Supplementary Figure 2

Size: px
Start display at page:

Download "Supplementary Figure 2"

Transcription

1 Supplementary Figure 2 a SBS-C1 SBS-C2 SBS-C3 SBS-C4 SBS-C5 SBS-C6 SBS-C7 SBS-C8 SBS-C9 LCR CNS-1 CNS-2 Il5 Rad50 Il13 Il4 Kif3a Sept kb Sau3AI BamHI/Bgl II A B C D E F G H I J K L M N O P Q R S Crosslink Urea Gradient un-crosslinked protein Digestion loop DNA 3C Assay ChIP-Loop Assay Ligation Reverse Crosslink ChIP Ligation non sepecific protein and DNA PCR

2 Supplementary Figure 2 b locus Sau3AI 0 S1 S2 500 S S bp * * BamHI/Bgl II B1 B2 0 B3 500 B bp * * Crosslinking frequency [ T 2] X= c H { [ } ] { [ *] [*] } A B C D X = A C B D SBS-C1 (Sau3AI fragment 2) Resting

3 Supplementary Figure 2 d SBS-C1 SBS-C2 SBS-C3 SBS-C4 SBS-C5 SBS-C6 SBS-C7 SBS-C8 SBS-C9 LCR CNS-1 CNS-2 Il5 Rad50 Il13 Il4 Kif3a Sept kb Sau3AI BamHI/Bgl II A B C D E F G H I J K L M N O P Q R S T H 2 Rad50 promoter SBS-C9 (fragment C) (fragment S) M A B C D E F G H I J K L M N O P Q R S A B C T H 2* *

4 Supplementary Fig. 2. ChIP loop assay and 3C assay to determine chromatin structure of the T H 2 cytokine locus. General principle) Chromatin loops that form in vivo can be trapped during formaldehyde crosslinking of cells. If remote DNA sequences are physically brought in close proximity by chromatin looping in vivo, they can be found in the same crosslinked chromatin fragment, and the DNA sequences at the stem of chromatin loops can be identified. Briefly, after digesting crosslinked chromatin with a restriction enzyme that removes the loop portion of chromatin, the two sequences initially located at the stem of loop can then be ligated intra-molecularly, after dilution of the chromatin sample to avoid inter-molecular ligation events. After reverse crosslinking (to remove proteins), purified genomic DNA that had been intra-molecularly ligated, excluding the loop portion of DNA, can be amplified by PCR, using primer pairs designed from the two distal sequences of interest. The ligation products detected by PCR indicates physical interactions between DNA fragments held together by higher-order chromatin structure. This method called the chromosome conformation capture (3C) assay (Dekker, J., Rippe, K., Dekker, M. & Kleckner, N., Science 295, , 2002). allows us to detect the frequency with which two remote genomic sequences interact in space in a given nucleus. The more recently devised ChIP-loop assay (Horike, S., Cai, S., Miyano, M., Cheng, J.F. & Kohwi-Shigematsu, T., Nat Genet 37, 31-40, 2005), a modified 3C analysis, studies the chromatin fragments that were immunoprecipitated with an antibody specific for a chromatin associated protein of interest. Although both assays examine long-range DNA interactions between regulatory elements, the advantage of the ChIP-loop assay is that it enables us to study a specific group of chromatin loops that are fastened at their base with a specific protein, or that associates with specific histone modification. For instance, using the ChIP-loop assay, we recently reported that methyl CpG-binding protein 2 (MeCP2) regulates higher-order chromatin organization and is responsible for chromatin looping of the transcriptionally-silent, but not active chromatin, at the locus of one of its target genes, Dlx5/6. The crosslinking frequencies of any two DNA fragments, as determined by the intensity of the PCR signals of a ligation product, depends on the relative proximity of the two DNA fragments to each other at a given time point. Relative ligation crosslinking

5 frequencies of any two DNA fragments were calculated as described below to normalize various parameters such as PCR amplification efficiencies, ligation and crosslinking efficiencies, the amounts of the template initially used. a, The experimental strategies of ChIP-loop and 3C assays. For these assays, we used Sau3AI restriction enzyme-digested fragments (1-20) as well as BamH1/BglII restriction enzyme-digested fragments (A-S), which were used for the verification purpose. Primers (forward and backward) were designed in each of these fragments. After formaldehyde crosslinking, we purified crosslinked chromatin by urea-gradient ultracentrifugation to remove un-crosslinked protein and proceeded to 3C assay as described in Methods. For ChIP-loop assay, we performed chromatin immunoprecipitation before intra-molecular ligation to identify the chromatin loop defined by specific protein. b, The genomic DNA prepared for either ChIP-loop or 3C assay as described above was subjected to PCR amplification using various combination of forward and backward primer pairs derived from the DNA fragments (1-20 or A-S). These PCR products derived from the 200-kb T H 2 cytokine locus using genomic DNA is designated T H 2. We used the b-actin locus (using primers S2 and S3 for Sau3AI digested/re-ligated templates, or B2 and B3, for BamH1/BglII digested/re-ligated templates) as an internal control to normalize any difference in the amounts of the genomic DNA, crosslinking and ligation efficiencies. Upon either Sau3AI or BamH1/BglII digestion and ligation, a PCR product of 149bp or 131bp is generated, respectively. The PCR products using S2 and S3 or B2 and B3 primers are indicated as. To correct for ligation efficiency and amplification efficiency of different primers, a mixture of plasmid DNA containing the b-actin locus between S1 and S4 primers or B1 and B4 primers and two BAC clones covering the 200-kb T H 2 cytokine locus (see Methods) was subjected to PCR amplification with the same series of primer pair combination from different DNA fragments. The PCR products derived from the BAC clones and plasmid DNA are indicated by T H 2* and *, respectively. We calculated relative crosslink frequency using the formula shown, which corrects for any differences in PCR amplification efficiencies, crosslinking and ligation efficiencies, the amounts of the template initially used and the size of the PCR products. c, We confirmed that premixing of primers from the T H 2 cytokine gene locus and the actin locus does not

6 affect the final results of our 3C assay. The top panels show data generated by premixing the primers, and the middle and bottom panels show data generated separately with either T H 2 primers or actin primers. d, Sau3AI digestion is blocked by overlapping CpG methylation. Therefore, we checked Sau3AI digestion sites (5 GATC3 ) at both ends of all 20 Sau3AI DNA fragments and identified 7 sites that have either 5 CGATC3 or 5 GATCG3. In our 3C data, we found evidence that Sau3AI successfully digested five of these seven sites, indicating that the overlapping CpGs were not methylated in five sites. However, for the remaining two sites, corresponding to fragment 3 and 4, our 3C data showed no evidence of cleavage at these sites. Therefore, we employed BamH1/BglII-digested chromatin to repeat the 3C analysis. The BglII fragment C did not crosslink with any other fragments, except for fragment D due to the short distance, confirming that this region was not involved in long range interaction with other sites at this locus. On the other hand, crosslinking of SBS-C9 (fragment S) with the Il5 promoter (fragment A) and SBS-C1 (fragment B) has been verified using the BamH1/BglII digested chromatin.

WORKSHOP. Transcriptional circuitry and the regulatory conformation of the genome. Ofir Hakim Faculty of Life Sciences

WORKSHOP. Transcriptional circuitry and the regulatory conformation of the genome. Ofir Hakim Faculty of Life Sciences WORKSHOP Transcriptional circuitry and the regulatory conformation of the genome Ofir Hakim Faculty of Life Sciences Chromosome conformation capture (3C) Most GR Binding Sites Are Distant From Regulated

More information

ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System

ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System Liyan Pang, Ph.D. Application Scientist 1 Topics to be Covered Introduction What is ChIP-qPCR? Challenges Facing Biological

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics

Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Epigenetics represents the science for the studying heritable

More information

Epigenetics in. Saccharomyces cerevisiae. Chapter 4 2/4/14

Epigenetics in. Saccharomyces cerevisiae. Chapter 4 2/4/14 Epigenetics in Saccharomyces cerevisiae Chapter 4 2/4/14 The budding yeast - Saccharomyces cerevisiae The fission yeast - Schizosaccharomyces pombe The budding yeast, Saccharomyces cerevisiae and the fission

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329. Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary

More information

Protocols for cloning SEC-based repair templates using SapTrap assembly

Protocols for cloning SEC-based repair templates using SapTrap assembly Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a

More information

4/26/2015. Cut DNA either: Cut DNA either:

4/26/2015. Cut DNA either: Cut DNA either: Ch.20 Enzymes that cut DNA at specific sequences (restriction sites) resulting in segments of DNA (restriction fragments) Typically 4-8 bp in length & often palindromic Isolated from bacteria (Hundreds

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within

More information

Molecular Biology: DNA sequencing

Molecular Biology: DNA sequencing Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides

More information

Assay Design Considerations, Optimization and Validation

Assay Design Considerations, Optimization and Validation Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment

More information

Supplementary Figure 1. HiChIP provides confident 1D factor binding information.

Supplementary Figure 1. HiChIP provides confident 1D factor binding information. Supplementary Figure 1 HiChIP provides confident 1D factor binding information. a, Reads supporting contacts called using the Mango pipeline 19 for GM12878 Smc1a HiChIP and GM12878 CTCF Advanced ChIA-PET

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Le proteine regolative variano nei vari tipi cellulari e in funzione degli stimoli ambientali

Le proteine regolative variano nei vari tipi cellulari e in funzione degli stimoli ambientali Le proteine regolative variano nei vari tipi cellulari e in funzione degli stimoli ambientali Tipo cellulare 1 Tipo cellulare 2 Tipo cellulare 3 DNA-protein Crosslink Lisi Frammentazione Immunopurificazione

More information

scgem Workflow Experimental Design Single cell DNA methylation primer design

scgem Workflow Experimental Design Single cell DNA methylation primer design scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease

More information

Impact of gdna Integrity on the Outcome of DNA Methylation Studies

Impact of gdna Integrity on the Outcome of DNA Methylation Studies Impact of gdna Integrity on the Outcome of DNA Methylation Studies Application Note Nucleic Acid Analysis Authors Emily Putnam, Keith Booher, and Xueguang Sun Zymo Research Corporation, Irvine, CA, USA

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

ab ChIP Kit Magnetic One-Step

ab ChIP Kit Magnetic One-Step ab156907 ChIP Kit Magnetic One-Step Instructions for Use For selective enrichment of a chromatin fraction containing specific DNA sequences in a high throughput format using chromatin isolated from various

More information

Site-directed Mutagenesis

Site-directed Mutagenesis Site-directed Mutagenesis Applications Subtilisin (Met à Ala mutation resistant to oxidation) Fluorescent proteins Protein structure-function Substrate trapping mutants Identify regulatory regions/sequences

More information

NAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late.

NAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late. MIT Department of Biology 7.013: Introductory Biology - Spring 2004 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. laudette ardel NME T SE 7.013 Problem Set 3 FRIDY March 5, 2004 Problem

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I

More information

Introduction to genome biology

Introduction to genome biology Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction

More information

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>>

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>> BIO450 Primer Design Tutorial The most critical step in your PCR experiment will be designing your oligonucleotide primers. Poor primers could result in little or even no PCR product. Alternatively, they

More information

SYBR Premix DimerEraser (Perfect Real Time)

SYBR Premix DimerEraser (Perfect Real Time) Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.

More information

Bioinformatics of Transcriptional Regulation

Bioinformatics of Transcriptional Regulation Bioinformatics of Transcriptional Regulation Carl Herrmann IPMB & DKFZ c.herrmann@dkfz.de Wechselwirkung von Maßnahmen und Auswirkungen Einflussmöglichkeiten in einem Dialog From genes to active compounds

More information

Manipulation of Purified DNA

Manipulation of Purified DNA Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Construction of plant complementation vector and generation of transgenic plants

Construction of plant complementation vector and generation of transgenic plants MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

CSS451 Spring 2010 Polymerase Chain Reaction Laboratory

CSS451 Spring 2010 Polymerase Chain Reaction Laboratory CSS451 Spring 2010 Polymerase Chain Reaction Laboratory The purpose of the polymerase chain reaction (PCR) is to amplify specific segments of DNA. If one knows the DNA sequence of regions of DNA that flank

More information

Vector Linearization. igem TU/e 2015 Biomedical Engineering

Vector Linearization. igem TU/e 2015 Biomedical Engineering igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector

More information

2x PCR LongNova-RED PCR Master Mix

2x PCR LongNova-RED PCR Master Mix 2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions

More information

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1 Bcor101 Sample questions Midterm 3 1. The maps of the sites for restriction enzyme EcoR1 (R1) in the wild type and mutated cystic fibrosis genes are shown below: Wild Type R1 12 kb R1 4 kb R1 _ _ CF probe

More information

EpiQuik Quantitative PCR Fast Kit Base Catalog # P-1029

EpiQuik Quantitative PCR Fast Kit Base Catalog # P-1029 EpiQuik Quantitative PCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiQuik Quantitative PCR Fast Kit is designed for quantitative real time analysis of DNA samples

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

More information

Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1

Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1 Bio 212 Lab Name: Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1 OBJECTIVES: Review the following terms and concepts presented in Biology 211: enzymes, DNA structure and replication, role

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

#FD µl (for 200 rxns) Expiry Date: Description. 1 ml of 10X FastDigest Green Buffer. Store at -20 C

#FD µl (for 200 rxns) Expiry Date: Description. 1 ml of 10X FastDigest Green Buffer. Store at -20 C PRODUCT INFORMATION Thermo Scientific FastDigest SalI #FD0644 Lot: 5'...G T C G A C...3' 3'...C A G C T G...5' Supplied with: Store at -20 C 200 µl (for 200 rxns) Expiry Date: BSA included www.thermoscientific.com/onebio

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

Practical solutions. for DNA methylation analysis

Practical solutions. for DNA methylation analysis DNA Methylation Analysis Tools Practical solutions for DNA methylation analysis Highly efficient and time-saving solutions Locus-specific and whole genome analysis Robust performance Innovative. Fast.

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

Some types of Mutagenesis

Some types of Mutagenesis Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine

More information

CHEM 4420 Exam I Spring 2013 Page 1 of 6

CHEM 4420 Exam I Spring 2013 Page 1 of 6 CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

CHAPTER 4A MAKING SURE YOU VE GOT A RECOMBINANT PLASMID. CHAPTER 4A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.

CHAPTER 4A MAKING SURE YOU VE GOT A RECOMBINANT PLASMID. CHAPTER 4A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved. CHAPTER 4A MAKING SURE YOU VE GOT A RECOMBINANT PLASMID 55 INTRODUCTION When biologists clone a gene in order to produce human insulin, they create a recombinant plasmid that has the human insulin gene.

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

Functional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing

Functional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Functional Genomics Research Stream Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Current Issues Research Meetings: Meet with me this Thursday or Friday. (bring laboratory notebook

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

Tutorial. In Silico Cloning. Sample to Insight. March 31, 2016

Tutorial. In Silico Cloning. Sample to Insight. March 31, 2016 In Silico Cloning March 31, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com In Silico Cloning

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

ChIP-seq/Functional Genomics/Epigenomics. CBSU/3CPG/CVG Next-Gen Sequencing Workshop. Josh Waterfall. March 31, 2010

ChIP-seq/Functional Genomics/Epigenomics. CBSU/3CPG/CVG Next-Gen Sequencing Workshop. Josh Waterfall. March 31, 2010 ChIP-seq/Functional Genomics/Epigenomics CBSU/3CPG/CVG Next-Gen Sequencing Workshop Josh Waterfall March 31, 2010 Outline Introduction to ChIP-seq Control data sets Peak/enriched region identification

More information

TECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C

TECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit

More information

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is

More information

Building with DNA 2. Andrew Tolonen Genoscope et l'université d'évry 08 october atolonen at

Building with DNA 2. Andrew Tolonen Genoscope et l'université d'évry 08 october atolonen at Building with DNA 2 Andrew Tolonen Genoscope et l'université d'évry 08 october 2014 atolonen at genoscope.cns.fr @andrew_tolonen www.tolonenlab.org Yesterday we talked about ways to assemble DNA building

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

Enzymatic assembly of DNA molecules up to several hundred kilobases

Enzymatic assembly of DNA molecules up to several hundred kilobases nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

Justin Veazey. Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy

Justin Veazey. Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy Veazey 1 Justin Veazey 7A Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy Construction of recombinants GFPuv-pGEM-T easy and GFPuv-pUC19 Transformation and analysis of recombinant

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon

More information

Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand

Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the

More information

Identifying multi-locus chromatin contacts in human cells using tethered multiple 3C

Identifying multi-locus chromatin contacts in human cells using tethered multiple 3C Ay et al. BMC Genomics (2015) 16:121 DOI 10.1186/s12864-015-1236-7 RESEARCH ARTICLE Open Access Identifying multi-locus chromatin contacts in human cells using tethered multiple 3C Ferhat Ay 1, Thanh H

More information

7.013 Practice Quiz

7.013 Practice Quiz MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel 7.013 Practice Quiz 2 2004 1 Question 1 A. The primer

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

Supplementary Information

Supplementary Information Supplementary Information Deletion of the B-B and C-C regions of inverted terminal repeats reduces raav productivity but increases transgene expression Qingzhang Zhou 1, Wenhong Tian 2, Chunguo Liu 3,

More information

EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide

EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide Table of Contents I. INTRODUCTION II. PRIMER DESIGN A. Finding the target gene using the UCSC Genome Bioinformatics Site B. Identifying

More information

Supplementary Information

Supplementary Information Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative

More information

Primer Design Ameer Effat M. Elfarash

Primer Design Ameer Effat M. Elfarash Primer Design Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com PCR Cycle Each cycle (Round) of PCR contains 3 steps: 1- Denaturation 2- Primer annealing

More information

Problem Set 4

Problem Set 4 7.016- Problem Set 4 Question 1 Arginine biosynthesis is an example of multi-step biochemical pathway where each step is catalyzed by a specific enzyme (E1, E2 and E3) as is outlined below. E1 E2 E3 A

More information

Activation of a Floral Homeotic Gene in Arabidopsis

Activation of a Floral Homeotic Gene in Arabidopsis Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg

More information