Protein Synthesis Fairy Tale

Transcription

1 Name: Protein Synthesis Fairy Tale Date: Period: Fairy Tale: "Once upon a time there were two fraternal twin brothers: Donald N. Armstrong and Ronald Armstrong. Donald was the smarter of the two, and he was a successful inventor with many Although Ronald was not as smart as his brother, he was extremely loyal. One day Donald c with an idea for a solar powered car. Given the ever-present possibility of energy shortage, efficient solar powered car would be in great demand. However, Donald really didn't want t his comfortable estate. He certainly couldn't take a chance by using or a fax to send h the factory. They might be stolen by industrial spies! Donald knows his loyal brother would anything for him, so he asks him to be a messenger and carry the plans to the factory. At the the assembly line is set up and factory workers bring the parts to assemble the prototype. T proves to be enormously successful. The Armstrong brothers buy an even bigger estate and happily ever after!" 1. In protein synthesis what would Donald represent? 2. What would Ronald represent? 3. What does the estate represent? 4. What do the plans represent? 5. What does the factory represent? 6. What do the factory workers represent? 7. What does the car represent? 27

2 DNA Strucure, History, and Replication Review Guide 1. What is a nucleotide? What are the 3 parts? 2. Give the 4 nucleotides found in DNA. Indicate their family and the structure of each family. 3. How is DNA like a twisted ladder? What makes up the sides? The rungs? What holds the 2 sides together? 4. State Chargaff s base pair rules. What is the complimentary strand to the following DNA segment: AAATTCCGGAGCTTAACGGTA? 5. When is DNA replicated? Why is DNA replication important? 6. Give the 2 types of enzymes involved in DNA replication and their functions. 7. Summarize the experiments/findings of the following scientists (from your notes and your reading): James Watson Francis Crick Edwin Chargaff Rosalind Franklin 28

3 RNA, Transcription and Translation Review 1. What is the process by which the genetic code of DNA is copied into a strand of RNA? 2. What is a codon and what is its purpose? What does it code for? 3. What are some similarities and differences between RNA and DNA? 4. What is the process of decoding mrna into a polypeptide chain? In other words, how does a gene become protein? 5. What is an anticodon and what is its purpose? 6. What are the steps of transcription? 7. Where does transcription take place? Where does translation take place? 8. What are the steps of translation? 9. What are the 3 types of RNA and what are their functions? 10. During transcription what is formed? During translation what is formed? 11. How many codons specify 1 amino acid? 12. What base is missing on RNA, & what other base replaces it? 13. Uracil will pair with what other base on DNA? 14. Is RNA double or single stranded? 29

4 15. Which type of RNA copies DNA s instructions in the nucleus? 16. What does trna transport? 17. In what part of a cell are proteins made? 18. What is RNA polymerase & tell its function. 19. Are both strands of DNA copied during transcription? 20. As RNA polymerase moves along the DNA template strand, what is being added? 21. What happens to the newly made mrna molecule following transcription in the nucleus? 22. How many different kinds of amino acids make up proteins? 23. Name the amino acid coded for by each of these codons: a. UUA b. AUU c. UGU d. AAA e. GAG f. UAA 24. What codon starts protein synthesis? What amino acid does the start codon always carry? 25. What codons stop protein synthesis? 26. What codon on mrna would bind with these anticodons: a. AAA b. GGA c. UAC d. CGU 27. What type of bonds are the ones that attach amino acids to each other in a growing polypeptide? 30

5 Protein Synthesis Lab Name: Period: Date: 1. One person in your group should go to the nucleus table of the classroom and transcribe one of the DNA segments into messenger RNA (mrna). 2. The mrna message will be brought back to the ribosome table where your partner is sitting. The other partner in your group will then turn the mrna message into the complementary anticodon series of transfer RNA (trna) 3. Once the trna sequence has been determined you will need to find out which amino acid goes with each anit-codon. You will need to decode the mrna codons using the decoder table to find out which amino acid goes with the complementary trna anti-codon. 4. When you have found which amino acid goes with the trna molecule you will go to the amino acid table and flip that amino acid card and find a word on the back. Write that word in the appropriate sentence blank of the DNA segment you picked in the nucleus. 5. Continue translating the mrna message until you have completed the sentence. 6. Repeat with other DNA segments until you finish all your assigned segments. (You should only do one sentence at a time or you will get all sorts of messed up.) Amino Acid base decoder table use with mrna codons! (not trna codons) 31

6 Analysis Questions: 1. Why did you have to stay in the nucleus to write down the mrna? 2. Which part of this activity represents transcription? 3. Which part of this activity represents translation? 4. What happens in the ribosomes during protein synthesis? 5. What does the final sentence represent in terms of protein synthesis? 6. What does each word represent in terms of protein synthesis? 7. All DNA sequences started with TAC and ended with ATC, ATT, or ACT. Why? 8. How many mutated DNA segments did you have? What could a mutated DNA segment cause? 32

7 DNA, RNA, and Snorks Name: Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on the planet Dee Enae in a distant solar system. Snorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the snork. DNA samples were taken from volunteer snorks. The DNA was then transcribed to its complimentary RNA strand, and you have been given a copy. Your job is to analyze the RNA sample and determine the phenotype (how the organism looks) based on the sequence. Use your RNA codon wheel to determine the amino acids. Remember that AUG is a start codon, and it signifies the beginning of each gene. UAA is a stop codon and signifies the end of a gene. Genes Amino Acid Sequence Description Gene 1 - body covering a.) val - ser - leu hairless b.) val - ser - lys hairy Gene 2 - body style a.) tyr - pro - glu - glu - lys plump b.) val - pro - thr - glu - lys skinny Gene 3 - legs a.) leu - leu - leu - pro 3 legged b.) leu - leu - ser - ala 2 legged Gene 4 - head shape a.) ala - val - val round head b.) val - ala - ala square head Gene 5 - tails a.) his - ile tail b.) his - his no tail Gene 6 - body pigment a.) ser - pro - val blue pigment (hair/skin) b.) val - phe - tyr red pigment (hair/skin) Gene 7 - eyes a.) asp - ile - leu - leu - pro - thre small slanted eyes b.) asp - ile - pro - pro - pro - thre large round eyes Gene 8 - mouth a.) val - asp - asp - ala circular mouth b.) asp - asp - asp - ala rectangular mouth Gene 9 - ears a.) phe - ser - gly pointed standing-up ears b.) phe - phe - gly rounded floppy ears Gene 10 - arms a.) arg - tyr - cys - lys long spaghetti like arms b.) arg - arg - asp - thre short stumpy arms Draw your snork on the back of this page. Be sure to include the type of snork you selected. 33

8 Type of Snork: 34

9 DNA Structure and Replication How is genetic information stored and copied? Why? Deoxyribonucleic acid or DNA is the molecule of heredity. It contains the genetic blueprint for life. For organisms to grow and repair damaged cells, each cell must be capable of accurately copying itself. So how does the structure of DNA allow it to copy itself so accurately? Model 1 The Structure of DNA Nucleotide Ladder Model of DNA Helix Model of DNA Phosphate Deoxyribose sugar Nitrogencontaining base Nitrogen Bases Adenine Thymine Guanine Cytosine 1. Refer to the diagram in Model 1. a. What are the three parts of a nucleotide? b. What kind of sugar is found in a nucleotide? c. Which nucleotide component contains nitrogen? d. Name the four nitrogen bases shown in Model DNA is often drawn in a ladder model. Locate this drawing in Model 1. a. Circle a single nucleotide on each side of the ladder model of DNA. DNA Structure and Replication 1 b. What part(s) of the nucleotides make up the rungs of the ladder? c. What parts of the nucleotides make up the sides (backbone) of the ladder? d. Look at the bottom and top of the ladder in Model 1. Are the rungs parallel (the ends of the strands match) or antiparallel (the ends of the strands are opposites)? 3. On the ladder model of DNA label each of the bases with the letter A, T, C or G. 4. Refer to Model 1. When one nucleotide contains adenine, what type of base is the adenine attached to on the opposite nucleotide strand? 5. The two strands of DNA are held together with hydrogen bonds between the nitrogen bases. These are weak bonds between polar molecules. How many hydrogen bonds connect the two bases from Question 4? 6. Refer to Model 1. When one nucleotide contains cytosine, what type of base is the cytosine attached to on the opposite nucleotide strand? 7. How many hydrogen bonds connect the two bases from Question 6? 8. With your group, use a complete sentence to write a rule for how the bases are arranged in the ladder model of DNA. Read This! Erwin Chargaff ( ), an Austrian-American biochemist, investigated the ratio of nucleotide bases found in the DNA from a variety of organisms. From his research, as well as research by Rosalind Franklin and Maurice Wilkins, Watson and Crick developed the complementary base-pair rule during their race to discover the structure of DNA. The complementary base-pair rule states that adenine and thymine form pairs across two strands, and guanine and cytosine form pairs across two strands. 9. Fill in the complementary bases on the strand below according to the base-pair rule. A T C C A G 10. The ladder model of DNA is a simplified representation of the actual structure and shape of a DNA molecule. In reality, the strands of DNA form a double helix. Refer to the double helix diagram in Model 1 and describe its shape using a complete sentence. 2 POGIL Activities for High School Biology 35

10 Model 2 DNA Replication Direction of DNA helicase Free Nucleotides DNA helicase 11. Examine Model 2. Number the steps below in order to describe the replication of DNA in a cell. Hydrogen bonds between nucleotides form. Hydrogen bonds between nucleotides break. Strands of DNA separate. Free nucleotides are attracted to exposed bases on the loose strands of DNA. 12. Locate the DNA helicase on Model 2. a. What type of biological molecule is DNA helicase? b. What is the role of DNA helicase in the replication of DNA? 13. What rule is used to join the free nucleotides to the exposed bases of the DNA? 14. This type of replication is called semi-conservative replication. Considering the meaning of these words (semi half; conserve to keep), explain why DNA replication is called semi-conservative. DNA Structure and Replication 3 4 POGIL Activities for High School Biology 36 Yeast Wheat 27 Salmon Cow Human Adenine Guanine Cytosine Thymine Organism Percentage of each type of base 16. The proportions of the bases are consistent within a species; however they do vary between species. Using the base-pair rules, complete the following table to show the percentage of each type of base in the five different organisms. 15. DNA molecules can be tens of thousands of base pairs in length. Mistakes in DNA replication lead to mutations, which may or may not be harmful to an organism. How does semi-conservative replication help prevent mutations during DNA replication?

11 Name: Period: DNA Model Activity D = deoxyribo N = nucleic A = acid DNA contains the information for carrying out all of the activities of a cell. How this information is coded or passed from cell to cell was at one time unknown. To break the code, you will do a paper lab to determine the structure of DNA and show how the genetic code is carried. You and each member of your class will color molecules called nucleotides. DNA is made up of repeating units of nucleotides. Directions Color the nucleotides using the legend. Label the nucleotides (sugar, phosphate, or A, G, T, C base). 1. Look at the nucleotides. What are the three common parts of a nucleotide? What is one part of a nucleotide that differs among the four different nucleotides? 3. List the four different types of nitrogen bases Cut out the nucleotides. Manipulate the nucleotide pieces until you find the best fit. Join the nucleotide molecules in your group like a puzzle. Use tape to connect and reinforce the molecules. You now have a molecule of DNA. 4. In the space below, explain where the nucleotide molecules connect to each other. 5. A real DNA molecule consists of thousands of these pairs of nucleotides. What is the pairing arrangement of the nitrogen bases? 37

12 pairs with and pairs with 6. Are there always going to be an equal number of adenine and thymine in a molecule? Why? 7. Are there always going to be an equal number of guanine and cytosine molecules in a molecule of DNA? Why? 8. Scientists abbreviate the nitrogen bases by using the first letter of each base, so: A always binds to C always binds to The structure of DNA is actually in a double helix arrangement. Double helix means that the two long chains of nucleotides are arranged in a spiral-like twisted ladder. The 9. The sides of the ladder are made up of alternating and molecules. steps of the ladder are made up of held together by bonds. Bring your molecule to the front of the room and join it to the molecules of your classmates. We now have one large DNA molecule! 38