7.012 Central Dogma Section

Size: px
Start display at page:

Download "7.012 Central Dogma Section"

Transcription

1 MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert. Weinberg, Dr. laudette ardel Part entral Dogma Section Shown below is a 240 base pair segment of a modified version of an E. coli gene. It includes the moter and the first codons of the gene. The sequences of both strands of the DN duplex are shown in Figure 1. The top strand reads 5' to 3' left to right (1 to 240); the bottom, complimentary, strand reads 5' to 3' right to left (240 to 1). 5'-TTTTTTTTTTTTTTTTTTT '-TTTTTTTTTTTT TTTTTTTTTTTTTTTT a d---e+--f-----c TTTTTTTTTTTTTTTTTTT TTTTTTTT g TTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTT-3' x TTTTTTTTTTTT-5' a) RN polymerase binds to the sequence (underlined above) and shown below. 5'-...TTTTTT...14bp space...tttt...-3' 3'-...TT...14bp space...t...-5' Once bound, RN polymerase starts making mrn at the 6th nucleotide after the end of the sequence (at position a, also underlined above). Synthesis of the mrn ceeds 5' to 3' left to right on the sequence above. Write the sequence of the first 10 nucleotides of the resulting mrn. b) What are the first five amino acids of the resulting tein? c) Does translation terminate at the underlined T at position 108 (c, bold)? Why or why not?

2 d) How would your answer to b) change if the / base pair at position 95 (d, bold) was deleted? e) How would your answer to b) change if an /T base pair were added between 98 & 99 (e, bold)? f) How would your answer to b) change if the /T base pair at position 103 (f, bold) were changed to /? g) ive a single base change (substitution, deletion, or addition of a single base and it's partner on the other strand) that would cause termination of the polypeptide chain at T codon 147 (g, underlined). h) ive a nonsense mutation (codon --> stop codon). i) ive a missense mutation (codon --> codon for another amino acid). j) ive a snt mutation (codon ---> codon for the same amino acid). The enetic ode ser tyr ser tyr ser STOP ser STOP trp phe phe met his his gln gln asn asn lys lys asp asp glu glu cys cys STOP ser ser

3 Part 2 iven the sequences on these next two pages, your goal is to draw a schematic of the con-6 gene. Determine the transcription start and stop sites, start and stop codons, untranslated regions, introns and exons. 5'-TTTTTTTTTTTTTTTT '-TTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTT TTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTT TTTTTTTTTTTTTTTTTTT TTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTT-3' TTTTTTTTT-5' Figure 1: enomic DN sequence of con-6 gene from Neurospora crassa. The sequence of both strands (5' to 3' on top, 3' to 5' on bottom) is shown above with nucleotides numbered 1 to 901. The dashed lines are interrupted every tenth nucleotide with a "+".

4 ENOMI DN: 251 TTTTTTT 300 mrn: 49 ENOMI DN: 301 TTTTTTTTT 350 mrn: ENOMI DN: 351 TTTTT 400 mrn: ENOMI DN: 401 TTTTTTTTTTTTTTT 450 mrn: ENOMI DN: 451 TTTTTTTTTTTTTTTTTT 500 mrn:... ENOMI DN: 501 TTTTTTT 550 mrn: ENOMI DN: 551 TTTTTTTTTT 600 mrn: ENOMI DN: 601 TTT 650 mrn: ENOMI DN: 651 TTT 700 mrn: ENOMI DN: 701 TTTTTTTT 750 mrn: ENOMI DN: 751 TTTTTTTTTTT 800 mrn: ENOMI DN: 801 TTTTTTTTTTTT 850 mrn: ENOMI DN: 851 TTTTTTTTTTTTTT 900 mrn: Figure 2: Sequence alignment of con-6 genomic DN and mrn sequences. The top line of each pair of sequences is the sequence of con-6 genomic DN. The genomic DN nucleotides are numbered as in figure 1. The bottom line is the sequence of a con-6 mrn isolated from Neurospora crassa. The nucleotide numbers of the mrn begin at the 5' end with #1, and end with #539 at the 3'end. Vertical dashes indicate nucleotides identical in both sequences. Dots indicate nucleotides in the genomic sequence that are not found in the mrn sequence. (@ represents 5' -cap)

5 Part 2 continued iven the previous figures draw a schematic of the con-6 gene below. Include the transcription start and stop sites, start and stop codons, untranslated regions, introns and exons phe phe met The enetic ode ser tyr ser tyr ser STOP ser STOP his his gln gln asn asn lys lys asp asp glu glu cys cys STOP trp ser ser

7.013 Problem Set 3 FRIDAY October 8th, 2004

7.013 Problem Set 3 FRIDAY October 8th, 2004 MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert. Weinberg, Dr. laudette ardel Name: T: 7.013 Problem Set 3 FRIDY October 8th, 2004 Problem

More information

7.014 Problem Set 3 Please print out this problem set and record your answers on the printed copy.

7.014 Problem Set 3 Please print out this problem set and record your answers on the printed copy. MIT Department of Biology 7.014 Introductory Biology, Spring 2004 Name: 7.014 Problem Set 3 Please print out this blem set and record your answers on the printed copy. Problem sets will not be accepted

More information

Name Section Problem Set 3

Name Section Problem Set 3 Name Section 7.013 Problem Set 3 The completed problem must be turned into the wood box outside 68120 by 4:40 pm, Thursday, March 13. Problem sets will not be accepted late. Question 1 Based upon your

More information

NAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late.

NAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late. MIT Department of Biology 7.013: Introductory Biology - Spring 2004 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. laudette ardel NME T SE 7.013 Problem Set 3 FRIDY March 5, 2004 Problem

More information

7.014 Quiz II Handout

7.014 Quiz II Handout 7.014 Quiz II Handout Quiz II: Wednesday, March 17 12:05-12:55 54-100 **This will be a closed book exam** Quiz Review Session: Friday, March 12 7:00-9:00 pm room 54-100 Open Tutoring Session: Tuesday,

More information

James Bond Cellular Spy (Protein Synthesis)

James Bond Cellular Spy (Protein Synthesis) James Bond ellular Spy (Protein Synthesis) Time: 50 minutes rade level: 7-12 dapted From: National ssociation of Biology Teacher s presentation (1999) Objectives: The students will more fully understand

More information

BIOLOGY. Chapter 15 Genes & Proteins

BIOLOGY. Chapter 15 Genes & Proteins BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition

More information

The Genetic Code: Translation. Pre-class reading Chapter 17: Pages

The Genetic Code: Translation. Pre-class reading Chapter 17: Pages The Genetic Code: Translation Pre-class reading Chapter 17: Pages 336-348 Nomenclature needed: Translation RN (m, t, r) Signal peptide sequence Mutations Ribosomes + Polyribosomes Codon (triplet code)

More information

Transcription & Translation notes

Transcription & Translation notes Transcription & Translation notes TRNSRIPTION The entral Dogma DN RN proteins Protein Synthesis The DN inherited by an organism leads to specific traits by dictating the synthesis of proteins The process

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

14 Gene Expression: From Gene to Protein

14 Gene Expression: From Gene to Protein CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information

More information

Recitation Section 20 April 25-26, Immunology. MIT Department of Biology Introductory Biology, Spring A. Antibody production

Recitation Section 20 April 25-26, Immunology. MIT Department of Biology Introductory Biology, Spring A. Antibody production MIT Department of Biology 7.014 Introductory Biology, Spring 005. ntibody duction Immunology Recitation Section 0 pril 56, 005 Shown below is a schematic of the duction of a heavy chain polypeptide for

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

7.014 Solution Set 4

7.014 Solution Set 4 7.014 Solution Set 4 Question 1 Shown below is a fragment of the sequence of a hypothetical bacterial gene. This gene encodes production of HWDWN, protein essential for metabolizing sugar yummose. The

More information

a) Give the sequence of the mrna transcribed from this gene and indicate the 5 and 3 ends of the mrna.

a) Give the sequence of the mrna transcribed from this gene and indicate the 5 and 3 ends of the mrna. ame: Section : 7.014 Problem Set 4 nswers to this problem set are to be turned in at the box outside 68120 by 11:45 am, Wednesday, March 9. Problem sets will not be accepted late. Solutions will be posted

More information

Gene Expression Translation U C A G A G

Gene Expression Translation U C A G A G Why? ene Expression Translation How do cells synthesize polypeptides and convert them to functional proteins? The message in your DN of who you are and how your body works is carried out by cells through

More information

No growth: Mutant cells cannot grow and divide. Classes of Neurospora crassa. Class I mutants Class II mutants Class III mutants

No growth: Mutant cells cannot grow and divide. Classes of Neurospora crassa. Class I mutants Class II mutants Class III mutants XPRIMNT Growth: Wild-type cells growing and dividing Minimal medium No growth: Mutant cells cannot grow and divide RSULTS Condition Minimal medium (MM) (control) MM + ornithine MM + citrulline Wild type

More information

This is the knowledge that you should understand upon completing this section:

This is the knowledge that you should understand upon completing this section: DN 11 Syllabus hecklist This is the knowledge that you should understand upon completing this section: 11.1 DN DN occurs bound to proteins in chromosomes in the nucs and as unbound DN in the mitochondria.

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:

3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to: 1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

Basic concepts of molecular biology

Basic concepts of molecular biology Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it Life The main actors in the chemistry of life are molecules called proteins nucleic acids Proteins: many different

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Basic concepts of molecular biology

Basic concepts of molecular biology Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it What is life made of? 1665: Robert Hooke discovered that organisms are composed of individual compartments called cells

More information

Gene Expression: From Genes to Proteins

Gene Expression: From Genes to Proteins The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below. Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose

More information

Biological Sciences 50 Practice Exam 2

Biological Sciences 50 Practice Exam 2 NAME: Fall 2005 TF: Biological Sciences 50 Practice Exam 2 A. Be sure to write your name on the top of each of page of the examination. B. Write each answer only on the same page as the pertinent question.

More information

7.012 Exam Two KEY

7.012 Exam Two KEY 7.012 Exam wo KEY -- 2006 Exam starts at 10:05 am and ends at 10:55 am. here are 9 pages including this cover page & the genetic code. Please write your name on each page. Only writing on the FRON of every

More information

Gene Expression: From Gene to Protein

Gene Expression: From Gene to Protein hapter 17 ene Expression: From ene to Protein Dr. Wendy Sera Houston ommunity ollege Biology 1406 The Flow of enetic Information The information content of genes is in the specific sequences of nucleotides

More information

Honors Research in Molecular Genetics Part 1

Honors Research in Molecular Genetics Part 1 Third Base Honors Research in Molecular enetics Part 1 ll bout ene Expression How do cells synthesize polypeptides and convert them to functional proteins? The message in your DN of who you are and how

More information

7.014 Problem Set 4 Answers to this problem set are to be turned in. Problem sets will not be accepted late. Solutions will be posted on the web.

7.014 Problem Set 4 Answers to this problem set are to be turned in. Problem sets will not be accepted late. Solutions will be posted on the web. MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Name: Section : 7.014 Problem Set 4 Answers to this problem set are to be turned in. Problem sets will not be accepted late. Solutions

More information

A Crash Course in Genetics. A Crash Course in Genetics. General Overview: General Overview: DNA Is Structured Hierarchically

A Crash Course in Genetics. A Crash Course in Genetics. General Overview: General Overview: DNA Is Structured Hierarchically DN Structure DN Structure RN RN DN Replication DN Replication Encoding Proteins Encoding Proteins Protein Folding Protein Folding Types of DN Types of DN Manipulating DN Manipulating DN DN Is Structured

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

Unit 6 (Part 1) DNA, RNA, & Protein Synthesis

Unit 6 (Part 1) DNA, RNA, & Protein Synthesis Unit 6 (Part 1) DN, RN, & Protein Synthesis Name: Period: 1 DN Structure 1. Complete the table below to show how the structure of the DN molecule allows it to perform each essential function. Function

More information

Mutations often produce proteins with new or altered functions that can be useful to organisms in different or changing environments.

Mutations often produce proteins with new or altered functions that can be useful to organisms in different or changing environments. 13 Study uide Information and Heredity Messenger RN, transfer RN, and ribosomal RN work together in prokaryotic and eukaryotic cells to translate DN s genetic code into functional proteins. These proteins,

More information

From Gene to Protein. How Genes Work

From Gene to Protein. How Genes Work From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:

More information

Welcome to Genome 371!

Welcome to Genome 371! Genome 371, 4 Jan 2010, Lecture 1 Welcome to Genome 371! If you are not registered - please don t take a seat! (class is full) - see Anne Paul (outside) to get on the wait list If you are registered and

More information

A mobile segment of DNA that travels from one location on a chromosome to another, one element of genetic change

A mobile segment of DNA that travels from one location on a chromosome to another, one element of genetic change 1 Page 1 Normal N 5' T G GG GG GG TT 3' Met ys Leu Pro Leu Pro ys Stop Mutated 5' T G G GG G GGG T 3' Met Leu Ser Ser Ser Pro Leu Phe What type of mutation is shown? 2 substitution deletion insertion translocation

More information

466 Asn (N) to Ala (A) Generate beta dimer Interface

466 Asn (N) to Ala (A) Generate beta dimer Interface Table S1: Amino acid changes to the HexA α-subunit to convert the dimer interface from α to β and to introduce the putative GM2A binding surface from β- onto the α- subunit Residue position (α-numbering)

More information

1. DNA replication. (a) Why is DNA replication an essential process?

1. DNA replication. (a) Why is DNA replication an essential process? ame Section 7.014 Problem Set 3 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68120 by 5:00pm on Friday

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

Protein Synthesis ~Biology AP~

Protein Synthesis ~Biology AP~ Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Course Announcements

Course Announcements Statistical Methods for Quantitative Trait Loci (QTL) Mapping II Lectures 5 Oct 2, 2 SE 527 omputational Biology, Fall 2 Instructor Su-In Lee T hristopher Miles Monday & Wednesday 2-2 Johnson Hall (JHN)

More information

Unit 6 Exam Review Game January 29, 2019 JEOPARDY! Unit 6 Exam Review Game January 29 th, 2019

Unit 6 Exam Review Game January 29, 2019 JEOPARDY! Unit 6 Exam Review Game January 29 th, 2019 JOPARY! Unit 6 xam Review ame January 29 th, 2019 ow to play JOPARY! The class will be split into two teams, the R team and the RN team. When a question is displayed, the R team will use the A keys on

More information

iclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3

iclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3 Bio 111 Handout for Molecular Biology 4 This handout contains: Today s iclicker Questions Information on Exam 3 Solutions Fall 2008 Exam 3 iclicker Question #28A - before lecture Which of the following

More information

3'A C G A C C A G T A A A 5'

3'A C G A C C A G T A A A 5' AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of

More information

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...

More information

From Genes to Protein

From Genes to Protein From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine

More information

Monster Synthesis Activity

Monster Synthesis Activity Monster Synthesis ctivity Purpose: To examine how an organism s DN determines their phenotypes. Background Information: Your unique body characteristics (traits), such as hair color or blood type, are

More information

Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.

Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2. 1. Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.This subunit is composed of what 3 parts? 3.What molecules make

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific

More information

Molecular Biology: DNA, gene, chromosome and genome (Learning Objectives)

Molecular Biology: DNA, gene, chromosome and genome (Learning Objectives) Molecular Biology: DN, gene, chromosome and genome (Learning bjectives) Nucleic acid structure and composition ompare and contrast the structure of DN and RN: features they share and how do they differ?

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle

More information

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies The Central Dogma Flow

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

7.016 Problem Set 3. 1 st Pedigree

7.016 Problem Set 3. 1 st Pedigree 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all generations

More information

The Structure of RNA. The Central Dogma

The Structure of RNA. The Central Dogma 12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait

More information

Granby Transcription and Translation Services plc

Granby Transcription and Translation Services plc ompany Resources ranby Transcription and Translation Services plc has invested heavily in the Protein Synthesis business. mongst the resources available to new recruits are: the latest cellphones which

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function

More information

CHapter 14. From DNA to Protein

CHapter 14. From DNA to Protein CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino

More information

A 6( mrna

A 6( mrna Name: Row: Date: Period: Protein Synthesis Worksiieet Directions: 1^* Fill in tlie complimentai^^ DN strand using DN base pairing rales. Fill in the correct mrn bases by transcribing the bottom DN code.

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

www.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations

More information

Year Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein.

Year Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein. DNA Year 1920 Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein. Which one actually carries the genetic information? The stuff that gets passed on from generation

More information

Thr Gly Tyr. Gly Lys Asn

Thr Gly Tyr. Gly Lys Asn Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human

More information

Gene Expression Transcription

Gene Expression Transcription Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction

More information

Outline. Gene Expression. One Gene One Enzyme Hypothesis. 1. Central Dogma DNA RNA Protein

Outline. Gene Expression. One Gene One Enzyme Hypothesis. 1. Central Dogma DNA RNA Protein ene Expression: RN and Synthesis ene Expression RN synthesis synthesis enetic ode Outline Splicing enes Introns and Exons omparison of ene Expression in Prokaryotes and Eukaryotes ene Expression 1. entral

More information

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION

More information

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc. Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,

More information

DNA.notebook March 08, DNA Overview

DNA.notebook March 08, DNA Overview DNA Overview Deoxyribonucleic Acid, or DNA, must be able to do 2 things: 1) give instructions for building and maintaining cells. 2) be copied each time a cell divides. DNA is made of subunits called nucleotides

More information

Basic Concepts of Human Genetics

Basic Concepts of Human Genetics Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes

More information

Chapter 13 From Genes to Proteins

Chapter 13 From Genes to Proteins Chapter 13 From Genes to Proteins True/False Indicate whether the sentence or statement is true(a) or false(b). 1. RNA nucleotides contain the sugar ribose. 2. Only DNA molecules contain the nitrogen base

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).

1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). 1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil

More information

Biology Day 67. Tuesday, February 24 Wednesday, February 25, 2015

Biology Day 67. Tuesday, February 24 Wednesday, February 25, 2015 Biology Day 67 Tuesday, February 24 Wednesday, February 25, 2015 Do#Now:' Brainstorm+8.5 + 1. Write today s FLT! 2. Identify 3 specific differences between DNA and RNA.! 3. is the process of making RNA

More information

Chapter 14 Active Reading Guide From Gene to Protein

Chapter 14 Active Reading Guide From Gene to Protein Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single

More information

Basic Concepts of Human Genetics

Basic Concepts of Human Genetics Basic oncepts of Human enetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. ne pair is called sex chromosomes

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different

More information

CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS

CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS 1 CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS * Some contents are adapted from Dr. Jean Gao at UT Arlington Mingon Kang, PhD Computer Science, Kennesaw State University 2 Genetics The discovery of

More information

CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code

CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template

More information

Molecular Genetics. Before You Read. Read to Learn

Molecular Genetics. Before You Read. Read to Learn 12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L-

36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 37. The essential fatty acids are A. palmitic acid B. linoleic acid C. linolenic

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

BIO 101 : The genetic code and the central dogma

BIO 101 : The genetic code and the central dogma BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;

More information

1. Overview of Gene Expression

1. Overview of Gene Expression Chapter 17: From Gene to 1. Overview of Gene Expression 2. Transcription 3. The Genetic Code 4. Translation 5. Mutations 1. Overview of Gene Expression Chapter Reading pp. 334-337 How are Genes related

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information