Bioinformatics for Cell Biologists
|
|
- Margaret Sullivan
- 5 years ago
- Views:
Transcription
1 Bioinformatics for Cell Biologists Rickard Sandberg Karolinska Institutet May 2013
2 OUTLINE INTRODUCTION Introduce yourselves HISTORY MODERN What is bioinformatics today? COURSE ONLINE LEARNING OPPORTUNITIES
3 INTRODUCE YOURSELVES 1-minute summary Project (1 sentence summary) Bioinformatics resources you are currently using Expectations of the course
4 THE ORIGIN Bioinformatics as a subject was born when we obtained methods to read DNA and protein sequences When the number of protein and DNA sequences made manual sequence comparisons and alignments impractical
5 MARGARET DAYHOFF Margaret Dayhoff, Started the Atlas of Protein Sequence and Structure (1969) Started the Protein Identification Resource (1972) to search for related sequences (homology) to infer evolutionary relationships (phylogeny) substition matrix, 1-letter amino acid code, point-accepted-mutations (PAM)
6 MILESTONES IN ALGORITHMIC DEVELOPMENT Algorithmic development in sequence comparisons Needleman-Wunch algorithm (1970) Smith-Waterman algorithm for alignment (1981) FASTP algorithm by Lipman and Pearson (1985) FASTA algorithm by Pearson, Lipman (1988) BLAST program implemented (Altshul et al.) (1990) BLAT program by Jim Kent (2000s)
7 DATABASES Institutes and centers for bioinformatics National Center for Biotechnological Information, NCBI (1988) European Bioinformatics Institute, EBI (1992) Famous databases established Swiss-Prot database created by University of Geneva and EMBL (1986) PRINTS database of protein motifs (Attwood and Beck) 1994 GenBank by NCBI (1982), EMBL-Bank (1980)
8 GENBANK (NCBI) SEQUENCE GROWTH
9 DATABASES CONTAINING INFORMATION OF HUMAN SEQUENCE VARIATION
10 COMPARATIVE GENOMICS
11 METAGENOMICS
12 COMMON PATTERN TO ALL THESE DATA
13 DEFINITION Computational methods for the anaylses of biological processes
14 IMPORTANT ASPECTS OF BIOINFORMATICS Tools that drive new biological discoveries Extends experiments one single genes - allows for generalization Have changed how we make experiments Storage, indexing, retrieval, comparison and visualization of biological data
15 BIOINFORMATICS-BASED DISCOVERIES Comparative genomics was imperative in identifying the microrna:rna interaction rules
16 GENOME-WIDE MINDSET Genomics are changing the way we ask questions in biology
17 When graduate students approach me these days about what is an interesting area to go into if you want to make a major contribution to biomedical research, the first thing out of my mouth is bioinformatics we are woefully short in terms of having a critical mass of people who understand both biology and computational approaches Francis Collins, director of the National Human Genome Research Institute
18 In the future, use of biological information collected in repositories, will play an ever increasingly important role in biology. European Molecular Biology Organization, EMBO, is considering information biology as one of the cornerstones of modern/future biology!
19 PROGRAM Bioinformatics for Cell Biologists May 2013 Mon 13th Tue 14th Wed 15th Thu 16th Fri 17th 9 am Introduction Alignments Gene expression analyses Genome-wide methods to Preparation time for :15 Rickard S. Åsa B. Rickard S. study translational regulation individual presentations :30 Ola Larsson, CCK :45 10 am Introduction Protein bioinformatics Network analyses of gene Statistics for Genomic Examination :15 Rickard S. Åsa B. expression data Studies presentations :30 Erik Fredlund, MTC Rickard S. (7+3 min per person) :45 Rickard, Åsa och Daniel 11 am Bioinformatics Phylogeny Next-gen bioinformatics ChIP-Seq data analyses Examination :15 Overview Lars Arvestad, SciLife Rickard S. Mikael Huss, SciLife presentations :30 Rickard S. (7+3 min per person) :45 Rickard, Åsa och Daniel 12 PM :15 L U N C H L U N C H L U N C H L U N C H L U N C H :30 :45 1 PM Computer lab 1. Computer lab 2. Computer lab 3. Computer lab 4. Examination :15 Genomic resources Alignments, Protein Gene expression with ChIP-Seq analyses in Galaxy presentations :30 bioinformatics microarrays and RNA-Seq How to use public (7+3 min per person) :45 repositories Rickard, Åsa och Daniel 2 PM Examination :15 Rickard Åsa och Daniel Rickard och Daniel Rickard och Daniel presentations :30 (7+3 min per person) :45 Rickard, Åsa och Daniel 3 PM :15 :30 :45 4 PM :15 :30 :45 5 PM Room A216, CMB, Berzelius väg 35 Enter, Computer lab, Utopia, Berzelius (close to Restaurant Jöns Jacob and KI library)
20 PRACTICALS All lectures will be in room A216 Code to enter the doors: 2000 All computer labs in Utopia Examination in A216 (powerpoint or white board)
21 EXAMINATION Methods workshop Recieve a Nature Biotechnology methods primer Task: present the method for the rest of the class 10 min (7+3) individual presentations Examiners: Me, Asa and Daniel Friday
22 TYPES OF BIOINFORMATIC ANALYSES Use bioinformatics resources online (tools and db) Use bioinformatics software environments (e.g. R) Develop new tools to address new questions (e.g. python, perl)
23 ONLINE COURSES OVERVIEW
24 I NTRODUCTION COURSERA H ISTORY M ODERN C OURSE O NLINE L EARNING O PPORTUNITIES
25 GALAXY
26 ROSALIND
27 SOFTWARE CARPENTRY
28 COFFEE Questions?
Bioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationCS 177 Introduction to Bioinformatics
CS 177 to Dr. Tom Wilke Department of Microbiology and Tropical Medicine e-mail: mtmtxw@gwumc.edu Tel.: 202 994 3635 Prof. Rahul Simha? School of Engineering and Applied Science (SEAS) e-mail: simha@seas.gwu.edu
More informationPractical Bioinformatics for Biologists (BIOS 441/641)
Practical Bioinformatics for Biologists (BIOS 441/641) - Course overview Yanbin Yin MO444 1 Room and computer access Room entry code: 2159 Computer access: user poduser 2 Compared to BIOS 443/643 and 646
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationComparative Bioinformatics. BSCI348S Fall 2003 Midterm 1
BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationBig picture and history
Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationKlinisk kemisk diagnostik BIOINFORMATICS
Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,
More informationPractical Bioinformatics for Biologists (BIOS493/700)
Practical Bioinformatics for Biologists (BIOS493/700) - Course overview Yanbin Yin Spring 2013 MO444 1 BIOS 643 and 646 Minimum theoretical intro A LOT of practical applications Goal: enhance the use of
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
More informationMARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305
MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What
More informationGNET 744 Biological Sequence Analysis, Protein Structure and Genome-Wide Data
GNET 744 Biological Sequence Analysis, Protein Structure and Genome-Wide Data This course provides an introduction to basic protein structure/function analyses, sequencing informatics and macromolecular
More informationScoring Alignments. Genome 373 Genomic Informatics Elhanan Borenstein
Scoring Alignments Genome 373 Genomic Informatics Elhanan Borenstein A quick review Course logistics Genomes (so many genomes) The computational bottleneck Python: Programs, input and output Number and
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationCompiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology
Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationWhat is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.
What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer
More informationG4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
More informationChallenging algorithms in bioinformatics
Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use
More informationSingle alignment: FASTA. 17 march 2017
Single alignment: FASTA 17 march 2017 FASTA is a DNA and protein sequence alignment software package first described (as FASTP) by David J. Lipman and William R. Pearson in 1985.[1] FASTA is pronounced
More informationWhat is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools
CAP 5510: Introduction to Bioinformatics : Bioinformatics Tools ECS 254A / EC 2474; Phone x3748; Email: giri@cis.fiu.edu My Homepage: http://www.cs.fiu.edu/~giri http://www.cs.fiu.edu/~giri/teach/bioinfs15.html
More informationSECTION ONE Introduction and Biological Databases
SECTION ONE Introduction and Biological Databases CHAPTER ONE Introduction Quantitation and quantitative tools are indispensable in modern biology. Most biological research involves application of some
More informationESSENTIAL BIOINFORMATICS
ESSENTIAL BIOINFORMATICS Essential Bioinformatics is a concise yet comprehensive textbook of bioinformatics that provides a broad introduction to the entire field. Written specifically for a life science
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationRESEARCH METHODOLOGY, BIOSTATISTICS AND IPR
MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy
More informationBioinformatics Databases
Bioinformatics Databases Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com Agenda
More informationBIOL 274 Introduction to Bioinformatics Fall 2016
Instructor: Eric S. Ho (hoe@lafayette.edu) Office: Kunkel 13 Office hours: TTh 2-4 pm Lecture: MWF 11:00-11:50 am, Venue: Kunkel 117 Lab: M/W 1:10-4:00 pm, Venue: Kunkel 313B TAs: Amy Boles (bolesa@lafayette.edu),
More informationIntroduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?
More informationIntroduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools
Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More informationBGGN 213: Foundations of Bioinformatics (Fall 2017)
BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on
More informationBasic Local Alignment Search Tool
14.06.2010 Table of contents 1 History History 2 global local 3 Score functions Score matrices 4 5 Comparison to FASTA References of BLAST History the program was designed by Stephen W. Altschul, Warren
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationCAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU
CAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU Three major public DNA databases!2! GenBank NCBI (Natl Center for Biotechnology Information) www.ncbi.nlm.nih.gov! EMBL
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationIntroduction. CS482/682 Computational Techniques in Biological Sequence Analysis
Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG
Chapman & Hall/CRC Mathematical and Computational Biology Series ALGORITHMS IN BIO INFORMATICS A PRACTICAL INTRODUCTION WING-KIN SUNG CRC Press Taylor & Francis Group Boca Raton London New York CRC Press
More informationCAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU
CAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU !2 Sequence Alignment! Global: Needleman-Wunsch-Sellers (1970).! Local: Smith-Waterman (1981) Useful when commonality
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationOutline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationThe String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.
Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif
More informationImaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized
1 2 3 Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized medicine, risk assessment etc Public Health Bio
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not
More informationIntroduction to EMBL-EBI.
Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,
More informationFACULTY OF LIFE SCIENCES
FACULTY OF LIFE SCIENCES SYLLABUS FOR Interdisciplinary Course Biotechnology (UG & PG) (Under Credit Based Continuous Evaluation Grading System) Examinations: 2015-16 GURU NANAK DEV UNIVERSITY AMRITSAR
More informationBIOINFORMATICS AND FUNCTIONAL GENOMICS
BIOINFORMATICS AND FUNCTIONAL GENOMICS third edition Jonathan Pevsner Bioinformatics and Functional Genomics Bioinformatics and Functional Genomics Third Edition Jonathan Pevsner Department of Neurology,
More informationAnnotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station
Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Library preparation Sequencing Hypothesis testing Bioinformatics 2 Why annotate?
More informationChimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationBIOINFORMATICS IN BIOCHEMISTRY
BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationTypically, to be biologically related means to share a common ancestor. In biology, we call this homologous
Typically, to be biologically related means to share a common ancestor. In biology, we call this homologous. Two proteins sharing a common ancestor are said to be homologs. Homologyoften implies structural
More informationGenome 373: Genomic Informatics. Elhanan Borenstein
Genome 373: Genomic Informatics Elhanan Borenstein Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis of genomes and biological systems,
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationData Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More informationBiological databases an introduction
Biological databases an introduction By Dr. Erik Bongcam-Rudloff SLU 2017 Biological Databases Sequence Databases Genome Databases Structure Databases Sequence Databases The sequence databases are the
More informationINTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet
INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and
More informationCECS Introduction to Bioinformatics University of Louisville Spring 2004 Dr. Eric Rouchka
Dr. Awwad Abdoh Radwan Dept Pharm Organic Chemistry, Faculty of Pharmacy, Assiut University. 29/09/2005 Required Texts Image Source: http://www.amazon.com/ Other Bioinformatics Books Image Source: http://www.amazon.com/
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationOverview of Health Informatics. ITI BMI-Dept
Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational
More informationWorkshop on Genomics. Český Krumlov Monday, January 7, 13
Workshop on Genomics Český Krumlov 2013 objectives of this presentation provide some information about the setting and logistics provide some background information about the Workshop help you establish
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationDNA Sequence Alignment based on Bioinformatics
DNA Sequence Alignment based on Bioinformatics Shivani Sharma, Amardeep singh Computer Engineering,Punjabi University,Patiala,India Email: Shivanisharma89@hotmail.com Abstract: DNA Sequence alignmentis
More informationSequence Analysis. BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI MAY P. Benos 1
Sequence Analysis (part III) BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI 2006 31-MAY-2006 2006 P. Benos 1 Outline Sequence variation Distance measures Scoring matrices Pairwise alignments (global,
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control
More informationONLINE BIOINFORMATICS RESOURCES
Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower
More information9 polymorphisms (SNPs) DNA fingerprinting with microsatellites, restriction
BIOL 260 Principles of Genetics, Fall 2013, 4.0 credits Date Lecture topic Chapter 06 Sep-Fri Introduction 1 DNA: The genetic material 2 DNA replication 3 Gene function 4 20 Sep-Fri: Last day for student-
More informationBioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases
Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence
More informationAnalysis of Biological Sequences SPH
Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,
More informationEnsembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationBioinformatics: course introduction
Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz
More informationIntegrated UG/PG Biotechnology (Fifth Semester) End Semester Examination, 2013 LBTC 504: Bioinformatics. Model Answers
Integrated UG/PG Biotechnology (Fifth Semester) End Semester Examination, 2013 LBTC 504: Bioinformatics Model Answers Answer Key for Section-A (Objective Type Questions) Question 1. (i) (c) Both of the
More informationbioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5
Bioinformatica 1 / 5 2 / 5 3 / 5 Bioinformatica Bioinformatics is the name given to these mathematical and computing approaches used to glean understanding of biological processes. Common activities in
More informationCourse Competencies Template Form 112
` Course Competencies Template Form 112 GENERAL INFORMATION Course Prefix/Number: BSC-2426 Number of Credits: 3 Degree Type Course Title: Biotechnology Methods and Applications-I B.A. B.S. B.A.S A.A. A.S.
More informationCourse Competencies Template Form 112
` Course Competencies Template Form 112 GENERAL INFORMATION Course Prefix/Number: BSC-2426 Number of Credits: 3 Degree Type Course Title: Biotechnology Methods and Applications-I B.A. B.S. B.A.S A.A. A.S.
More informationPrinciples of Genetics, Spring 2013, 4.0 credits
BIOL 362 Principles of Genetics, Spring 2013, 4.0 credits Date Lecture topic Chapter 23 Jan-Wed Introduction 1 28 Jan-Mon DNA: The genetic material 2 30 Jan-Wed DNA replication 3 04 Feb-Mon Gene function
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationM. Phil. (Computer Science) Programme < >
M. Phil. (Computer Science) Programme Department of Information and Communication Technology, Fakir Mohan University, Vyasa Vihar, Balasore-756019, Odisha. MPCS11: Research Methodology Unit
More information