Differential Protein Expression Analysis Using 1D PAGE and Cleavable ICAT Reagents pplication Note 1D PGE and Cleavable ICT Reagents Investigation of a Mammalian Cellular Model for Differential Protein Expression nalysis Using 1D PGE and Cleavable ICT Reagents Overview The use of two-dimensional

More information

EXPIRED. The original method was described by F. Lasne et al. in Analytical Biochemistry 311 (2002)

EXPIRED. The original method was described by F. Lasne et al. in Analytical Biochemistry 311 (2002) HARMONIZATION OF THE METHOD FOR THE IDENTIFICATION OF EPOETIN ALFA AND BETA (EPO) AND DARBEPOETIN ALFA (NESP) BY IEF-DOUBLE BLOTTING AND CHEMILUMINESCENT DETECTION. The criteria presented herein have been

More information

special offers from your protein biology resource

special offers from your protein biology resource special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research

More information