BABELOMICS: Microarray Data Analysis
|
|
- Ruth Hood
- 6 years ago
- Views:
Transcription
1 BABELOMICS: Microarray Data Analysis Madrid, 21 June 2010 Martina Marbà Bioinformatics and Genomics Department Centro de Investigación Príncipe Felipe (CIPF) (Valencia, Spain)
2 DNA Microarrays Paradigm of High Throughput Technologies Yield concentration measurements for : genes, SNP, exons, mrna... Measure cells in different biological conditions In a genomic scale Allow us conducting biological experiments So... How do they work?
3 Central Dogma of Molecular Biology CentralDogma3 For a cell, at a particular time, thousands of mrna are created and sent out of the nucleus to be translated into proteins. Protein concentration regulates biological systems.
4 DNA Microarrays
5 Biological Sample We want to know which genes are expressed under particular biological conditions. We can extract all mrna molecules that are being translated within the cells and provide an expression level indicator of its concentration in the biological sample.
6 RNA Extraction
7 Labelling the Sample Fluorescent Dye
8 Hybridization
9 Expression Measurement If the fluorescent label is attached to one spot we know that the particular complementary gene transcript was present in our cell sample. The greater the fluorescence the greater the concentration of the transcript.
10 Scanning the Microarray Measuring the intensity of the fluorescence in each spot We get a measurement of the hybridization in each spot of the microarray
11 The Data For each biological sample (individual) We get intensity measurements for thousands of genetic transcripts. The measured intensity is used as an indicator of gene expression _s_at _at _at _s_at _at _at _at _at _s_at _at _at _s_at _x_at _at _s_at _s_at _x_at _at _at _s_at _at _at _at _s_at _at
12 Several Microarrays
13 Data Matrix
14 How to treat the data??
15 Babelomics Pipeline
16 Definitions Babelomics One of the most complete integrated packages of tools for microarray data analysis available over the web A complete suite of web tools for functional analysis of genome-scale experiments
17 Babelomics Web
18 Questions Is there any significant difference in gene expression between tumor and healthy cells? Can we detect group of genes with similar expression profiles? Can we classify new biological samples based on gene expression patterns? Is there any significant functional enrichment in my gene list? Are these genes involved in the same disease?
19 Modules Gene Expression Analysis Normalization Differential Expression Clustering Predictors Functional Analysis FatiGO Fatiscan
20 Gene Expression Analysis Gene Expression Analysis
21 Normalization
22 Differential expression
23 Predictors
24 Clustering
25 Functional Analysis Fuctional Analysis
26 From data to functional interpretation Gene Expression Analysis Microarray Data Differential expression Preprocessing (Normalization, Scaling, ) Tab matrix file Predictors Clustering Genes differentially expressed Predicting genes Genes with same expression patterns Functional Analysis
27 Functional Analysis Babelomics, a suite of web tools for: statistical test, multiple test corrections, blast,... List of genes or ids, ie: differentially expressed genes,... Integrated Biological DB of Functional Annotation (GO, KEGG, InterPro, Ensembl, SwisProt, Transcription Factors, MicroRNA, Cisred, Biocarta, Bioentities Literature)
28 FatiGO
29 FatiGO features Compares two lists of genes. Compares one list of genes against the rest of the genome. One statistical test (Fisher s exact) for each Block of annotation. Multiple testing context. Filtering of annotation is convenient (the less tests the best correction).
30 FatiGO test One Gene List (A) The other list (B) Are this two groups of genes carrying out different biological roles? Biosynthesis 60% Biosynthesis 20% Sporulation Sporulation 20% Genes in group A have significantly to do with biosynthesis, but not with sporulation. Biosynthesis No biosynthesis A % B 2 8 We do this for each GO, mirna, Interpro,...!!!
31 FatiScan
32 FatiScan Interpret a ranked list of genes. There is not need for choosing a cut off. All information is included. One statistical test for each Block of annotation. Multiple testing context (hundreds of annotation). Filtering of annotation is convenient (the less tests the best correction).
33 FatiScan Testing along an ordered list Annotation label A List of genes Index ranking genes according to some biological aspect under study. + A B C Annotation label B Annotation label C Block of genes enriched in the annotation A Database that stores gene class membership information. Annotation C is homogeneously distributed along the list FatiScan searches over the whole ordered list, trying to find runs of functionally related genes. - Block of genes enriched in the annotation B
34 FatiScan results Significant results: Enriched class Annotated genes par GO from each list
35 Babelomics Running an Example...
36 Example Experiment description: Rheumatoid Arthritis and Osteoarthritis 15 Affymetrix (HG U133A), 38,500 genes Human 3 classes: control, osteoarthritis and rheumatoid arthritis
37 Example Rheumatoid Arthritis and Osteoarthritis Analysis: Normalization Differential expression FatiScan
38 Input form Normalization Select your data > browser server > select your data : affy_arthritis Analysis : RMA Job name : normalization_arthritis
39
40
41 Normalization Results
42 Normalization Results
43 Input form Differential expression (ND vs RA) Dataset file name : rma.summary.txt Class : CLASS [ND, RA] Test : t Multiple-test correction : fdr Adjusted p-value : 0.05 Job name : Diffexpr_2class_arthritis
44
45 Diff Expression Results
46 Diff Expression Results
47 Input form FatiScan Species : hsa Duplicates management : Never Fisher exact test : Over represented terms in list 2 Organism: Homo sapiens Data bases: GO biological process Job name : fatiscan_bottomlist_arhritis
48
49 FatiScan Results
50 Acknowledgements Supervisor: Joaquín Dopazo The GEPAS team: Fatima Al-Shahrour Eva Alloza José Carbonell Ana Conesa Pablo Escobar Francisco García Stefan Göetz Martina Marbà Ignacio Medina Pablo Mínguez David Montaner Luis Pulido Javier Santoyo Joaquín Tárraga
GEPAS and Babelomics. Ignacio Medina David Montaner Bioinformatics Department Functional Genomics Unit
GEPAS and Babelomics Ignacio Medina David Montaner Bioinformatics Department Functional Genomics Unit GEPAS/Babelomics Definitions GEPAS The Gene Expression Profile Analysis Suite is one of the most complete
More informationBioinformatica. Centro de Investigación Príncipe Felipe (CIPF), and Functional genomics node, (INB),
Bioinformatica Department of Bioinformatics and Genomics, (BIG) Centro de Investigación Príncipe Felipe (CIPF), and Functional genomics node, (INB), Valencia, Spain. http://www.gepas.org. http://www.babelomics.org
More informationHerramientas para el diseño y el análisis de datos de paneles de genes
Herramientas para el diseño y el análisis de datos de paneles de genes Hospital Sant Pau Barcelona, 16 Jun 2016 BIER Francisco García fgarcia@cipf.es Departamento de Genómica Computacional. CIPF Príncipe
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationMS bioinformatics analysis for proteomics. Protein anotations
MS bioinformatics analysis for proteomics Protein anotations UCO - Córdoba Organized by: ProteoRed, EUPA and Seprot Alberto Medina January, 23rd 2009 Summary Introduction Some issues Software: Fatigo -
More informationMicroRNA sequencing (mirnaseq)
, Robust experimental design Data analysis using the CAP-miRSeq: A comprehensive analysis pipeline for deep microrna sequencing E. Starr Hazard Over view of this first lecture 1) Review of very basic mirna
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationGenomes: What we know and what we don t know
Genomes: What we know and what we don t know Complete draft sequence 2001 October 15, 2007 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms!
More informationExploration and Analysis of DNA Microarray Data
Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing
More informationA NGS data analysis course
A NGS data analysis course Introduction Computational Genomics Department, Centro de Investigación Príncipe Felipe (CIPF), Functional Genomics Node, (INB), Bioinformatics Group (CIBERER) Spain. http://bioinfo.cipf.es
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationComplete draft sequence 2001
Genomes: What we know and what we don t know Complete draft sequence 2001 November11, 2009 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms
More informationIntro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits)
Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Some Basic Biology Genes are DNA sequences that code for proteins. (e.g. gene lengths perhaps 1000
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationHigh performance sequencing and gene expression quantification
High performance sequencing and gene expression quantification Ana Conesa Genomics of Gene Expression Lab Centro de Investigaciones Príncipe Felipe Valencia aconesa@cipf.es Next Generation Sequencing NGS
More informationUpstream/Downstream Relation Detection of Signaling Molecules using Microarray Data
Vol 1 no 1 2005 Pages 1 5 Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data Ozgun Babur 1 1 Center for Bioinformatics, Computer Engineering Department, Bilkent University,
More informationAnnotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station
Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Library preparation Sequencing Hypothesis testing Bioinformatics 2 Why annotate?
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationGene expression analysis: Introduction to microarrays
Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is
More informationBIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis
BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationIntroduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics
Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized
More informationAnnouncement Structure Analysis
Announcement Structure Analysis BSC 4439/BSC 5436: Biomedical Informatics: Structure Analysis Spring 2019, CB117 Monday and Wednesday 12:00 1:15pm Office hour: Monday and Wednesday 1:15 2pm Topics include
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationData Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationIdentifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer
Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Nagwan M. Abdel Samee 1, Nahed H. Solouma 2, Mahmoud Elhefnawy 3, Abdalla S. Ahmed 4, Yasser M. Kadah 5 1 Computer Engineering
More informationUnderstanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University
Understanding protein lists from proteomics studies Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu A typical comparative shotgun proteomics study IPI00375843
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationMicroarrays & Gene Expression Analysis
Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed
More informationSuberoylanilide Hydroxamic Acid Treatment Reveals. Crosstalks among Proteome, Ubiquitylome and Acetylome
Suberoylanilide Hydroxamic Acid Treatment Reveals Crosstalks among Proteome, Ubiquitylome and Acetylome in Non-Small Cell Lung Cancer A549 Cell Line Quan Wu 1, Zhongyi Cheng 2, Jun Zhu 3, Weiqing Xu 1,
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationVariant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
More informationAgilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008
Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationIntroduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis. Jenny Wu
Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis Jenny Wu Outline Introduction to NGS data analysis in Cancer Genomics NGS applications in cancer research Typical NGS
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationMeasuring gene expression (Microarrays) Ulf Leser
Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationNext-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
More informationStandard Data Analysis Report Agilent Gene Expression Service
Standard Data Analysis Report Agilent Gene Expression Service Experiment: S534662 Date: 2011-01-01 Prepared for: Dr. Researcher Genomic Sciences Lab Prepared by S534662 Standard Data Analysis Report 2011-01-01
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationEnsembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
More informationFunctional Annotation and Prioritization of Whole Exome and Whole Genome Sequencing Variants. Mulin Jun Li
Functional Annotation and Prioritization of Whole Exome and Whole Genome Sequencing Variants Mulin Jun Li 2017.04.19 Content Genetic variant, potential function impact and general annotation Regulatory
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationHuman Genomics. Higher Human Biology
Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary
More informationFeature Selection of Gene Expression Data for Cancer Classification: A Review
Available online at www.sciencedirect.com ScienceDirect Procedia Computer Science 50 (2015 ) 52 57 2nd International Symposium on Big Data and Cloud Computing (ISBCC 15) Feature Selection of Gene Expression
More informationWelcome! Introduction to High Throughput Genomics December Norwegian Microarray Consortium FUGE Bioinformatics platform
Introduction to High Throughput Genomics December 2011 Norwegian Microarray Consortium FUGE Bioinformatics platform Rita Holdhus Kjell Petersen Welcome! Course program Day 1 Thursday 1st December 2011
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationGene expression. What is gene expression?
Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying
More informationCS-E5870 High-Throughput Bioinformatics Microarray data analysis
CS-E5870 High-Throughput Bioinformatics Microarray data analysis Harri Lähdesmäki Department of Computer Science Aalto University September 20, 2016 Acknowledgement for J Salojärvi and E Czeizler for the
More informationAnalyzing Gene Set Enrichment
Analyzing Gene Set Enrichment BaRC Hot Topics June 20, 2016 Yanmei Huang Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Purpose of Gene Set Enrichment Analysis
More informationFunctional microrna targets in protein coding sequences. Merve Çakır
Functional microrna targets in protein coding sequences Martin Reczko, Manolis Maragkakis, Panagiotis Alexiou, Ivo Grosse, Artemis G. Hatzigeorgiou Merve Çakır 27.04.2012 microrna * micrornas are small
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationMeasuring gene expression
Measuring gene expression Grundlagen der Bioinformatik SS2018 https://www.youtube.com/watch?v=v8gh404a3gg Agenda Organization Gene expression Background Technologies FISH Nanostring Microarrays RNA-seq
More informationAgilent Genomics Software Future Directions
Agilent Genomics Software Future Directions Michael Rosenberg, PhD Director, Genomics Software Agilent: A Focused Measurement Company Serving Diverse End Markets Electronic Measurement 2008 Revenue: $3.6
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationIntroduction to Genome Biology
Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationWhat is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
More informationBioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.
Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationBioinformatics. Outline of lecture
Bioinformatics Uma Chandran, MSIS, PhD Department of Biomedical Informatics University of Pittsburgh chandran@pitt.edu 412 648 9326 07/08/2014 Outline of lecture What is Bioinformatics? Examples of bioinformatics
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationProtein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
More informationThe first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks.
Open Seqmonk Launch SeqMonk The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks. SeqMonk Analysis Page 1 Create
More informationLesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationA Microarray Analysis Teaching Module. for Hamilton College. July 2008 Megan Cole Post-doctoral Associate Whitehead Institute, MIT
A Microarray Analysis Teaching Module for Hamilton College July 2008 Megan Cole Post-doctoral Associate Whitehead Institute, MIT Lecture Topics I. Uses of microarrays developed in 1987 a. To measure gene
More informationIngenuity Pathway Analysis (IPA )
Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics
More informationShannon pipeline plug-in: For human mrna splicing mutations CLC bio Genomics Workbench plug-in CLC bio Genomics Server plug-in Features and Benefits
Shannon pipeline plug-in: For human mrna splicing mutations CLC bio Genomics Workbench plug-in CLC bio Genomics Server plug-in Features and Benefits Cytognomix introduces a line of Shannon pipeline plug-ins
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationMicroarrays The technology
Microarrays The technology Goal Goal: To measure the amount of a specific (known) DNA molecule in parallel. In parallel : do this for thousands or millions of molecules simultaneously. Main components
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationThe human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.
Data mining in Ensembl with BioMart Worked Example The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Which other genes related to human
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationFrom genome-wide association studies to disease relationships. Liqing Zhang Department of Computer Science Virginia Tech
From genome-wide association studies to disease relationships Liqing Zhang Department of Computer Science Virginia Tech Types of variation in the human genome ( polymorphisms SNPs (single nucleotide Insertions
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More information