1.1 What is bioinformatics? What is computational biology?
|
|
- Deborah McLaughlin
- 6 years ago
- Views:
Transcription
1 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, October 16, Introduction 1.1 What is bioinformatics? What is computational biology? Bioinformatics and computational biology are multidisciplinary fields, at the intersection of natural sciences (esp. biology, chemistry), computer science and mathematics. Both terms are often used synonymously but sometimes they are used with different nuances. The US National Institutes of Health defined both notions as follows: Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological, medical, behavioral or health data, including those to acquire, store, organize, archive, analyze, or visualize such data. Computational Biology: The development and application of data-analytical and theoretical methods, mathematical modeling and computational simulation techniques to the study of biological, behavioral, and social systems. In German the term Bioinformatik is used for both, the term Computerbiologie is virtually not used. If we talk about Bioinformatics in the following we include the notions of Computational Biology. (Note: in October 2006 Google found 26.7 million pages on Bioinformatics, 4.1 million on Computational Biology, 1.6 million on Bioinformatik and 238 on Computerbiologie.) 1.2 Why is there a need for this new scientific discipline? Technological advances, such as high-throughput sequencers, DNA-arrays, protein mass-spectrometry, faster processors and larger computer memories, have helped transform molecular biology into a highthroughput science, in which huge amounts of data are being generated ever faster. To handle and interpret these data, bioinformaticians are needed who understand the experiment by which the data are generated and how they can be efficiently processed and stored. They not only need to be capable of developing or adapting algorithms and their implementation, but also need to be able to communicate with the other involved scientists from various fields. Bioinformaticians develop simulations to test theoretical models of biological or chemical processes, possibly derived from data analysis. Verified models can be implemented in predictive programs that will e.g. allow to narrow down the number of necessary biological experiments in drug research (known as rational drug design). 1.3 Contents of the lecture 1. Introduction 2. Probabilities 3. DNA compression algorithm 4. Pairwise sequence alignment 5. BLAST: Searching for similar sequences in a database 6. Multiple sequence alignment 7. Genome comparison 8. RNA secondary structure 9. Protein secondary structure
2 4 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, October 16, Protein tertiary structure 11. Physical mapping 12. Hidden Markov models 1.4 Probability theory is vital in bioinformatics Figure 1.1: A die: Can you be sure that it is fair? Probability theory and statistics are important to bioinformatics: one wants to estimate how significant the result of a predictive or heuristic method is. in heuristic algorithms probabilistic decisions may be taken to walk through solution space (e.g. in simulated annealing) etc DNA compression Figure 1.2: DNA compression takes repeats into account to efficiently reduce space requirement. The discussed DNA compression algorithm uses 2-bit nucleotide encoding and a repeat recognition. The compression rates of two genomes allows to estimate their relatedness. 1.6 Pairwise sequence alignment Hemoglobin is oxygen carrier in the blood. Myoglobin in the muscle also carries oxygen and both have a heme group as a cofactor to which O 2 is bound (see Figure 1.3). Figure 1.3: Heme molecule with one oxygen molecule bound. Are both protein sequences similar? A pairwise sequence alignment can help! (see Figure 1.4).
3 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, October 16, Figure 1.4: A pairwise alignment of human hemoglobin (α chain) and myoglobin. 1.7 BLAST: Basic Local Alignment Search Tool MbtH-like protein is a protein that occurs in certain bacteria that produce antibiotics. Its function is still unclear. Are there other proteins in the databases of known proteins that are similar to it and might have a known function? BLAST will compare a query protein to all proteins in the database (see Figure 1.5 and Figure 1.6). Figure 1.5: Result of a BLAST search with MbtH-like protein of Amycolatopsis balhimycina as query and Swiss-Prot as database. Figure 1.6: The best relevant hit is a hypothetical protein with unknown function. 1.8 Multiple sequence alignment Besides hemoglobin and myoglobin a third protein has a heme cofactor to transport oxygen: Leghemoglobin, a hemoprotein found in the nitrogen-fixing root nodules of leguminous plants. A multiple sequence alignment (MSA) of all three globins shows their mutual conservation.
4 6 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, October 16, 2006 Figure 1.7: Multiple sequence alignment of leghemoglobin (of yellow lupine), human hemoglobin and myoglobin. Pairwise identities: hemoglobin vs. myoglobin 25%, leghemoglobin vs. myoglobin 23% and leghemoglobin vs. hemoglobin 14%. Figure 1.8: The 3D structures of Hemoglobin (α chain), Myoglobin and Leghemoglobin are astoundingly similar despite their low sequence identity. [source: Berg, Tymoczk & Stryer (2002). Biochemistry]. The three-dimensional structure is much more closely associated with function than is sequence. This is the reason why it is evolutionary more conserved. 1.9 Genome comparison Figure 1.9: Chimp-human chromosome differences. The major structural difference is that human chromosome 2 (green color code) was derived from two smaller chromosomes that are found in other great apes (now called 2A and 2B, see: Entrez PubMed ). Parts of human chromosome 2 are scattered among parts of several cat and rat chromosomes in these species that are more distantly related to humans (more ancient common ancestors; about 85 million years since the human/rodent common ancestor: Entrez PubMed ). [Source: Wikipedia, Chimpanzee Genome Project].
5 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, October 16, RNA secondary structure prediction In this chapter we will discuss algorithms to predict the secondary structure of RNAs. Figure 1.10: Secondary Structure of trna Leu(UUR) : The indicated nucleotide transitions are associated with the MELAS syndrome. [Source: Saara Finnilä, Oulu University, 2000]. Figure 1.11: 3D structure model of a transfer RNA (trna). [Source: Wikipedia, transfer RNA] Prediction of secondary and tertiary protein structure Figure 1.12: 10 models for the tertiary structure of MbtH-like protein generated by ROSETTA Physical mapping Physical Mapping is the process of identifying the order and orientation (called layout) of overlapping unsequenced DNA pieces (sequences). A prerequisite is the prior position finding of orientation
6 8 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, October 16, 2006 points called markers, short known words (subsequences) with a length in the order of 10 base pairs that should occur in more than one sequence. In the Physical Map the sequences should be placed and orientated consistently with the marker information. Figure 1.13: A map of human chromosome X. [source: NCBI Mapview] Hidden Markov Models (HMMs) HMMs are statistical models particularly used in pattern recognition. Because only their output is visible (the data) the underlying model is hidden and has to be estimated. Figure 1.14: A simple Hidden Markov Model of the weather. [Source: K. Noto, University of Wisconsin-Madison].
Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationComputational methods in bioinformatics: Lecture 1
Computational methods in bioinformatics: Lecture 1 Graham J.L. Kemp 2 November 2015 What is biology? Ecosystem Rain forest, desert, fresh water lake, digestive tract of an animal Community All species
More informationBioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview
Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 1 Intro to Molecular Biology Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/14 Announcements Homework 1 due next Tuesday
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationBIOINFORMATICS IN BIOCHEMISTRY
BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationCourse Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses
Course Information Introduction to Algorithms in Computational Biology Lecture 1 Meetings: Lecture, by Dan Geiger: Mondays 16:30 18:30, Taub 4. Tutorial, by Ydo Wexler: Tuesdays 10:30 11:30, Taub 2. Grade:
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationIntroduction to Algorithms in Computational Biology Lecture 1
Introduction to Algorithms in Computational Biology Lecture 1 Background Readings: The first three chapters (pages 1-31) in Genetics in Medicine, Nussbaum et al., 2001. This class has been edited from
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationWhat is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.
What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer
More informationBioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University
Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationNew Programs in Quantitative Biology: Hunter College.
New Programs in Quantitative Biology: QuBi @ Hunter College What is QuBi? Quantitative Biology An initiative to join computational and quantitative disciplines to the analysis of biological data. Bioinformatics,
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationStudying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationIntroduction. CS482/682 Computational Techniques in Biological Sequence Analysis
Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationOutline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
More informationBLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationSequence Analysis Lab Protocol
Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: January 16, 2013 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationBLASTing through the kingdom of life
Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.
More informationComputational Genomics ( )
Computational Genomics (0382.3102) http://www.cs.tau.ac.il/ bchor/comp-genom.html Prof. Benny Chor benny@cs.tau.ac.il Tel-Aviv University Fall Semester, 2002-2003 c Benny Chor p.1 AdministraTrivia Students
More informationbioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5
Bioinformatica 1 / 5 2 / 5 3 / 5 Bioinformatica Bioinformatics is the name given to these mathematical and computing approaches used to glean understanding of biological processes. Common activities in
More informationWorksheet for Bioinformatics
Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research
More informationLesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not
More informationHidden Markov Models. Some applications in bioinformatics
Hidden Markov Models Some applications in bioinformatics Hidden Markov models Developed in speech recognition in the late 1960s... A HMM M (with start- and end-states) defines a regular language L M of
More informationBLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the database of nucleotide sequences at the National Center for Biotechnology
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationChallenging algorithms in bioinformatics
Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use
More informationBioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
More informationab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More information90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006
90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006 8 RNA Secondary Structure Sources for this lecture: R. Durbin, S. Eddy, A. Krogh und G. Mitchison. Biological sequence analysis,
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationExamination Assignments
Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN
More informationUCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
More informationMolecular Structures
Molecular Structures 1 Molecular structures 2 Why is it important? Answers to scientific questions such as: What does the structure of protein X look like? Can we predict the binding of molecule X to Y?
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationBiology From gene to protein
Biology 205 5.3.06 From gene to protein Shorthand abbreviation of part of the DNA sequence of the SRY gene >gi 17488858 ref XM_010627.4 Homo sapiens SRY (sex determining region Y chromosome) GGCATGTGAGCGGGAAGCCTAGGCTGCCAGCCGCGAGGACCGCACGGAGGAGGAGCAGG
More informationG4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
More informationMolecular Structures
Molecular Structures 1 Molecular structures 2 Why is it important? Answers to scientific questions such as: What does the structure of protein X look like? Can we predict the binding of molecule X to Y?
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationLecture 10. Ab initio gene finding
Lecture 10 Ab initio gene finding Uses of probabilistic sequence Segmentation models/hmms Multiple alignment using profile HMMs Prediction of sequence function (gene family models) ** Gene finding ** Review
More informationSequence Alignment and Phylogenetic Tree Construction of Malarial Parasites
72 Sequence Alignment and Phylogenetic Tree Construction of Malarial Parasites Sk. Mujaffor 1, Tripti Swarnkar 2, Raktima Bandyopadhyay 3 M.Tech (2 nd Yr.), ITER, S O A University mujaffor09 @ yahoo.in
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationINTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet
INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationGenome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
More informationDatabase Searching and BLAST Dannie Durand
Computational Genomics and Molecular Biology, Fall 2013 1 Database Searching and BLAST Dannie Durand Tuesday, October 8th Review: Karlin-Altschul Statistics Recall that a Maximal Segment Pair (MSP) is
More informationLecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary
More informationCMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS
CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS (Computational Structural Biology) OUTLINE Review: Molecular biology Proteins: structure, conformation and function(5 lectures) Generalized coordinates,
More informationHEMOGLOBIN: PHYSIOLOGICAL EXPRESSION AND EVOLUTION OF GENE CLUSTER
HEMOGLOBIN: PHYSIOLOGICAL EXPRESSION AND EVOLUTION OF GENE CLUSTER I. Physiological Expression: HOW DO WE GET OXYGEN TO OUR BODY TISSUES? Oxygen has a low solubility in blood. During the course of animal
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationBasic Concepts and History of Genetic Engineering. Mitesh Shrestha
Basic Concepts and History of Genetic Engineering Mitesh Shrestha Genetic Engineering AKA gene manipulation, gene cloning, recombinant DNA technology, genetic modification, and the new genetics. A technique
More informationMolecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo
Molecular Biology IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Francesca Stomeo Molecular biology is the study of biology at a molecular level, especially DNA and RNA - replication, transcription, translation,
More informationExome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.
Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationSAMPLE LITERATURE Please refer to included weblink for correct version.
Edvo-Kit #340 DNA Informatics Experiment Objective: In this experiment, students will explore the popular bioninformatics tool BLAST. First they will read sequences from autoradiographs of automated gel
More informationCSC 121 Computers and Scientific Thinking
CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors
More informationSection DNA: The Molecule of Heredity
Ch 11: DNA and Genes - DNA: The Molecule of Heredity Inside This Section... What is DNA? The Structure of DNA DNA Replication What is DNA? Acid DNA is the blueprint of all living organisms. It controls
More informationClassification and Learning Using Genetic Algorithms
Sanghamitra Bandyopadhyay Sankar K. Pal Classification and Learning Using Genetic Algorithms Applications in Bioinformatics and Web Intelligence With 87 Figures and 43 Tables 4y Spri rineer 1 Introduction
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationBIOINFORMATICS Introduction
BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea
More informationBGGN 213: Foundations of Bioinformatics (Fall 2017)
BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on
More informationBIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics
More informationCHAPTER 21 GENOMES AND THEIR EVOLUTION
GENETICS DATE CHAPTER 21 GENOMES AND THEIR EVOLUTION COURSE 213 AP BIOLOGY 1 Comparisons of genomes provide information about the evolutionary history of genes and taxonomic groups Genomics - study of
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationG4120: Introduction to Computational Biology
ICB Fall 2004 G4120: Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Copyright 2004 Oliver Jovanovic, All Rights Reserved. Analysis of Protein Sequences Coding
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationOverview of Health Informatics. ITI BMI-Dept
Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases
More informationRecommendations from the BCB Graduate Curriculum Committee 1
Recommendations from the BCB Graduate Curriculum Committee 1 Vasant Honavar, Volker Brendel, Karin Dorman, Scott Emrich, David Fernandez-Baca, and Steve Willson April 10, 2006 Background The current BCB
More informationDNA Function. DNA Heredity and Protein Synthesis
DNA Function DNA Heredity and Protein Synthesis 1 Review DNA made of Nucleotide bases Proteins made of Amino acids Describe how DNA is involved in protein synthesis DNA base sequence codes for amino acid
More informationComputers in Biology and Bioinformatics
Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come
More informationOptimizing multiple spaced seeds for homology search
Optimizing multiple spaced seeds for homology search Jinbo Xu, Daniel G. Brown, Ming Li, and Bin Ma School of Computer Science, University of Waterloo, Waterloo, Ontario N2L 3G1, Canada j3xu,browndg,mli
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationDNA is normally found in pairs, held together by hydrogen bonds between the bases
Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationCOMP 555 Bioalgorithms. Fall Lecture 1: Course Introduction
COMP 555 Bioalgorithms Fall 2014 Jan Prins Lecture 1: Course Introduction Read Chapter 1 and Chapter 3, Secns 3.1-3.7 1 Intended Audience COMP 555: Bioalgorithms Suitable for both undergraduate and graduate
More informationBioinformatics - Lecture 1
Bioinformatics - Lecture 1 Louis Wehenkel Department of Electrical Engineering and Computer Science University of Liège Montefiore - Liège - September 19, 2007 Find slides: http://montefiore.ulg.ac.be/
More informationThe Human Genome Project
The Human Genome Project The Human Genome Project Began in 1990 The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease. The true payoff from the
More informationIntegrated UG/PG Biotechnology (Fifth Semester) End Semester Examination, 2013 LBTC 504: Bioinformatics. Model Answers
Integrated UG/PG Biotechnology (Fifth Semester) End Semester Examination, 2013 LBTC 504: Bioinformatics Model Answers Answer Key for Section-A (Objective Type Questions) Question 1. (i) (c) Both of the
More information