Improved Splice Site Detection in Genie
|
|
|
- Ethel Holland
- 5 years ago
- Views:
Transcription
1 Improved Splice Site Detection in Genie Martin Reese Informatics Group Human Genome Center Lawrence Berkeley National Laboratory Santa Fe, 1/23/97
2 Database Homologies EST BLAST MPSRCH Types of Annotation GenPep Repeat t s Exon Predictions Genie GeneMark GeneFinder GRAIL Signals xpound promoter NN splice NN ORFs trnasearch
3 Gene Structure from Watson, Gilman, Witkowski, Zoller: Recombinant DNA, 1992 (modified from Chambon, 1981)
4 DNA: Schematic gene structure Promoter Exon 1 Exon 2 Exon 3 TSS Intron 1 Intron 2 ATG GT AG GT AG TAA transcription prerna: splicing Exon 1 Exon 2 Exon 3 Intron 1 Intron 2 ATG GT AG GT AG TAA mrna: Exon 1 Exon 2 Exon 3 ATG TAA AAAAAAAAA translation Protein: ATG TAA MPYCPLTW...GFL amino acid sequence
5 GeneFinding Methods (Staden 82, 84; Fickett, 82; Gribskov, 82) search by content codon usage, codon bias search by signal start codon, stop codon, splice sites search by homology database sequence homology
6 Popular Gene Finding Algorithms GRAIL (E. Uberbacher et al.) Genefinder (P. Green) GeneID (R. Guigo) GeneParser (E. Snyder and G. Stormo) Xpound (A. Thomas) GeneMark (M. Borodovsky) GENLANG (D. Searls) FGENEH (V. Solovyev) GENSCANW (C. Burge)
7 Problems in GeneFinding data biased integrate homology searches long introns atypical exons gene assembly multiple genes edges alternative splicing
8 Genefinding Strategies Develop New Feature Detectors Develop Gene Model Link in Database Information Find Structural Homologies
9 33,371 17,356 13, sequences in GenBank no CDS annotation no introns inconsistent CDS annotation multiple CDS entries no or wrong STOP codon no or wrong START codon atypical splice sites STOP in frame similar or related genes GenBank, Release 89, 5/95
10 Problems with Public Databases Organization Access Security Data Quality
11 Linear Hidden Markov Model
12 Generalized HMM for genes
13 Sensors in Genie content sensors length distribution codon submodel GC content sensor splice site HMM profile DB match
14 Sensors in Genie Signal Sensors Promoter NN Start codon NN Donor site NN Acceptor Site NN Stop codon
15 Splice Site Detectors version 1, modeled after Brunak et al., JMB, 1991 trained to distinguish GTs/AGs from real donor/acceptor sites version 2, modeled after Henderson and Salzberg, ISMB, 1996 dinucleotide pairs as inputs
16 Donor-Acceptor Neural Networks
17 Performance
18 Results Donor and acceptor neural network performance False Positive Rates (FP) splice sites recognized Donor neural network FP (CC) Acceptor neural network FP (C C) 85% 3.18% (0.827) 3.68% (0.819) 90% 4.16% (0.850) 4.78% (0.816) 95% 5.89% (0.835) 9.09% (0.766) 98% 9.20% (0.805) 14.15% (0.704) Kulp et al. PSB 97
19 Results Donor and acceptor neural network performance False Positive Rates (FP) splice sites recognized Donor neural network FP (CC) Acceptor neural network FP (C C) 85% 3.17% (0.840) 3.51% (0.816) 90% 3.52% (0.860) 4.55% (0.834) 95% 4.93% (0.862) 7.97% (0.797) 98% 6.57% (0.856) 17.53% (0.677) Reese et al. RECOMB 97
20 Exon Length vs. Donor Score
21 Exon Length vs. Acceptor Score
22 Score vs. Exon Length
23 Donor Site Prediction Correct predictions and false positives for 4 donor neural networks trained with different training sets.
24 Predictions in Splice Site Regions Predicted scores for GT / AG sites in the splice site regions.
25 Performance (6/96) Gene finder Per Base Exact Exon Sn Sp AC Sn Sp Avg ME WE Part Part Part Part Part Part Part Kulp, Haussler, Reese, Eeckman. ISMB 96, St. Louis.
26 Performance (8/96) Gene finder Per Base Exact Exon Sn Sp AC Sn Sp Avg ME WE Part Part Part Part Part Part Part Kulp et al. PSB 97
27 Performance Per Base Exact Exon Sn Sp AC Sn Sp Avg ME WE UCSC/LBNL Data Set Average ISMB Average PSB Average RECOMB B/G Data Set ISMB PSB RECOMB
28 Genie for Drosophila Melanogaster Preliminary results Per Base Exact Exon Sn Sp AC Sn Sp Avg ME WE Human (288 genes) Average RECOMB Drosophila melanogaster (202 genes) Average RECOMB
29 Performance 9/96 (B/G data set) Gene finder Per Base Exact Exon Sn Sp AC Sn Sp Avg ME WE Genie FGENEH GeneID GeneParser GenLang GRAIL II SORFIND Xpound Reese, Eeckman, Kulp, Haussler. RECOMB 97
30 Performance with homology Gene finder Per Base Exact Exon Sn Sp AC Sn Sp Avg ME WE Genie Data Set Genie PSB Genie RECOMB B/G Data Set Genie PSB Genie RECOMB GeneID GeneParser Reese, Eeckman, Kulp, Haussler. RECOMB 97
31 Antennapedia Region Genotater by Nomi Harris based on BioTK by Gregg Helt
32 Conclusions Access to Good Data Sets Split splice data into reading frames Strong correlations in neighboring Dinucleotides Integrate Homology Information Non-functional GT/AG Sites in Splice Regions have low Scores URL:
33 Future Work Improved Intron and Intergenic Models Multiple/Partial Genes (Gene clusters) Separate Exon Prediction User Constraints Integrating EST/cDNA databases Other Organisms (C.elegans,...)
34 Genie Collaboration UCSC David Kulp Kevin Karplus David Haussler LBNL Frank Eeckman Nomi Harris UCB Gerry Rubin
G. Reese, Frank II. Eeckman
Ilrl~>roved :jp11ct: Site Detection in Genie Martin G. Reese, Frank II. Eeckman Human Genome Informatics Group Lawrence Berkeley National Laboratory 1 Cyclotron Road, Berkeley, CA 94720 mgreese@xbl.gov,
Model. David Kulp, David Haussler. Baskin Center for Computer Engineering and Computer Science.
Integrating Database Homology in a Probabilistic Gene Structure Model David Kulp, David Haussler Baskin Center for Computer Engineering and Computer Science University of California, Santa Cruz CA, 95064,
Gene finding: putting the parts together
Gene finding: putting the parts together Anders Krogh Center for Biological Sequence Analysis Technical University of Denmark Building 206, 2800 Lyngby, Denmark 1 Introduction Any isolated signal of a
CSE 527 Computational Biology Autumn Lectures ~14-15 Gene Prediction
CSE 527 Computational Biology Autumn 2004 Lectures ~14-15 Gene Prediction Some References A great online bib http://www.nslij-genetics.org/gene/ A good intro survey JM Claverie (1997) "Computational methods
Gene Prediction in Eukaryotes
Gene Prediction in Eukaryotes Jan-Jaap Wesselink Biomol Informatics, S.L. jjw@biomol-informatics.com June 2010/Madrid jjw@biomol-informatics.com (BI) Gene Prediction June 2010/Madrid 1 / 34 Outline 1 Gene
CSE 527 Computational Biology" Gene Prediction"
CSE 527 Computational Biology" Gene Prediction" Gene Finding: Motivation" Sequence data flooding in" What does it mean?" "protein genes, RNA genes, mitochondria, chloroplast, regulation, replication, structure,
Methods and Algorithms for Gene Prediction
Methods and Algorithms for Gene Prediction Chaochun Wei 韦朝春 Sc.D. ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Shanghai Jiao Tong University Shanghai Center for Bioinformation Technology 5/12/2011 K-J-C
Outline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions
Outline Introduction to ab initio and evidence-based gene finding Overview of computational gene predictions Different types of eukaryotic gene predictors Common types of gene prediction errors Wilson
Outline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation
Tues, Nov 29: Gene Finding 1 Online FCE s: Thru Dec 12 Thurs, Dec 1: Gene Finding 2 Tues, Dec 6: PS5 due Project presentations 1 (see course web site for schedule) Thurs, Dec 8 Final papers due Project
Genie Gene Finding in Drosophila melanogaster
Methods Gene Finding in Drosophila melanogaster Martin G. Reese, 1,2,4 David Kulp, 2 Hari Tammana, 2 and David Haussler 2,3 1 Berkeley Drosophila Genome Project, Department of Molecular and Cell Biology,
Evaluation of Gene-Finding Programs on Mammalian Sequences
Letter Evaluation of Gene-Finding Programs on Mammalian Sequences Sanja Rogic, 1 Alan K. Mackworth, 2 and Francis B.F. Ouellette 3 1 Computer Science Department, The University of California at Santa Cruz,
Profile HMMs. 2/10/05 CAP5510/CGS5166 (Lec 10) 1 START STATE 1 STATE 2 STATE 3 STATE 4 STATE 5 STATE 6 END
Profile HMMs START STATE 1 STATE 2 STATE 3 STATE 4 STATE 5 STATE 6 END 2/10/05 CAP5510/CGS5166 (Lec 10) 1 Profile HMMs with InDels Insertions Deletions Insertions & Deletions DELETE 1 DELETE 2 DELETE 3
UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
GenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs
Gene Finding GenBank Growth GenBank Growth In 2003 ~ 31 million sequences ~ 37 billion base pairs GenBank: Exponential Growth Growth of GenBank in billions of base pairs from release 3 in April of 1994
CSEP 590 B Computational Biology. Genes and Gene Prediction
CSEP 590 B Computational Biology Genes and Gene Prediction 1 Some References (more on schedule page) A good intro survey JM Claverie (1997) "Computational methods for the identification of genes in vertebrate
Gene Structure & Gene Finding Part II
Gene Structure & Gene Finding Part II David Wishart david.wishart@ualberta.ca 30,000 metabolite Gene Finding in Eukaryotes Eukaryotes Complex gene structure Large genomes (0.1 to 10 billion bp) Exons and
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Gene Prediction 10/21/05
Gene Prediction 1/21/5 1/21/5 Gene Prediction Announcements Eam 2 - net Friday Posted online: Eam 2 Study Guide 544 Reading Assignment (2 papers) (formerly Gene Prediction - ) 1/21/5 D Dobbs ISU - BCB
Gene Prediction. Mario Stanke. Institut für Mikrobiologie und Genetik Abteilung Bioinformatik. Gene Prediction p.
Gene Prediction Mario Stanke mstanke@gwdg.de Institut für Mikrobiologie und Genetik Abteilung Bioinformatik Gene Prediction p.1/23 Why Predict Genes with a Computer? tons of data 39/250 eukaryotic/prokaryotic
Phat a gene finding program for Plasmodium falciparum
Molecular & Biochemical Parasitology 118 (2001) 167 174 www.parasitology-online.com. Phat a gene finding program for Plasmodium falciparum Simon E. Cawley a,b, *, Anthony I. Wirth c, Terence P. Speed a
ab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
Gene finding. Lorenzo Cerutti Swiss Institute of Bioinformatics. EMBNet course, September 2002
Gene finding Lorenzo Cerutti Swiss Institute of Bioinformatics EMBNet course, September 2002 Introduction Gene finding is about detecting coding regions and infer gene structure Gene finding is difficult
Applications of HMMs in Computational Biology. BMI/CS Colin Dewey
Applications of HMMs in Computational Biology BMI/CS 576 www.biostat.wisc.edu/bmi576.html Colin Dewey cdewey@biostat.wisc.edu Fall 2008 The Gene Finding Task Given: an uncharacterized DNA sequence Do:
Gene Prediction Background & Strategy Faction 2 February 22, 2017
Gene Prediction Background & Strategy Faction 2 February 22, 2017 Group Members: Michelle Kim Khushbu Patel Krithika Xinrui Zhou Chen Lin Sujun Zhao Hannah Hatchell rohini mopuri Jack Cartee Introduction
Genomic region (ENCODE) Gene definitions
DNA From genes to proteins Bioinformatics Methods RNA PROMOTER ELEMENTS TRANSCRIPTION Iosif Vaisman mrna SPLICE SITES SPLICING Email: ivaisman@gmu.edu START CODON STOP CODON TRANSLATION PROTEIN From genes
Recognition of Human Genes by Stochastic Parsing
Recognition of Human Genes by Stochastic Parsing Kiyoshi Asai, Katunobu Itou, Yutaka Deno Genome Informatics Group, Electrotechnical Laboratories, 1-1-4 Umezono, Tsukuba, 305 Japan asai, kilo, ueno@etl.go.jp
Some References (more on schedule page) CSE 527 Computational Biology Autumn Motivation. Protein Coding Nuclear DNA
CSE 527 Computational Biology Autumn 2006 Lectures 13-14 Gene Prediction Some References (more on schedule page) An extensive online bib http://www.nslij-genetics.org/gene/ A good intro survey JM Claverie
Some References (more on schedule page) CSEP 590A Computational Biology Summer Motivation. Protein Coding Nuclear DNA
CSEP 590A Computational Biology Summer 2006 Lecture 7 Gene Prediction Some References (more on schedule page) An extensive online bib http://www.nslij-genetics.org/gene/ A good intro survey JM Claverie
Small Exon Finder User Guide
Small Exon Finder User Guide Author Wilson Leung wleung@wustl.edu Document History Initial Draft 01/09/2011 First Revision 08/03/2014 Current Version 12/29/2015 Table of Contents Author... 1 Document History...
Evidence Combination in Hidden Markov Models for Gene Prediction
Evidence Combination in Hidden Markov Models for Gene Prediction by Bronislava Brejová A thesis presented to the University of Waterloo in fulfilment of the thesis requirement for the degree of Doctor
Genscan. The Genscan HMM model Training Genscan Validating Genscan. (c) Devika Subramanian,
Genscan The Genscan HMM model Training Genscan Validating Genscan (c) Devika Subramanian, 2009 96 Gene structure assumed by Genscan donor site acceptor site (c) Devika Subramanian, 2009 97 A simple model
CABIOS. A method for identifying splice sites and translationai start sites in eukaryotic mrna. Steven LSalzberg
CABIOS Vol. 3 no. 4 997 Pages 365-376 A method for identifying splice sites and translationai start sites in eukaryotic mrna Steven LSalzberg Abstract This paper describes a new method for determining
Using Expressing Sequence Tags to Improve Gene Structure Annotation
Washington University in St. Louis Washington University Open Scholarship All Computer Science and Engineering Research Computer Science and Engineering Report Number: WUCS-2006-25 2006-05-01 Using Expressing
EECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 08: Gene finding aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggc tatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt
Lecture 7 Motif Databases and Gene Finding
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC
Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
Gene Finding Genome Annotation
Gene Finding Genome Annotation Gene finding is a cornerstone of genomic analysis Genome content and organization Differential expression analysis Epigenomics Population biology & evolution Medical genomics
Gene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
Homework 4. Due in class, Wednesday, November 10, 2004
1 GCB 535 / CIS 535 Fall 2004 Homework 4 Due in class, Wednesday, November 10, 2004 Comparative genomics 1. (6 pts) In Loots s paper (http://www.seas.upenn.edu/~cis535/lab/sciences-loots.pdf), the authors
132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading:
132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, 214 1 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading:
Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, 211 155 12 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel
How to design an HMM for a new problem. HMM model structure. Inherent limitation of HMMs. Duration modeling. Duration modeling
How to design an HMM for a new problem Architecture/topology design: What are the states, observation symbols, and the topology of the state transition graph? Learning/Training: Fully annotated or partially
Annotating eukaryote genomes Suzanna Lewis*, Michael Ashburner and Martin G Reese
349 Annotating eukaryote genomes Suzanna Lewis*, Michael Ashburner and Martin G Reese The Genome Annotation Assessment Project tested current methods of gene identification, including a critical assessment
Lecture 10. Ab initio gene finding
Lecture 10 Ab initio gene finding Uses of probabilistic sequence Segmentation models/hmms Multiple alignment using profile HMMs Prediction of sequence function (gene family models) ** Gene finding ** Review
Eukaryotic Gene Prediction. Wei Zhu May 2007
Eukaryotic Gene Prediction Wei Zhu May 2007 In nature, nothing is perfect... - Alice Walker Gene Structure What is Gene Prediction? Gene prediction is the problem of parsing a sequence into nonoverlapping
MODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009)
Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009) Prerequisites: BLAST Exercise: An In-Depth Introduction to NCBI BLAST Familiarity
Gene Prediction with Conditional Random Fields Abstract Introduction
Gene Prediction with Conditional Random Fields Aron Culotta, David Kulp and Andrew McCallum Department of Computer Science University of Massachusetts Amherst, MA 01002 {culotta, dkulp, mccallum}@cs.umass.edu
Annotating the Genome (H)
Annotating the Genome (H) Annotation principles (H1) What is annotation? In general: annotation = explanatory note* What could be useful as an annotation of a DNA sequence? an amino acid sequence? What
reviewed in detail by (Kornberg, 996, and other articles in the same issue) or (Nikolov and Burley, 997). The survey of Fickett and Hatzigeorgiou (997
Interpolated Markov Chains for Eukaryotic Promoter Recognition Uwe Ohler ;2, Stefan Harbeck, Heinrich Niemann, Elmar Noth, and Martin G. Reese 2 Chair for Pattern Recognition (Computer Science V) University
Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
Bacterial Genome Annotation
Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control
Applications of hidden Markov models to sequence analysis. Lior Pachter
Applications of hidden Markov models to sequence analysis Lior Pachter Outline Why do we analyze sequences? What are we looking for? Annotation of DNA sequences I (and HMMs) Alignment Annotation of DNA
Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
May 16. Gene Finding
Gene Finding j T[j,k] k i Q is a set of states T is a matrix of transition probabilities T[j,k]: probability of moving from state j to state k Σ is a set of symbols e j (S) is the probability of emitting
Gene & genome organisation. Computational gene identification
Gene & genome organisation Computational gene identification Eubacterial gene Eukaryotic gene Regulatory elements Promoter Translation start Introns polya signal Transcription stop DNA Transcription
Computational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
ProGen: GPHMM for prokaryotic genomes
ProGen: GPHMM for prokaryotic genomes Sharad Akshar Punuganti May 10, 2011 Abstract ProGen is an implementation of a Generalized Pair Hidden Markov Model (GPHMM), a model which can be used to perform both
Computational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
Chapter 4 METHOD FOR PREDICTING GENES IN EUKARYOTIC GENOMES
qene Prediction Chapter 4 METHOD FOR PREDICTING GENES IN EUKARYOTIC GENOMES 4.1 INTRODUCTION Evaluation of seven ab initio methods that were evaluated on a non-homologous mammalian data set (Rogic et al.
BIOINFORMATICS. Interpolated Markov chains for eukaryotic promoter recognition. Abstract. Introduction. 362 Oxford University Press
BIOINFORMATICS Interpolated Markov chains for eukaryotic promoter recognition Abstract Motivation: We describe a new content-based approach for the detection of promoter regions of eukaryotic protein encoding
GENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS. Olivier GARSMEUR & Stéphanie SIDIBE-BOCS
GENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS Olivier GARSMEUR & Stéphanie SIDIBE-BOCS Introduction two main concepts: Identify the different elements of the genome, (location and stucture) :
Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
![Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G](/thumbs/95/123686269.jpg "Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G")
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
Gene Structure Prediction From Many. Engineering Sciences Lab 102. Harvard University. Phone: (617)
Gene Structure Prediction From Many Attributes Adam A. Deaton Rocco A. Servedio Engineering Sciences Lab 102 Division of Engineering and Applied Sciences Harvard University Cambridge, MA 02138 faabd,roccog@cs.harvard.edu
FEATURE EXTRACTION FROM DNA SEQUENCES
of 6 FEATURE EXTRACTION FROM DNA SEQUENCES BY MULTIFRACTAL ANALYSIS H. Zhang and W. Kinsner Department of Electrical and Computer Engineering, Signal and Data Compression Laboratory University of Manitoba,
TIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
International Journal of Engineering & Technology IJET-IJENS Vol:14 No:01 9
International Journal of Engineering & Technology IJET-IJENS Vol:14 No:01 9 Analysis on Clustering Method for HMM-Based Exon Controller of DNA Plasmodium falciparum for Performance Improvement Alfred Pakpahan
Genome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
Integrating Genomic Homology into Gene Structure Prediction
BIOINFORMATICS Vol. 1 Suppl. 1 2001 Pages S1 S9 Integrating Genomic Homology into Gene Structure Prediction Ian Korf 1, Paul Flicek 2, Daniel Duan 1 and Michael R. Brent 1 1 Department of Computer Science,
9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
#26 - Gene Prediction 10/22/07
BCB 444/544 Required Reading (before lecture) Lecture 26 Mon Oct 22 - Lecture 26 Gene Prediction Chp 8 - pp 97-112 Gene Prediction Wed Oct 24 - Lecture 27 (will not be covered on Exam 2) Regulatory Element
EGPred: Prediction of Eukaryotic Genes Using Ab Initio Methods After Combining With Sequence Similarity Approaches
Methods EGPred: Prediction of Eukaryotic Genes Using Ab Initio Methods After Combining With Sequence Similarity Approaches Biju Issac and Gajendra Pal Singh Raghava 1 Institute of Microbial Technology,
Evaluation of Gene Structure Prediction Programs
GENOMICS 34, 353 367 (1996) ARTICLE NO. 0298 Evaluation of Gene Structure Prediction Programs MOISÈS BURSET AND RODERIC GUIGÓ 1 Departament d Informàtica Mèdica, Institut Municipal d Investigació Mèdica
Computational Gene Finding
Computational Gene Finding Dong Xu Digital Biology Laboratory Computer Science Department Christopher S. Life Sciences Center University of Missouri, Columbia E-mail: xudong@missouri.edu http://digbio.missouri.edu
New Methods for Splice Site Recognition
New Methods for Splice Site Recognition S. Sonnenburg, G. Rätsch, A. Jagota, and K.-R. Müller Fraunhofer FIRST, Kekuléstr. 7, 12489 Berlin, Germany Australian National University, Canberra, ACT 0200, Australia
Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar
Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification
Genome 373: Gene Predic/on I. Doug Fowler
Genome 373: Gene Predic/on I Doug Fowler Outline Review of gene structure Scale of the problem Solu;ons Empirical methods Ab ini&o predic;on What is a gene? A locatable region of genomic sequence, corresponding
What is a Gene? Snyder and Gerstein, Science Gene Finding Questions
ues, Nov 28: ene Finding 1 Online FE s: hru Dec 11 hurs, Nov 30: ene Finding 2 ues, Dec 5: PS5 due in my office at 5pm. Project presentation preparation no class hurs, Dec 7 Final papers due Project presentations
Annotating Fosmid 14p24 of D. Virilis chromosome 4
Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome
Uncorrected Proof Copy Finding Genes by Using Computational Tools 85
Finding Genes by Using Computational Tools 85 II IN SILICO PREDICTION OF PLANT GENE FUNCTION 86 Davuluri and Zhang Finding Genes by Using Computational Tools 87 6 Computer Software to Find Genes in Plant
AC Algorithms for Mining Biological Sequences (COMP 680)
AC-04-18 Algorithms for Mining Biological Sequences (COMP 680) Instructor: Mathieu Blanchette School of Computer Science and McGill Centre for Bioinformatics, 332 Duff Building McGill University, Montreal,
Genes and gene finding
Genes and gene finding Ben Langmead Department of Computer Science You are free to use these slides. If you do, please sign the guestbook (www.langmead-lab.org/teaching-materials), or email me (ben.langmead@gmail.com)
AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG
AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT AGCTAGGCTCCGGATGCGACCAGCTTTGATAGATGAATATAGTGT
Steve Thompson 9/25/03. Introduction to BioInformatics BSC4933/5936. Florida State University Department of Biology
Introduction to BioInformatics BSC4933/5936 Florida State University Department of Biology www.bio.fsu.edu October 2, 2003 Genomics Steven M. Thompson Florida State University School of Computational Science
Computational gene finding. Devika Subramanian Comp 470
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Lec 2 Lec 3 Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
Outline. 1. Introduction. 2. Exon Chaining Problem. 3. Spliced Alignment. 4. Gene Prediction Tools
Outline 1. Introduction 2. Exon Chaining Problem 3. Spliced Alignment 4. Gene Prediction Tools Section 1: Introduction Similarity-Based Approach to Gene Prediction Some genomes may be well-studied, with
March 9, Hidden Markov Models and. BioInformatics, Part I. Steven R. Dunbar. Intro. BioInformatics Problem. Hidden Markov.
and, and, March 9, 2017 1 / 30 Outline and, 1 2 3 4 2 / 30 Background and, Prof E. Moriyama (SBS) has a Seminar SBS, Math, Computer Science, Statistics Extensive use of program "HMMer" Britney (Hinds)
Edward C. Uberbacher, Ying Xu, Manesh Shah, Sherri Matis Xiaojun Guan and Richard J. Mural'
e - DNA Sequence Pattern Recognition Methods ingrail* Edward C. Uberbacher, Ying Xu, Manesh Shah, Sherri Matis Xiaojun Guan and Richard J. Mural' :omputer Informatics Group Science and Mathematics Division
DNA is normally found in pairs, held together by hydrogen bonds between the bases
Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,
Genome 373: Hidden Markov Models III. Doug Fowler
Genome 373: Hidden Markov Models III Doug Fowler Review from Hidden Markov Models I and II We talked about two decoding algorithms last time. What is meant by decoding? Review from Hidden Markov Models
FAST AND ACCURATE GENE PREDICTION BY PROTEIN HOMOLOGY
FAST AND ACCURATE GENE PREDICTION BY PROTEIN HOMOLOGY by Rong She Master of Science, Simon Fraser University, 2003 Bachelor of Engineering, Shanghai Jiaotong University, 1993 THESIS SUBMITTED IN PARTIAL
Transcription Start Sites Project Report
Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:
Gene Prediction: Statistical Approaches
Gene Prediction: Statistical Approaches Outline 1. Central Dogma and Codons 2. Discovery of Split Genes 3. Splicing 4. Open Reading Frames 5. Codon Usage 6. Splicing Signals 7. TestCode Section 1: Central
SLAM: Cross-Species Gene Finding and Alignment with a Generalized Pair Hidden Markov Model
Methods SLAM: Cross-Species Gene Finding and Alignment with a Generalized Pair Hidden Markov Model Marina Alexandersson, 1 Simon Cawley, 2 and Lior Pachter 3,4 1 Department of Statistics, University of
Homologous Gene Finding with a Hidden Markov Model
Homologous Gene Finding with a Hidden Markov Model by Xuefeng Cui A thesis presented to the University of Waterloo in fulfilment of the thesis requirement for the degree of Master of Mathematics in Computer