Bioinformatics and Life Sciences Standards and Programming for Heterogeneous Architectures

Size: px
Start display at page:

Download "Bioinformatics and Life Sciences Standards and Programming for Heterogeneous Architectures"

Transcription

1 Bioinformatics and Life Sciences Standards and Programming for Heterogeneous Architectures Eric Stahlberg Ph.D. (SAIC-Frederick contractor) SIAM Conference on Parallel Processing for Scientific Computing Savannah, GA, February 16, 2012 Caveats: Content and statements following do not constitute any official position or endorsement, whether stated or implied. All copyrights of referenced material remain with the original owner. 1

2 Context for Heterogeneous Acceleration Cancer kills every 55 seconds Cancer research utilizes bioinformatics heavily Bioinformatics is computationally intensive Faster solutions help cancer research move faster Faster and better clinical applications help to impact patient lives Today s Goal: Encourage paths to improve bioinformatics applications for cancer research

3 Three Key Needs Faster and better applications Better education and preparation in parallel and distributed computing Better and faster data handling solutions

4 SAIC-Frederick, Inc. Technical and operations contractor to the U.S. National Cancer Institute Federally Funded Research and Development Center for DHHS Many technical and operational areas of support for the NCI including bioinformatics IT picture here 4

5 NCI Center for Cancer Research

6 NCI Center for Cancer Research BRANCHES Cell and Cancer Biology Dermatology Experimental Immunology Experimental Transplantation and Immunology Genetics HIV and AIDS Malignancy HIV DRP Host-Virus Interaction Medical Oncology Metabolism Neuro-Oncology Pediatric Oncology Radiation Biology Radiation Oncology Surgery Urologic Oncology Vaccine PROGRAMS Cancer and Inflammation CCR Nanobiology HIV Drug Resistance Molecular Discovery Molecular Imaging Mouse Cancer Genetics LABS Basic Research Laboratory Cancer and Developmental Biology Laboratory Chemical Biology Laboratory Gene Regulation and Chromosome Biology Laboratory HIV DRP Retroviral Replication Laboratory Laboratory of Biochemistry and Molecular Biology Laboratory of Cancer Biology and Genetics Laboratory of Cancer Prevention Laboratory of Cell and Developmental Signaling Laboratory of Cell Biology Laboratory of Cellular and Molecular Biology Laboratory of Cellular Oncology Laboratory of Experimental Carcinogenesis Biophysics Laboratory Laboratory of Experimental Immunology Laboratory of Genome Integrity Laboratory of Human Carcinogenesis Laboratory of Immune Cell Biology Laboratory of Metabolism Laboratory of Molecular Biology Laboratory of Molecular Immunoregulation Laboratory of Molecular Pharmacology Laboratory of Pathology Laboratory of Population Genetics Laboratory of Protein Dynamics and Signaling Laboratory of Receptor Biology and Gene Expression Laboratory of Tumor Immunology and Biology Macromolecular Crystallography Laboratory Molecular Targets Laboratory Structural Biophysics Laboratory

7 Life Science Application Areas Image processing 3D imaging 2D imaging Sequence and protein analysis Microarray Next Generation Sequence Analysis Proteomics Simulation Molecular interactions and dynamics Complex systems biology simulations Data mining and analytics Statistics Graph and cluster analysis Population analysis

8 Dataflow View of Basic Biology DNA Transcription RNA Mitosis Translation new cell Duplicated DNA Cell Functions Intra-Cellular Functions Proteins DNA information flow Protein feedback loop Intercellular communication Transform Process Data source

9 Metabolic Pathways at Higher Resolution Source:

10 Next Generation Sequencing Focus Next Generation Sequencing Focus Used to understand complex biological systems Common types of NGS applications ChIPseq RNAseq mirnaseq Epigenetic studies Large and growing dataset sizes Identify, associate, and compare within individual experiments Integrate and compare across experiments

11 Data Acquisition Costs Plummet 11

12 Large Data Challenges Big Data = Big Challenges Volume of available data is growing rapidly One run produces hundreds of gigabytes of data* Policy issues HIPAA, security and protection Move it, store it, delete it? Validation and clinical liability Metadata - reliable secondary value *Reference: Barski and Zhao, Journal of Cellular Biochemistry, 107:11-18,

13 Generic General NextGenWorkflow NGS Sequence Acquisition Data Quality Evaluation Sequence Read Mapping Analysis of Mapped Reads Compare Across Samples Experimental data is progressively concentrated to become knowledge for decision Per sample volume of information reduced as data is analyzed Concentrated results are integrated to inform decisions

14 Example Illustrative Areas Next in Gen Next Sequencing Gen Sequencing Apps Genome Assembly Combine small fragments of DNA/RNA into highconfidence composite contigs Connect the small pieces into a larger string consistent with observed sequences and known biology Read Mapping Start with a known baseline reference genome Map smaller pieces of DNA/RNA to their correct location on the reference genome allowing for mismatches, insertions, deletions

15 RNA Sequencing Overview Source:

16 Challenges Key in NGS Next Challenges Gen Sequencing Transferring large datasets Processing huge datasets Integrating datasets Proliferation of sequencing capabilities Growing data volumes too great to store results Overcoming ambiguity with algorithmic improvements Reproducibility over time Translation to clinical application Applications are parallel but not system friendly

17 Research vs. Clinical Application Contrasting Application Goals Research Application Aims Agile Rapid incorporation of new advances Ad hoc development process Open source Documented as needed Generally portable Limited liability for failures Marginal testing Reproducibility Speed SIAM Conference on Parallel Processing for Scientific Computing, February 16, 2012 Clinical Application Aims Stable Measuredincorporation of proven advances Development process required Licensed and proprietary Well documented Supportable Liability for failure Certification of testing Reproducibility Speed

18 Three Key Needs Faster and better applications Better education and preparation in parallel and distributed computing Better and faster data handling solutions

19 Why Better Education in PDC? Improved application development Higher speed applications More robust applications in PDC environments More efficient applications Better interoperability among PDC technologies More effective application use at run time Analysts know how to use parallel computing effectively Understanding of scalability to better relate problem size to computational resources Improved planning of large computational analysis efforts Better run-time efficiency

20 Changing a Way of Thinking Education is key Teaching parallel and accelerated computing across the CS curriculum Innovative NSF funded project Incorporating parallel computing into CS, software development, and computational science Workshop and website under development See more information Courses Enhanced Computer Literacy Intro to Programming Data Structures Algorithms Programming Languages Computer Hardware Computational Modeling Bioinformatics (applications) Computational chemistry (applications) We gratefully acknowledge the support of the National Science Foundation Grant CCF , SHF:Small:RUI:Collaborative Research: Accelerators to Applications Supercharging the Undergraduate Computer Science Curriculum

21 Why Heterogeneous Acceleration?? Problems are large Recent sample runs have taken up to 4 days to compute Experiments include many samples Data is becoming too large to move Instrument systems are becoming smaller and cheaper Trend to generate much more data continues Technologies are heterogeneous Multicoreis pervasive and proven GPU technology is affordable and available FPGAs have history for fast bioinformatics

22 Parallel Computing in Bioinformatics Parallel Computing and bioinformatics 182 articles in PubMed since 1995 GPU and Bioinformatics 50 articles dating back to articles in CUDA and bioinformatics Message Passing and bioinformatics 26 articles with message passing and bioinformatics FPGA and Bioinformatics 22 articles in PubMed since 1993 OpenMP and bioinformatics 6 articles in OpenMP and bioinformatics OpenCL and bioinformatics 3 articles reported Parallel Computing GPU CUDA Message Passing FPGA OpenMP OpenCL

23 Biowulfat NIH Biowulf NIH HPC Resource GPU cluster available

24 Weighing Relative the Merits of Standards of Pros Stabilizes development efforts Improve portability of algorithms and applications Raise productivity and innovation Improve robustness of mission critical applications Improve supportability Channels creativity and innovation Easier education Cons Takes time forcommunity adoption Possible performance penalty in some cases

25 Open Accelerator Not to be confused with OpenACC Open Accelerator Initiative provides community knowledge base of accelerated computing activity Components, performance, literature, and more to come Encourages interoperability among technologies and standards Registration services support application reproducibility and certification Downloads: OpenFPGA draft GenAPI standard Visit

26

27 Summary Faster and better applications Heterogeneous acceleration Support standards and interoperability Multiple areas exist Better education and preparation in parallel and distributed computing Improved application development Ease of application use Better and faster data handling solutions Not addressed here

28 Colleagues at NCI CCR, SAIC-F ABCC National Science Foundation CISE Colleagues at Wittenberg and Clemson Dr. Steven Bogaerts, Dr. Kyle Burke, Dr. Brian Shelburne, Acknowledgements Dr. Melissa Smith OpenFPGA and OpenAccelerator communities Contact information: estahlberg(-at-) gmail.com or stahlbergea(-at-)mail.nih.gov

The Integrated Biomedical Sciences Graduate Program

The Integrated Biomedical Sciences Graduate Program The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to

More information

Satellite Education Workshop (SW4): Epigenomics: Design, Implementation and Analysis for RNA-seq and Methyl-seq Experiments

Satellite Education Workshop (SW4): Epigenomics: Design, Implementation and Analysis for RNA-seq and Methyl-seq Experiments Satellite Education Workshop (SW4): Epigenomics: Design, Implementation and Analysis for RNA-seq and Methyl-seq Experiments Saturday March 17, 2012 Orlando, Florida Workshop Description: This full day

More information

Computational Biology

Computational Biology 3.3.3.2 Computational Biology Today, the field of Computational Biology is a well-recognised and fast-emerging discipline in scientific research, with the potential of producing breakthroughs likely to

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

Machine Learning. HMM applications in computational biology

Machine Learning. HMM applications in computational biology 10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly

More information

NGS in Pathology Webinar

NGS in Pathology Webinar NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical

More information

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility 2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,

More information

Our website:

Our website: Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate

More information

Ph.D. Program in Genetics, Genomics, and Cancer Biology

Ph.D. Program in Genetics, Genomics, and Cancer Biology Ph.D. Program in Genetics, Genomics, and Cancer Biology Program Requirements Required Courses Credits GE 501, 511, 521, 531 Experimental Methods Pre-entry, I, II, III (3 research rotations are usually

More information

Data Mining for Biological Data Analysis

Data Mining for Biological Data Analysis Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han

More information

The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Catalog Addendum

The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Catalog Addendum The University of Texas MD Anderson Cancer Center UTHealth 2016-2018 Catalog Addendum GSBS 2016-18 Catalog Addendum Table of Contents School Name Change... 1 Areas of Research Concentration Changes...

More information

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics

More information

ADAMAS UNIVERSITY FACULTY OF SCIENCE - DEPARTMENT OF BIOTECHNOLOGY BACHELOR OF SCIENCE (Honours) SEMESTER - I

ADAMAS UNIVERSITY FACULTY OF SCIENCE - DEPARTMENT OF BIOTECHNOLOGY BACHELOR OF SCIENCE (Honours) SEMESTER - I NEW CHOICE BASED CREDIT SYSTEM (TOTAL CREDIT = 22+22+28+28+26+26 = 152) Type of the Paper Paper Code ADAMAS UNIVERSITY FACULTY OF SCIENCE - DEPARTMENT OF BIOTECHNOLOGY SEMESTER - I / Brief Contents I BT1201

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Course Agenda. Day One

Course Agenda. Day One Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an

More information

Accelerating Precision Medicine with High Performance Computing Clusters

Accelerating Precision Medicine with High Performance Computing Clusters Accelerating Precision Medicine with High Performance Computing Clusters Scalable, Standards-Based Technology Fuels a Big Data Turning Point in Genome Sequencing Executive Summary Healthcare is in worldwide

More information

IGPNS Recommended Electives List

IGPNS Recommended Electives List IGPNS Recommended Electives List Animal Science 414: Ruminant Nutrition Integrates basic nutrition concepts and ration balancing skills by teaching students to balance and troubleshoot rations for various

More information

Elixir: European Bioinformatics Research Infrastructure. Rolf Apweiler

Elixir: European Bioinformatics Research Infrastructure. Rolf Apweiler Elixir: European Bioinformatics Research Infrastructure Rolf Apweiler EMBL-EBI Service Mission To enable life science research and its translation to medicine, agriculture, the bioindustries and society

More information

CENTER FOR BIOTECHNOLOGY

CENTER FOR BIOTECHNOLOGY CENTER FOR BIOTECHNOLOGY Keith A. McGee, Ph.D., Program Director Math and Science Building, 3 rd Floor 1000 ASU Drive #870 Phone: 601-877-6198 FAX: 601-877-2328 Degree Offered Required Admission Test M.

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Genomics. Data Analysis & Visualization. Camilo Valdes

Genomics. Data Analysis & Visualization. Camilo Valdes Genomics Data Analysis & Visualization Camilo Valdes cvaldes3@miami.edu https://github.com/camilo-v Center for Computational Science, University of Miami ccs.miami.edu Today Sequencing Technologies Background

More information

ATIP Avenir Program 2018 Young group leader

ATIP Avenir Program 2018 Young group leader ATIP Avenir Program 2018 Young group leader Important dates - October 17th (4 pm) 2017 : opening of the registrations online - November 23 th 2017: deadline for the online submission, the mailing of the

More information

ACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes

ACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes ACCELERATING GENOMIC ANALYSIS ON THE CLOUD Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES

LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES 1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,

More information

SPECTArare as an innovative model of combining clinical research and care in an ERN. Denis Lacombe, MD, MSc EORTC, Director General Brussels, Belgium

SPECTArare as an innovative model of combining clinical research and care in an ERN. Denis Lacombe, MD, MSc EORTC, Director General Brussels, Belgium SPECTArare as an innovative model of combining clinical research and care in an ERN Denis Lacombe, MD, MSc EORTC, Director General Brussels, Belgium Contents The changing clinical research pathway How

More information

Computational Challenges of Medical Genomics

Computational Challenges of Medical Genomics Talk at the VSC User Workshop Neusiedl am See, 27 February 2012 [cbock@cemm.oeaw.ac.at] http://medical-epigenomics.org (lab) http://www.cemm.oeaw.ac.at (institute) Introducing myself to Vienna s scientific

More information

Comparative Oncology Program

Comparative Oncology Program The Problem: Non-Integrated Cancer Drug Development A Solution: Integration of Informative Non-Clinical Models of Cancer With Clinical Drug Development Efforts Companion Animal Malignancies as Comparative

More information

Department of Biochemistry and Molecular Genetics

Department of Biochemistry and Molecular Genetics 536 Department of Biochemistry and Molecular Genetics Chairperson: Professors: Associate Professors: Assistant Professors: Associates: Jaffa, Ayad Boustany, Rose-Mary; Darwiche, Nadine; Dbaibo, Ghassan;

More information

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance

More information

Short Course Instructors

Short Course Instructors Short Course Instructors Andrew Allen, Ph.D., Professor of Biostatistics and Bioinformatics and Director of the new Duke Center of Statistical Genetics and Genomics, Duke University, has expertise in statistical

More information

The Power to Cure: Therapeutic Innovation in Academia

The Power to Cure: Therapeutic Innovation in Academia The Power to Cure: Therapeutic Innovation in Academia Leslie Molony, Ph.D. November 7, 2011 Sanford-Burnham Medical Research Institute: a Non Profit Basic Research Institute Santa Barbara Est. 2006 La

More information

Forum on Analytics for Advanced Cancer Research Basel, 26 October 2016 Ted Slater Global Head, Healthcare & Life Sciences

Forum on Analytics for Advanced Cancer Research Basel, 26 October 2016 Ted Slater Global Head, Healthcare & Life Sciences Forum on Analytics for Advanced Cancer Research Basel, 26 October 2016 Ted Slater Global Head, Healthcare & Life Sciences Why Is Advanced Computation Important in the Fight Against Cancer? Data continue

More information

Integrated M.Tech. in Biotechnology (B.Tech + M.Tech) programme. Semester 1

Integrated M.Tech. in Biotechnology (B.Tech + M.Tech) programme. Semester 1 Annexure-VI Integrated M.Tech. in Biotechnology (B.Tech + M.Tech) programme Semester 1 CY101/PH102 Engineering Chemistry/ Engineering Physics 3 1 0 4 MA103 Basic Mathematics 3 1 0 4 CS101 Computer Programming-I

More information

Prof. Clare Bates Congdon, PhD

Prof. Clare Bates Congdon, PhD Women in Bioinformatics Forum Ballroom D, Tuesday 12:15PM-1:15PM Open to EVERYONE! Lunch Provided! ACM BCB 2013 Bioinformatics: Translation Catalyst, Enabler, Hub Bio+Med Study Discovery & Development

More information

Introducing the Department of Life Sciences

Introducing the Department of Life Sciences Introducing the Department of Life Sciences Life Sciences is a discipline that aims at a fundamental understanding of life phenomena by exploring complex and mysterious structures and funct ions of living

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research

E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research www.hcltech.com E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research whitepaper April 2015 TABLE OF CONTENTS Introduction 3 Challenges associated with NGS data analysis 3 HCL s NGS Solution

More information

Biosc10 schedule reminders

Biosc10 schedule reminders Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,

More information

Vision, aims and strategies. Department of Immunology, Genetics and Pathology Uppsala University

Vision, aims and strategies. Department of Immunology, Genetics and Pathology Uppsala University Vision, aims and strategies Department of Immunology, Genetics and Pathology Uppsala University April19,2011 SCOPEOFACTIVITIESATIGP Research at the Department focuses on translational medicine through

More information

Yesterday s Picture UNIT 3E

Yesterday s Picture UNIT 3E Warm-Up The data above represent the results of three different crosses involving the inheritance of a gene that determines whether a certain organism is blue or white. Which of the following best explains

More information

Data Intensive Scientific Discovery Vijay Chandru

Data Intensive Scientific Discovery Vijay Chandru Data Intensive Scientific Discovery Vijay Chandru Hon. Professor, NIAS Chairman, Strand Life Sciences chandru@alum.mit.edu The Promise Peta (10 15 )and Exa (10 18 ) scale Computing Astrophysics (Large

More information

Complex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine

Complex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine Complex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine January 18, 2013 Anna D. Barker, Ph.D. Director, Transformative Healthcare Networks C-Director, Complex Adaptive Systems Initiative

More information

Information Driven Biomedicine. Prof. Santosh K. Mishra Executive Director, BII CIAPR IV Shanghai, May

Information Driven Biomedicine. Prof. Santosh K. Mishra Executive Director, BII CIAPR IV Shanghai, May Information Driven Biomedicine Prof. Santosh K. Mishra Executive Director, BII CIAPR IV Shanghai, May 21 2004 What/How RNA Complexity of Data Information The Genetic Code DNA RNA Proteins Pathways Complexity

More information

High peformance computing infrastructure for bioinformatics

High peformance computing infrastructure for bioinformatics High peformance computing infrastructure for bioinformatics Scott Hazelhurst University of the Witwatersrand December 2009 What we need Skills, time What we need Skills, time Fast network Lots of storage

More information

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow

More information

RNA Bioinformatics (Methods In Molecular Biology) READ ONLINE

RNA Bioinformatics (Methods In Molecular Biology) READ ONLINE RNA Bioinformatics (Methods In Molecular Biology) READ ONLINE If you are searched for the book RNA Bioinformatics (Methods in Molecular Biology) in pdf form, in that case you come on to the loyal website.

More information

The Open2Dprot Proteomics Project for n-dimensional Protein Expression Data Analysis. The Open2Dprot Project. Introduction

The Open2Dprot Proteomics Project for n-dimensional Protein Expression Data Analysis. The Open2Dprot Project. Introduction The Open2Dprot Proteomics Project for n-dimensional Protein Expression Data Analysis http://open2dprot.sourceforge.net/ Revised 2-05-2006 * (cf. 2D-LC) Introduction There is a need for integrated proteomics

More information

Talk with the editors of THE JOURNAL OF BIOLOGICAL CHEMISTRY

Talk with the editors of THE JOURNAL OF BIOLOGICAL CHEMISTRY Talk with the editors of THE JOURNAL OF BIOLOGICAL CHEMISTRY Part 1: What s new at the JBC? Mission Statement The Journal of Biological Chemistry encourages the submission of manuscripts based on original

More information

Smart India Hackathon

Smart India Hackathon TM Persistent and Hackathons Smart India Hackathon 2017 i4c www.i4c.co.in Digital Transformation 25% of India between age of 16-25 Our country needs audacious digital transformation to reach its potential

More information

Annotation. (Chapter 8)

Annotation. (Chapter 8) Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store

More information

Dana-Farber Cancer Institute Speeds Medical Research with Advanced Data Warehouse

Dana-Farber Cancer Institute Speeds Medical Research with Advanced Data Warehouse Dana-Farber Cancer Institute Speeds Medical Research with Advanced Data Warehouse Dana-Farber Cancer Institute Boston, MA www.dana-farber.org Industry: Healthcare Annual Revenue: US$665.7 million Employees:

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

More information

Biomedical Informatics in BIG DATA Era

Biomedical Informatics in BIG DATA Era Biomedical Informatics in BIG DATA Era Yang C. Fann, Ph.D. Director, Intramural IT and Bioinformatics Program National Institute of Neurological Disorders and Stroke Disclaimer The opinions or assertions

More information

National Cancer Institute

National Cancer Institute National Cancer Institute The Impact of HPC and Data- Centric Computing in Cancer Research Jack R. Collins, Ph.D. Information Systems Program Frederick National Laboratory for Cancer Research July 5, 2012

More information

An Interactive Workflow Generator to Support Bioinformatics Analysis through GPU Acceleration

An Interactive Workflow Generator to Support Bioinformatics Analysis through GPU Acceleration An Interactive Workflow Generator to Support Bioinformatics Analysis through GPU Acceleration Anuradha Welivita, Indika Perera, Dulani Meedeniya Department of Computer Science and Engineering University

More information

Bioinformatics Specialist

Bioinformatics Specialist Bioinformatics Specialist At a Glance Bioinformatics specialists use their knowledge of computers and math to collect, analyze, and store biological data. Search by Cluster Computers & Telecom Science

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

M a x i m i z in g Value from NGS Analytics in t h e E n terprise

M a x i m i z in g Value from NGS Analytics in t h e E n terprise Global Headquarters: 5 Speen Street Framingham, MA 01701 USA P.508.935.4445 F.508.988.7881 www.idc-hi.com M a x i m i z in g Value from NGS Analytics in t h e E n terprise C U S T O M I N D U S T R Y B

More information

Bridging the Gap Between Basic and Clinical Research. Julio E. Celis Danish Cancer Society

Bridging the Gap Between Basic and Clinical Research. Julio E. Celis Danish Cancer Society Bridging the Gap Between Basic and Clinical Research Julio E. Celis Danish Cancer Society Barriers and Oportunities in Translational Research Promise of the new technologies What is Europe doing? Challenges

More information

Wake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics

Wake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics Wake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics Extra Resources Website: http://waa-science.weebly.com Module 1: Overview of DNA Vocabulary Term Definition (You may use an Internet

More information

ROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE

ROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE CHAPTER1 ROAD TO STATISTICAL BIOINFORMATICS Jae K. Lee Department of Public Health Science, University of Virginia, Charlottesville, Virginia, USA There has been a great explosion of biological data and

More information

Visit our Career Flowchart to get more information on some of these career paths.

Visit our Career Flowchart to get more information on some of these career paths. Visit our Career Flowchart to get more information on some of these career paths. Academic Research Faculty: This career path consists of university or college professors who conduct research. They select

More information

Automating Data Analysis Workflows - Why Data Management is Important in an Era of HPDA

Automating Data Analysis Workflows - Why Data Management is Important in an Era of HPDA Automating Data Analysis Workflows - Why Data Management is Important in an Era of HPDA Jack R. Collins Director, Advanced Biomedical Computational Sciences Group April, 2019 DEPARTMENT OF HEALTH AND HUMAN

More information

The University of California, Santa Cruz (UCSC) Genome Browser

The University of California, Santa Cruz (UCSC) Genome Browser The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

COURSES IN BIOLOGICAL SCIENCE. Undergraduate Courses Postgraduate Courses

COURSES IN BIOLOGICAL SCIENCE. Undergraduate Courses Postgraduate Courses COURSES IN BIOLOGICAL SCIENCE Undergraduate Courses Postgraduate Courses Undergraduate Courses: BISC 001 Appreciation of Biological Sciences [3-0-0:3] Diversity of life forms; origin of life; chemical

More information

CodeLink Human Whole Genome Bioarray

CodeLink Human Whole Genome Bioarray CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it

More information

About ICarbonX. Learn more:

About ICarbonX. Learn more: About ICarbonX icarbonx is a technology company, combining advances in artificial intelligence, multi-omics and experience to fundamentally change how people understand their present to optimize their

More information

Journal standards and trends in crop genomics

Journal standards and trends in crop genomics Journal standards and trends in crop genomics Myles Axton Chief Editor Nature Genetics ICRISAT Hyderabad, India February 18 th 2015 Maciej Tomczak Nature's mission statement written in 1869 still guides

More information

Bioinformatics Programming and Analysis CSC Dr. Garrett Dancik

Bioinformatics Programming and Analysis CSC Dr. Garrett Dancik Bioinformatics Programming and Analysis CSC 315-01 Dr. Garrett Dancik What is bioinformatics Bioinformatics: Biology + information the study and utilization of methods for storing, retrieving and analyzing

More information

Christoph Bock ICPerMed First Research Workshop Milano, 26 June 2017

Christoph Bock ICPerMed First Research Workshop Milano, 26 June 2017 New Tools for Personalized Medicine *Tools = Assays, Devices, Software Christoph Bock ICPerMed First Research Workshop Milano, 26 June 2017 http://epigenomics.cemm.oeaw.ac.at http://biomedical-sequencing.at

More information

Pharmaceuticals and Biotechnology

Pharmaceuticals and Biotechnology ABCD Pharmaceuticals and yet are quickly accessible from one central location. 7 Gain a competitive advantage 7 Facilitate product research and development 7 Raise return on investment Pharmaceuticals

More information

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up

More information

Generation of research tools to translate genomic discoveries into drug discovery projects. Nils Ostermann, Novartis

Generation of research tools to translate genomic discoveries into drug discovery projects. Nils Ostermann, Novartis Generation of research tools to translate genomic discoveries into drug discovery projects Nils Ostermann, Novartis Need for public-private collaboration Common interest Genomic information is growing

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Network System Inference

Network System Inference Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What

More information

Microbiology, Molecular Biology and Biochemistry

Microbiology, Molecular Biology and Biochemistry Microbiology, Molecular Biology and Biochemistry Bruce L. Miller, Interim Dept. Head, Dept. of Microbiology, Molecular Biology and Biochemistry (142 Life Sc. Bldg. 83844-3052; phone 208/885-7966; mmbb@uidaho.edu;

More information

Biosimilars: The Impact on Academic Pharmacy

Biosimilars: The Impact on Academic Pharmacy Biosimilars: The Impact on Academic Pharmacy George E. MacKinnon III, PhD, MS, RPh, FASHP Founding Dean and Professor College of Pharmacy Vice Provost for Health Sciences Roosevelt University Learning

More information

Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D.

Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D. Cory Brouwer, Ph.D. Dr. Cory R. Brouwer is Director of the Bioinformatics Services Division and Associate Professor of Bioinformatics and Genomics at UNC Charlotte. He and his team provide a wide range

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

BIOINFORMATICS THE MACHINE LEARNING APPROACH

BIOINFORMATICS THE MACHINE LEARNING APPROACH 88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and

More information

Our job today Enlist you to help us cross the Translational Divide between the lab bench and the patient s bedside Demonstrate that this will

Our job today Enlist you to help us cross the Translational Divide between the lab bench and the patient s bedside Demonstrate that this will Bench Bedside Our job today Enlist you to help us cross the Translational Divide between the lab bench and the patient s bedside Demonstrate that this will be done in our Kimmel Cancer Center at Hopkins,

More information

The Institute of Microbiology of the Czech Academy of Sciences is looking for. four POSTDOCTORAL FELLOW positions in the fields of:

The Institute of Microbiology of the Czech Academy of Sciences is looking for. four POSTDOCTORAL FELLOW positions in the fields of: 4 Postdoctoral Fellow positions in microbiology, molecular biology and ecology The Institute of Microbiology of the Czech Academy of Sciences, Prague, Czech Republic The Institute of Microbiology of the

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

DNA Function. DNA Heredity and Protein Synthesis

DNA Function. DNA Heredity and Protein Synthesis DNA Function DNA Heredity and Protein Synthesis 1 Review DNA made of Nucleotide bases Proteins made of Amino acids Describe how DNA is involved in protein synthesis DNA base sequence codes for amino acid

More information

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation

More information

Drosophila White Paper 2003 August 13, 2003

Drosophila White Paper 2003 August 13, 2003 Drosophila White Paper 2003 August 13, 2003 Explanatory Note: The first Drosophila White Paper was written in 1999. Revisions to this document were made in 2000 and the final version was published as the

More information

Introducing Bioinformatics Concepts in CS1

Introducing Bioinformatics Concepts in CS1 Introducing Bioinformatics Concepts in CS1 Stuart Hansen Computer Science Department University of Wisconsin - Parkside hansen@cs.uwp.edu Erica Eddy Computer Science Department University of Wisconsin

More information

Ingenuity Pathway Analysis (IPA )

Ingenuity Pathway Analysis (IPA ) Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

J ove VIDEO JOURNAL CATALOG A CATALYST FOR SCIENTIFIC RESEARCH AND EDUCATION

J ove VIDEO JOURNAL CATALOG A CATALYST FOR SCIENTIFIC RESEARCH AND EDUCATION J ove VIDEO JOURNAL CATALOG A CATALYST FOR SCIENTIFIC RESEARCH AND EDUCATION J ove VIDEO JOURNAL The first scientific video journal dedicated to advancing science by increasing reproducibility and efficient

More information

Data representation for clinical data and metadata

Data representation for clinical data and metadata Data representation for clinical data and metadata WP1: Data representation for clinical data and metadata Inconsistent terminology creates barriers to identifying common clinical entities in disparate

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

The flow diagram below shows part of a process to produce a protein, using genetically modified plants.

The flow diagram below shows part of a process to produce a protein, using genetically modified plants. 1 Some organisms have been genetically modified to produce proteins including hormones and vaccines. The flow diagram below shows part of a process to produce a protein, using genetically modified plants.

More information

Bioinformatics : Gene Expression Data Analysis

Bioinformatics : Gene Expression Data Analysis 05.12.03 Bioinformatics : Gene Expression Data Analysis Aidong Zhang Professor Computer Science and Engineering What is Bioinformatics Broad Definition The study of how information technologies are used

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information