Outline. Gene Expression. One Gene One Enzyme Hypothesis. 1. Central Dogma DNA RNA Protein
|
|
- Robert Knight
- 6 years ago
- Views:
Transcription
1 ene Expression: RN and Synthesis ene Expression RN synthesis synthesis enetic ode Outline Splicing enes Introns and Exons omparison of ene Expression in Prokaryotes and Eukaryotes ene Expression 1. entral Dogma 2. Evidence for role of DN enes influence enzymes enes specify order of amino acids Fig. 14.3(E rt) Egg UV light destroys nucleus, or it is removed with micropipette. adpole or frog embryo Differentiated cells are isolated from tadpole or frog embryo. Nucleus ontains a Full Set of enetic Material Briggs & King (1952) No growth 1 2 Embryo 3 Differentiated cell nucleus is inserted into enucleate egg. Embryo Nucleus is adpole removed in micropipette. bnormal embryo Occasionally, an adult frog develops. One ene One Enzyme Hypothesis Beadle & atum s Experiments - rginine No growth Results Fig (E rt) enes Specify Sequences of mino cids Normal hemoglobin β chain (Sanger 1953) Valine Histidine cine hreonine Proline lutamic acid lutamic acid Wild-type Mutagenize Neurospora with X-rays + rginine rowth Valine Histidine cine hreonine Proline Sickle cell anemia hemoglobin β chain (Ingram 1956) ENE = Unit of Heredity Valine lutamic acid lutamate Ornithine itrulline rginosuccinate rginine rg Enzymes rg enes E F H rg E rg F rg rg H ENE = Sequence of nucleotides that determines the amino acid sequence of a protein
2 entral Dogma of Molecular Biology DN he enetic ode DN is read in sets of 3 nucleotides for each amino acid. ranscription RN ranslation Different amino acids he enetic ode DN is read in sets of 3 nucleotides for each amino acid. RN Synthesis Occurs on a DN emplate DN U U Same amino acids Newly synthesized RN RN-DN hybrid helix messenger RN makes protein U U U codon codon codon codon enetic ode (messenger RN codons) enetic ode haracteristics 1. riplet ode 2. Degenerate (redundant) 3. Start & Stop odons 4. Universal
3 ene Expression RN Synthesis ranscription = RN synthesis ranscription proceeds through: Initiation: DN unwinds at Promoter site. RN polymerase binds to promoter site. ranscription factors guide RN polymerase. Elongation: ranscription bubble forms. Single-stranded DN used to form new RN using complementary RN nucleotides added in a direction. ermination: RN polymerase stops transcription. DN terminator sequence stops RN synthesis. ene Expression RN Synthesis Initiation of transcription 1. DN Strands DN template strand: strand of DN double helix used to make RN DN coding strand: strand of DN complementary to the template strand 2. Enzyme in RN synthesis RN polymerase: enzyme that synthesizes RN from the DN template 3. Promoter Initial site on DN to attach RN polymerase Fig. 15.8a(E rt) ranscription: DN Promoter Sites are Start sites Initiation DN RN polymerase σ Promoter site oding strand Bacterial DN ranscription in Eukaryotes requires ranscription factors ranscription factor ore promoter Eukaryotic DN Eukaryote Initiation omplex ranscription factors emplate strand 35 sequence 10 sequence Prokaryote RN Polymerase RN polymerase mrn Initiation omplex RN Synthesis: Elongation & ranscription Bubble Elongation: RN nucleotides added RN Synthesis: ermination ermination ranscription stops at termination sequence DN emplate strand Newly synthesized RN U U DN oding strand RN-DN hybrid helix RN polymerase - Region Four or more U ribonucleotides
4 Elements of ranscription DN components RN Nucleotide Structure Upstream (-) Downstream (+) ore Promoter DN recognition & RN polymerase binding site Start Site First odon ranscription Unit odons ranslated erminator Signal to End ranscription Initiation Elongation ermination Nitrogen Base 1. RN sugar is RIBOSE 2. Uracil is unique to RN 3. Polymer is single-stranded omparison of ranscription in Prokaryotes & Eukaryotes Prokaryotes Eukaryotes RN polymerase One hree Promoter site + + Initiation or One Many transcription factors (RN polymerase holoenzyme) (bind to multiple sites on DN) mrn ranscription unit & amino acid sequence ermination of transcription olinear - hairpin & weak U- pairing Not colinear Introns & Exons Require cutting & splicing Not well-defined mrn transcript Not processed Processed cap & poly- tail added Mature RN transcript oupled to translation ransferred to cytoplasm through nuclear pores ene Expression ypes of RN ene expression requires multiple types of RN messenger RN (mrn) encodes proteins ribosomal RN (rrn) a structural component of the ribosome transfer RN (trn) carries amino acids to the ribosome 22 aminoacyl-trn synthetase ransfer RN Structure & Function trn red & yellow P (green) Enzyme (blue) aminoacyltrn synthetase nticodon loop t-rn cceptor arm amino acid attaches here nticodon loop ene Expression - ranslation ranslation = protein synthesis Steps: Initiation mrn, trn, and ribosome come together Elongation trns bring amino acids to the ribosome for incorporation into the elongating polypeptide ermination ribosome encounters a stop codon and releases polypeptide 24
5 ene Expression ranslation Ribosome Structure ene Expression Initiation of ranslation Initiator trn mrn Initiation Elongation ermination Ribosome large Ribosome small functional Ribosome Fig. 15.2b(E rt) Ribosome Ribosome Structure & Function Peptide Bond Formation t RN binding sites Initiation Elongation ermination E = Exit site P = Peptide site = mino acid site MINO Large ribosomal Small ribosomal E P Ribosome functions: (1) decode the mrn (2) form peptide bonds mrn binding site RBOXYL E NIODON ODON P t RN t RN Fig d(E rt) Synthesis: Initiation Initiation Elongation ermination Fig a(E rt) Synthesis: Elongation E site = EXI P site = Peptide Site = mino acid trn site P site (occupied) trn Elongation factor NIODON ODON U U E site site U U U U mrn
6 Fig b(E rt) Fig c(E rt) Synthesis: Elongation Synthesis: ranslocation Peptide Bond Forms U U U U U U U U Fig d(E rt) Synthesis: ranslocation Fig e(E rt) Synthesis: Elongation & ranslocation 5 P site ytoplasm E site site trn U U U U trns bring their amino acids in at the site on the ribosome. Peptide bonds form between amino acids at the P site, and trns exit the ribosome from the E site. Fig b(E rt) Synthesis: ermination ene Expression Synthesis Val Ser la rp Polypeptide chain released ranslation consists of Initiation mrn, trn, and ribosome come together trn Elongation trns bring amino acids to the ribosome for incorporation into the elongating polypeptide. Release Factor ermination ribosome encounters a stop codon and releases polypeptide U U SOP ODON 36
7 RN & Synthesis in Prokaryotes Eukaryotic pre-mrn Splicing In eukaryotes, the final mrn transcript is not colinear with DN. In eukaryotes, the primary transcript must be modified by: addition of a cap addition of a poly- tail removal of non-coding sequences (introns) Fig a(E rt) Exon coding region mrn is processed in Eukaryotic ells Intron noncoding region Eukaryotic RN may be spliced in more than one way lternative splicing may generate two or more types of mrn from the same transcript Exons DN Primary RN transcript cap ranscription Introns are cut out and coding regions are spliced together poly- tail DN 1 o RN transcript mrn or Mature mrn transcript opyright 2005 Pearson Education, Inc. Publishing as Benjamin ummings Fig (E rt) RN & Synthesis - Prokaryotes and Eukaryotes Prokaryote chromosome Eukaryotic hromosome ranscription ranslation mrn DN Primary Intron ranscription RN transcript Processing mature mrn ap Poly- tail ranslation END ENE EXPRESSION END ene Expression
Molecular Biology: DNA, gene, chromosome and genome (Learning Objectives)
Molecular Biology: DN, gene, chromosome and genome (Learning bjectives) Nucleic acid structure and composition ompare and contrast the structure of DN and RN: features they share and how do they differ?
More informationDivision Ave. High School AP Biology
Division ve. High School Making s From ene to Protein How enes Work Organelles nucleus ribosomes endoplasmic reticulum (ER) olgi apparatus vesicles small nuclear pore ribosomal mrn large ribosomal cytoplasm
More information14 Gene Expression: From Gene to Protein
CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information
More informationBIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationGene Expression: From Gene to Protein
hapter 17 ene Expression: From ene to Protein Dr. Wendy Sera Houston ommunity ollege Biology 1406 The Flow of enetic Information The information content of genes is in the specific sequences of nucleotides
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationGene Expression Transcription
Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction
More informationFrom Gene to Phenotype- part 3. Lecture Outline 11/9/05. The genetic code. Translation: overview
DN mrn From ene to Phenotype- part 3 TRNSRIPTION DN 1 RN is transcribed from a DN template. 5 RN RN transcript polymerase RN PROESSIN Exon 2 In eukaryotes, the RN transcript RN transcript (premrn) is spliced
More informationGene Expression Translation U C A G A G
Why? ene Expression Translation How do cells synthesize polypeptides and convert them to functional proteins? The message in your DN of who you are and how your body works is carried out by cells through
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationKey Concept Translation converts an mrna message into a polypeptide, or protein.
8.5 Translation VOBLRY translation codon stop codon start codon anticodon Key oncept Translation converts an mrn message into a polypeptide, or protein. MIN IDES mino acids are coded by mrn base sequences.
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More informationUnit 4: Cell Development and Replication, Part II: Gene Expression
Name: Block: PKET 9 nit 4: ell Development and Replication, Part II: ene Expression Reading: hapter 9, plus 14.1 and 15.4 Date: Objectives: By the conclusion of this unit the student will be able to: 12.
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationMolecular Biology of the Gene
Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationNucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationAP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationChapter 2 - DNA MC [37 marks]
Chapter 2 - N MC [37 marks] 1. The image shows a N nucleotide. Which correctly identifies the parts labelled I and II? C 2. Which model represents transcription? 3. Which sequence represents the order
More informationMolecular Biology of the Gene
hapter 12: pp. 211-22 Molecular Biology of the ene 2 nm opyright he Mcraw-Hill ompanies, Inc. ermission required for reproduction or display. b. 0.4 nm.4 nm omplementary base pairing sugar-phosphate backbone
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationSelf-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 1 The Nature of Genes Early ideas to explain how genes work came from studying human diseases Archibald Garrod 1902 Recognized that alkaptonuria (black urine disease)
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationProtein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationDNA, RNA, protein synthesis. Sections , , and
DNA, RNA, protein synthesis Sections 14.1 14.5, 15.1 15.5, and 16.4 16.6 05-09-16 Today s class Extra-credit essay Activity on mitosis, meiosis, and inheritance Lecture and activities on the lecture Extra-credit
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationSection A: The Connection Between Genes and Proteins
CHAPTER 17 FROM GENE TO PROTEIN Section A: The Connection Between Genes and Proteins 1. The study of metabolic defects provided evidence that genes specify proteins 2. Transcription and translation are
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationChapter 9. Microbial Genetics. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Chapter 9 Microbial Genetics Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 9.1 Introduction to Genetics and Genes: Unlocking the Secrets of Heredity Genetics
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationTRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
More informationDo you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationFrom Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
More informationMolecular Biology: DNA, gene, chromosome and genome (Outline)
Molecular Biology: D, gene, chromosome and genome (utline) ucleic acid structure and composition D and R Base-pairing rule in D Definition of D, gene, chromosome and genome. D structure and chemical bonds
More informationTeacher Preparation Notes for "From Gene to Protein Transcription and Translation" 1
Teacher Preparation Notes for "From ene to Protein Transcription and Translation" 1 In this hands-on, minds-on activity students learn (1) how genes provide the instructions for making a protein via transcription
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More information1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
More informationAnswers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.
Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationMutate a DNA Sequence Student Instructions
ME DE Mutate a D equence tudent Instructions Background D replication happens whenever new cells are made, like when the organism is growing or healing a wound. lthough D replication is tightly regulated
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationThe Central Dogma of Molecular Biology
The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationThe DNA Molecule: The Molecular Basis of Inheritance
Slide hapter 6 he DN Molecule: he Molecular Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil ampbell and Jane Reece Lectures by hris Romero, updated by Erin Barley
More informationActivity A: Build a DNA molecule
Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More information2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.
From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2011 1 In this activity you will learn how
More informationFrom Gene to Protein Transcription and Translation i
How do genes influence our characteristics? From Gene to Protein Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More information3. INHERITED MUTATIONS
THE CENTRAL DOGMA OF BIOLOGY 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting,
More informationMolecular Biology of the Gene
hapter 12: pp. 211-232 BIOLOY 10th Edition Molecular Biology of the ene 2 nm opyright The Mcraw-Hill ompanies, Inc. Permission required for reproduction or display. b. 0.34 nm 3.4 nm T sugar-phosphate
More informationProtein Synthesis: Transcription and Translation
Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationPUC Vikasana Program- 2012
Chromosome Nucleus DNA PUC Vikasana Program- 2012 Introduction Molecular biology is the study of biology at a molecular level. Macromolecules and the macromolecular mechanisms. Interactions between the
More informationFlow of Genetic Information
Flow of Genetic Information Transcription and Translation Links to the Next Generation Standards Scientific and Engineering Practices: Asking Questions (for science) and Defining Problems (for engineering)
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More information