Supplementary Information. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote
|
|
|
- Felix McGee
- 5 years ago
- Views:
Transcription
1 Supplementary Information Supplementary Figures S1 to S5 and Tables S1 to S3. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote Aurélien Raveux, Sandrine Vandormael-Pournin and Michel Cohen-Tannoudji Institut Pasteur, CNRS, Unité de Génétique Fonctionnelle de la Souris, UMR 3738, Department of Developmental & Stem Cell Biology, 25 rue du docteur Roux, F Paris Cedex. Corresponding author: Michel Cohen-Tannoudji, Unité de Génétique Fonctionnelle de la Souris, Department of Developmental & Stem Cell Biology, 25 rue du docteur Roux, F Paris, France; Phone: ; Fax: , web site:
2 Figure S1 : Single nucleotides polymorphisms (SNPs) around Nle exon 1. Tail DNAs from one (C57BL/6xSJL/J) F1 female and six CD1-IGS males were amplified using primers WTF1 and GFPR (169bp 5 and 522bp 3 to the ATG respectively) and WTF2 and GFP250R (500bp 5 and 250bp 3 to the ATG respectively), and sequenced using GFP60F and GFP60R primers respectively (see Supplementary Table S1 for primer sequences). 9 SNPs compared to the C57BL6 reference genome (NCB1 m37) were identified and their positions respective to exon 1 and 2 and to the regions covered by the ssodn matrix (orange box) and the plasmid repair matrix (green box) are indicated on the scheme. The grey box located at the telomeric end of the green box represent a small GC and CA repeat region that could not be sequenced properly. 8 out of the 9 SNPs were already present in dbsnp Build 142. SNP n 1 has been identified in this study. (C57BL/6xSJL/J)F1 females and 4 out of the 6 CD1-IGS males are heterozygous at all SNP positions.
3 Figure S2 : Comparison of the effect of Cas9/sgRNA consentration and the site of injection on KI efficiency at the Sox2 locus. A. Schematic representation of the end of Sox2 coding region, sgrna sequence and ssodn repair matrix. Sox2 TGA stop codon is indicated in bold, the sgrna-targeting sequence is underlined, and the protospacer adjacent motif sequences is labelled in red. Cas9 nuclease cuts DNA at position -3 bp from the protospacer adjacent motif. The ssodn repair matrix contains 60 nucleotides of homology flanking both sides of the DSB generated by sgrnasox2. B. Schematic representation of Sox2 wt and Sox2 HA alleles. Positions of the primers and sizes of the PCR fragments are indicated below each allele. C. Each circle represents the proportion of embryos with KI, indels, KI and indels, or wild-type only alleles for a given condition. The overall mutation rate, which corresponds to the proportion of embryos displaying at least one edited allele, is indicated at the center of each disk. Because some embryos contained both KI and indels alleles, the overall mutation rate can be less than the sum of the rates of KI and indels alleles. High concentration ([ ]) correspond to 100 ng/μl of Cas9 mrna and 50 ng/μl of sgrna while low [ ] corresponds to 5 ng/μl of Cas9 mrna and 2.5 ng/μl of sgrna. ssodn were injected at 20 ng/µl.
4 Nick#09 CCTCGGAAAGTACACATGGTATTACAGTTTGTTTGCAAGAAGAAATGGCCAGATGTACGATTATACACTGACTCATGGGCTGTAGCCAATGGATTGGCTGGATGGT CAGGGACTTGGAAAGATCACAATTGGAAAATTGGTGAGAAAGACATCTGGGGAAGAAGTATGTGGATAGATCTCTCCAAATGGGCAAAGGATGTGAAGATATTTGT GTCCCATGTAAATGCTCACCAAAAGGTGACTTCAGCTGAGGAGGAGTTCCACGTGGGGACGCAGGATGGGGTACCCATATGATGTTCCAGATTATGCTGCGGCGGC GGTGGTGGTAGGTGTACGCGCACGGGGC Figure S3 : Sequencing of NleHA KI alleles. A. Schematic representation of the NleHA KI allele indicating the position of the primers used to generate the PCR products that have been sequenced and the size of the amplicons. B. Sequences of the NleHA KI alleles from embryos injected under different conditions. The HA-tag sequence is underlined. Insertions, deletions and substitutions are labeled in red or green. Most of the imprecise KI events consisted in small indels in the HA tag region. For some embryos, no HAF1-NleR PCR product were recovered probably because of the deletion in the sequence complementary to the HAF1 primer. As a consequence, sequence 3 to the HA tag was not analyzed (NA) for these embryos. We found one duplication of the HA tag (Nick#05) and a transposon insertion (Nick#09). C. Complete sequence of the insertion identified in the embryo nick#09.
5 C. HA-GFP KI#5 TGCCCGGCGCGACATGGATTTAACGTCATAGGGATAGCCAGCGTAATCTGGAACATCGTATGGGTACCCCATCCTGCG TCCCCACGTGGAGGAGAACCGAGGCGGAAAGACGGAGCGTTAAATCTCGTGCCAACGAGAAGCGCGATCACATGGTCC TGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGGAGTGGGACCCCCTGGACGAG ATGGCATCCCTGGACAGCCTGGACTTCCTGGTCCTCCTGGTCCCCCTGGGCCCCCCGGACCCCCTGGCCTTGGAGGAG CCGGAGGAAGCGGAGGAGGAAGCGGAGCCGCGGCGGCGGTGGTGGTAGGTGTACGCGCACGGGGCGGGGATGCCGGGT CTCCGCGTG Figure S4 : Sequencing of Nle HA-GFP KI alleles. A. Schematic representation of the Nle HA-GFP KI allele indicating the position of the primers used to generate the PCR products that have been sequenced and the size of the amplicons. B. Sequence of the Nle HA-GFP KI alleles from embryos injected in the pronucleus with high RNA concentration of Cas9 mrna/sgrna (HA-GFP KI#1-6) or Cas9n mrna/sgrna (HA-GFP nick KI#1-2). HA-GFP nick KI #1 has a point mutation at the vicinity of sgrna2 nicking site (arrow). HA-GFP KI #5 presents several rearrangements in the HDR region. C. Sequence of the rearranged HA-GFP KI #5 allele. The inverted region is indicated in italics. The 6 bp insertion is labeled in red.
6 Low #2 WT1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGGCGGAGGCGAGGTAAGGACCGGACGCAAATT WT2-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGGCGGAGGCGAGGTAAGGACCGGACGCAAGTT Dl1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATG-CGGAGGCGAGGTAAGGACCGGACGCAAATT High #1 WT1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGGCGGAGGCGAGGTAAGGACCGGACGCAAATT WT2-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGGCGGAGGCGAGGTAAGGACCGGACGCAAGTT In1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGGCGGATGGCGGAGGCGAGGTAAGGACCGGACGCAAGTT High #4 WT1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGGCGGAGGCGAGGTAAGGACCGGACGCAAATT WT2-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGGCGGAGGCGAGGTAAGGACCGGACGCAAGTT Dl1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGAT------GGCGAGGTAAGGACCGGACGCAAATT Dl2-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAG-----CGGAGGCGAGGTAAGGACCGGACGCAAATT Dl3-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATG-CGGAGGCGAGGTAAGGACCGGACGCAAATT High #9 WT1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGGCGGAGGCGAGGTAAGGACCGGACGCAAGTT Dl1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGA GGCGAGGTAAGGACCGGACGCAAGTT Dl2-CTGCGGAAGGGCGAGAGCAAGTATTGGGAGTGCAGGA GGCGAGGTAAGGACCGGACGCAAGTT High #10 Dl1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGG---AGGCGAGGTAAGGACCGGACGCAAATT Dl2-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGA--GCGGAGGCGAGGTAAGGACCGGACGCAAATT High #11 WT1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGGCGGAGGCGAGGTAAGGACCGGACGCAAGTT Dl1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGG---AGGCGAGGTAAGGACCGGACGCAAGTT In1-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGGCGCGGAGGCGAGGTAAGGACCGGACGCAAGTT High #13 Dl1-CTGCGGAAGGGCGAGAGCACGTATTGGGAATGCAGGATGG---AGGCGAGGTAAGGACCGGACGCAAATT Dl2-CTGCGGAAGGGCGAGAGCAAGTACTGGGAATGCAGGATGG---AGGCGAGGTAAGGACCGGACGCAAATT Dl3-CTGCGGAAGGGCGAGAGCAAGTATTGGGAATGCAGGATGG---AGGCGAGGTAAGGACCGGACGCAAATT Figure S5 : Off-target mutations analysis. A. Predicted off-target sites of the sgrna1 target sequence displaying three mismatches sorted according to their risk score determined at the Zhang portal ( OT1-3 were selected for further study and we verified that no SNPs within OT1-3 sequences were present in (C57BL/6xSJL/J) F1 female and CD1-IGS males. B. Agarose gel electrophoresis analysis of OT3intF- OT3intR PCR products (228bp) of one non-injected embryo (Ctrl) and thirteen embryos (lanes 1 to 13) microinjected into the pronucleus with either low or high Cas9 mrna/sgrna1 concentration. Mutant embryos are labelled in red. Black arrowheads point to non-specific bands. Blue arrows point to indels. MW: 100 bp molecular weight marker. C. Sequences of sub-cloned OT3 alleles present in some of the mutant embryos. The off-target sequence is highlighted in gray and its PAM is indicated in bold. Insertions and deletions are labeled in red. A SNP present in genitors is labeled in blue.
7 site of injection Cas9/sgRNA (ng/µl) ssodn matrix (ng/µl) Nb exp. Nb embryos*/nb injected Nb analyzed KI Indels** WT*** >2 alleles Pronucleus 5/ /124 (75) a (34) 67 (73) 21 (23) 51 (56) Pronucleus 100/ /130 (61) b (53) 60 (80) 8 (11) 46 (61) Cytosol 5/ /99 (60) (29) 48 (82) 9 (16) 35 (63) Cytosol 100/ /120 (51) c (42) 45 (76) 6 (10) 27 (46) Table S1 : Summary of CRISPR/Cas9-mediated Sox2 mutations obtained after mouse zygotes microinjection Cas9 mrna, sgrna SOX2 and ssodn repair matrix were injected into the cytoplasm or the male pronucleus at 20 ng/µl. Embryos surviving the injection were cultured and embryos that developed up to 8-cell stage and beyond were analysed by PCR and migration of the amplification products on agarose gels. As for the Notchless locus, KI efficiency did not depend on the site of injection and increased significantly when more Cas9 mrna and sgrna were delivered in the cytosol (p<0.05) as well as in the pronucleus (p<0.01). * : 8-cell stage to early blastocyst ; ** : because indels 5 bp could be missed by gel electrophoresis analysis, the number of indels is likely underestimated ; *** : WT corresponds to embryos for which no edited alleles was detected. a : including one homozygous KI embryos. b : including six homozygous KI embryos. c : including five homozygous KI embryo. sgrna/ Cas9 variant sgrna1/ wild-type sgrna2+sgrna3 /nickase HDR matrix (homol. arm) ssodn Cas9/sgRNA (ng/µl) HDR matrix (ng/µl) No. KI analyzed Precise Imprecise Both 5/ (60) 4 (40) 0 (0) 100/ (80) 1 (10) 1 (10) plasmid (500 bp) 100/ (83) 1 (17) 0 (0) ssodn 100/ (56) 2 (22) 2 (22) plasmid (500 bp) 100/ (50) 1 (50) 0 (0) Table S2 : Frequency of imprecise KI events Fidelity of KI events detected in embryos from Table 1 was verified by sequencing. Some embryos displayed only the expected KI allele (precise), some displayed only one or several imprecise alleles (imprecise), and some displayed both the expected allele and an imprecise allele (both). See supplementary figure S3 and S4 for details. : 50 ng/µl of each sgrna
8 Usage Primer name Primer sequence Genotyping ExtF CACACGGGTCCCTCTGGCCTTCT ExtR CCTGCCCGCCTAGTCTCTACCTCC NleF GATTTAACGCTCCGTCTTTCC NleR CCTCATCCTGGAACTGTACGA HAF TGAAAAGAAGGCGCGAAG HAR TAATCTGGAACATCATATGGGTACC GFPF GACGAGCTGTACAAGGGAGT GFPR AGTCGGCTCAATCCCAACT OT1ExtF GAGTTAATACTCTGAAGGGT OT1ExtR GGTAAGGAAAGCTGCCATAG OT1intF GGTGATTCTAGTCTGGGTACTT OT1intR GGACTCTGTCCATTATTGGAG OT3ExtF ATTTGAAACTTGGCGGCCC OT3ExtR GGCAAATTCCAAACTCTCCCA OT3intF TCTGAGAAGGAATCGGGTGC OT3intR CCTCCTCGATCCTCCCCT Sox2ExtF AGCTCGCAGACCTACATGAA Sox2ExtR CCCTCAGGTTTTCTCTGTACAA Sox2F GATCAGCATGTACCTCCCCG Sox2R CGTTTCGCTGCGGAGATTTT Sequencing WTF1 TACTGTGAAAAGAAGGCGCG WTF2 AGAGGATCATGGAGTTCAAGG HAF1 ggacgcaggatggggtaccca HAR2 cgcagcataatctggaacatc GFPF2 TCCGATATTCCCAGCATCCC GFPR2 CTGTCCAGGGATGCCATCTC seqhaf2 TCCGAGAGCGGCTTGACTCCT seqgfpf3 ACGGCCACAAGTTCAGCGTGT seqgfpf4 CCTGGTGAACCGCATCGAGCT seqot12 CTTAAGGAGAAAATAGACAGT seqot3 TTAGGAGCACGGGGTGACGAT BSB1 AAGGCGATTAAGTTGGGT BSB2 GGCTCGTATGTTGTGTGG Cas9 mrna synthesis wtcas9f gtaatacgactcactatagggagaatggactataaggaccacgac wtcas9r GCGAGCTCTAGGAATTCTTAC Cas9nF gtaatacgactcactatagggagaatgtacccatacgatgttccagattacgc Cas9nR GCGAGCTCTAGGAATTCTTAG sgrna synthesis sgrna1f caccgtggggacgcaggatggcgg sgrna1r aaacccgccatcctgcgtccccac sgrna2f caccccccacgtggaggagaaccg sgrna2r aaaccggttctcctccacgtgggg sgrna3f cacctggtggtaggtgtacgcgca sgrna3r aaactgcgcgtacacctaccacca sgsox2f caccgtgcccctgtcgcacatgtga sgsox2r aaactcacatgtgcgacaggggcac T7-sgRNA1 gtaatacgactcactataggggtggggacgcaggatggcgg T7-sgRNA2 gtaatacgactcactatagggccccacgtggaggagaaccg T7-sgRNA3 gtaatacgactcactatagggtggtggtaggtgtacgcgca T7-sgSox2 gtaatacgactcactataggggtgcccctgtcgcacatgtga allsgrnar AAAAGCACCGACTCGGTGCC Reparation matrix synthesis NleGFP250F CTCCTGCCTCTGTGAGCTAGG NleGFP250R GCGCGTTGCACACCAGCTGCA NleGFP60F TAACGCTCCGTCTTTCCGCCT NleGFP60R CCCCACGCGGAGACCCGGCAT
9 Nle-HA ssodn Sox2-HA ssodn ACATGGATTTAACGCTCCGTCTTTCCGCCTCGGTTCTCCTCCACGTGGGGACGCAGGATG GGGTACCCATATGATGTTCCAGATTATGCTGCGGCGGCGGTGGTGGTAGGTGTACGCGC ACGGGGCGGGGATGCCGGGTCTCCGCGTGGG TACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTGTCGCACAT GTACCCATATGATGTTCCAGATTATGCTTGAGGGCTGGACTGCGAACTGGAGAAGGGGA GAGATTTTCAAAGAGATACAAGGGAATTG Table S3 : Oligonucleotides used in this study
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al.
Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s disease-like pathology Nagata et al. Supplementary Fig 1. Previous App knock-in model did not show Aβ accumulation
Nature Biotechnology: doi: /nbt.4166
Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained
Supplementary Figure 1
Supplementary Figure 1 Product purity of cytosine base editing for the wheat genomic loci tested. Product distributions and indels frequencies at four representative wheat genomic DNA sites in wheat protoplasts
Easi CRISPR for conditional and insertional alleles
Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs
Using CRISPR for genetic alteration
Using CRISPR for genetic alteration Joffrey Mianné. j.mianne@har.mrc.ac.uk Mary Lyon Centre, MRC Harwell. CRISPR/Cas origins Origin of the CRISPR/Cas system: Clustered-Regularly Interspaced Short Palindromic
Supplementary Figure 1 Activities of ABEs using extended sgrnas in HEK293T cells.
Supplementary Figure 1 Activities of ABEs using extended sgrnas in HEK293T cells. Base editing efficiencies of ABEs with extended sgrnas at Site 18 (a), Site 19 (b), the HBB-E2 site (c), and the HBB-E3
CRISPR/Cas9 Mouse Production
CRISPR/Cas9 Mouse Production Emory Transgenic and Gene Targeting Core http://cores.emory.edu/tmc Tamara Caspary, Ph.D. Scientific Director Teresa Quackenbush --- Lab Operations and Communications Coordinator
Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementary Information Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells Josep V. Forment 1,2, Mareike Herzog
Supplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
Applications of Cas9 nickases for genome engineering
application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,
Supplementary Information
Supplementary Information This Supplementary Information file contains the following contents: Supplementary Methods, Supplementary Discussion, Supplementary Figures (S1~S9), Supplementary Tables (1~3)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The
Efficient generation of conditional knockout mice by CLICK
Efficient generation of conditional knockout mice by CLICK Tomoji Mashimo Genome Editing Research and Development (R&D) Center and Institute of Experimental Animal Sciences, Graduate School of Medicine,
Genome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
Genome Engineering with ZFNs, TALENs and CRISPR/Cas9
Genome Engineering with ZFNs, TALENs and CRISPR/Cas9 Designer Endonucleases ZFNs (zinc finger nucleases), TALENs (transcription activator-like effector nucleases) and CRISPR/Cas9 (clustered regularly interspaced
dsxf - wt wt dsxf bp 2493bp Nature Biotechnology: doi: /nbt.4245 Supplementary Figure 1
5 3 2493bp 2426bp attp GFP 3xP3 attp CDS dsxf - wt wt dsxf - Supplementary Figure 1 Molecular confirmation of the correct integration of the HDR-mediated event to generate dsxf PCRs were performed to verify
Supplementary Materials. China
Supplementary Materials An Efficient Genotyping Method for Genome-modified Animals and Human Cells Generated with CRISPR/Cas9 System Xiaoxiao Zhu 1,2 *, Yajie Xu 1 *, Shanshan Yu 1 *, Lu Lu 1,2, Mingqin
CRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
You use the UCSC Genome Browser (www.genome.ucsc.edu) to assess the exonintron structure of each gene. You use four tracks to show each gene:
CRISPR-Cas9 genome editing Part 1: You would like to rapidly generate two different knockout mice using CRISPR-Cas9. The genes to be knocked out are Pcsk9 and Apoc3, both involved in lipid metabolism.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)
Allele-specific locus binding and genome editing by CRISPR at the
Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure
Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494
Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting
Supplementary Figures and Figure legends
Supplementary Figures and Figure legends 3 Supplementary Figure 1. Conditional targeting construct for the murine Satb1 locus with a modified FLEX switch. Schematic of the wild type Satb1 locus; the conditional
Supplementary Information Targeting fidelity of adenine and cytosine base editors in mouse embryos
Supplementary Information ing fidelity of adenine and cytosine base s in mouse embryos Lee et al. a P = 1.012e-14 b Frequency (%) 100% 80% 60% 40% 20% 0% CB AB On-target Bystander Proximal Indels Frequency
TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:
TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene
CRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
SUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
BurrH: a new modular DNA binding protein for genome engineering
Supplementary information for: BurrH: a new modular protein for genome engineering Alexandre Juillerat, Claudia Bertonati, Gwendoline Dubois, Valérie Guyot, Séverine Thomas, Julien Valton, Marine Beurdeley,
Schematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
Inhibition of HSV-1 Replication by Gene Editing Strategy. Running Title: Targeting HSV-1 Infection by CRISPR/Cas9
SUPPLEMENTARY MATERIALS 2/4/16 Inhibition of HSV-1 Replication by Gene Editing Strategy Running Title: Targeting HSV-1 Infection by CRISPR/Cas9 Pamela C. Roehm 1,2,3*, Masoud Shekarabi 1, Hassen Wollebo
Supplementary Materials
Supplementary Materials Supplementary Methods Supplementary Discussion Supplementary Figure 1 Calculated frequencies of embryo cells bearing bi-allelic alterations. Targeted indel mutations induced by
Supplementary Figure 1. CRISPR/Cas9-induced targeted mutations in TaGASR7, TaDEP1, TaNAC2, TaPIN1, TaLOX2 and TaGW2 genes in wheat protoplasts.
Supplementary Figure 1. CRISPR/Cas9-induced targeted mutations in TaGASR7, TaDEP1, TaNAC2, TaPIN1, TaLOX2 and TaGW2 genes in wheat protoplasts. Lanes 1 and 2: digested CRISPR/Cas9-transformed protoplasts;
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
CRISPR Applications: Mouse
CRISPR Applications: Mouse Lin He UC-Berkeley Advantages of mouse as a model organism similar to human Can be genetically manipulated Isogenic and congenic genetic background An accelerated lifespan. Well-characterized
CRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
Homology-directed repair with Dharmacon Edit-R CRISPR-Cas9 reagents and single-stranded DNA oligos
APPLICATION NOTE Homology-directed repair with Dharmacon Edit-R CRISPR- reagents and single-stranded DNA oligos John A. Schiel, Eldon Chou, Maren Mayer, Emily M. Anderson, and Anja van Brabant Smith Horizon
Supporting Information
Supporting Information Park et al. 10.1073/pnas.1410555111 5 -TCAAGTCCATCTACATGGCC-3 5 -CAGCTGCCCGGCTACTACTA-3 5 -TGCAGCTGCCCGGCTACTAC-3 5 -AAGCTGGACATCACCTCCCA-3 5 -TGACAGGAACACCTACAAGT-3 5 -AAGGCACCTTTCTGTCTCCA-3
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
i-stop codon positions in the mcherry gene
Supplementary Figure 1 i-stop codon positions in the mcherry gene The grnas (green) that can potentially generate stop codons from Trp (63 th and 98 th aa, upper panel) and Gln (47 th and 114 th aa, bottom
Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.
Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin
Map-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced
Supplementary Data Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced mutations Suresh Ramakrishna 1, Seung Woo Cho 2, Sojung Kim 2, Myungjae Song 1, Ramu Gopalappa
Supplementary Information
Supplementary Information Generation of inheritable and transgene clean targeted genome-modified rice in later generations using the CRISPR/Cas9 system. Rong-Fang Xu, Hao Li, Rui-Ying Qin, Juan Li, Chun-Hong
SUPPLEMENTARY INFORMATION
VOLUME: 1 ARTICLE NUMBER: 0066 In the format provided by the authors and unedited. Engineering CRISPR-Cpf1 crrnas and mrnas to maximize genome editing efficiency Bin Li 1, Weiyu Zhao 1, Xiao Luo 1, Xinfu
Optimizing Cas9 and sgrna concentrations for increasing mutation efficiency. Nature Methods: doi: /nmeth.3360
Supplementary Figure 1 Optimizing Cas9 and sgrna concentrations for increasing mutation efficiency. (a) Wild-type, 2-dpf slc24a5 b1 embryos and a series of slc24a5 CRISPR-injected embryos; anterior is
Donor DNA Utilization during Gene Targeting with Zinc- finger Nucleases
Donor DNA Utilization during Gene Targeting with Zinc- finger Nucleases Kelly J. Beumer, Jonathan K. Trautman, Kusumika Mukherjee and Dana Carroll Department of Biochemistry University of Utah School of
Genome edi3ng with the CRISPR-Cas9 system
CRISPR-Cas9 Genome Edi3ng Bootcamp AHA Council on Func3onal Genomics and Transla3onal Biology Narrated video link: hfps://youtu.be/h18hmftybnq Genome edi3ng with the CRISPR-Cas9 system Kiran Musunuru,
Supplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444
Supplementary Figure 1 Diagram for CATCHA construct. Supplementary Figure 2 Representative view of ebony (left) and non-ebony (right) F2 flies from experiments described in Fig. 1c. F0 #1 F0 #2 F0 #3 F0
Soyeong Jun 1, 3, Hyeonseob Lim 1, 3, Hoon Jang 1, Wookjae Lee 1, Jinwoo Ahn 1, Ji Hyun Lee 2,*, Duhee Bang 1,* Korea
Straightforward Delivery of Linearized Double-stranded DNA Encoding sgrna and Donor DNA for the Generation of Single Nucleotide Variants Based on the CRISPR/Cas9 System Soyeong Jun 1, 3, Hyeonseob Lim
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
A Guide to CRISPR/Cas9
Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse
XactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events
Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Steve Siembieda, MS MBA VP Commercialization ABRF Conference February 2015 What Is CRISPR? Clustered
Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.
Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)
Supplementary Materials for
www.sciencemag.org/cgi/content/full/science.aaa5945/dc1 Supplementary Materials for The mutagenic chain reaction: A method for converting heterozygous to homozygous mutations Valentino M. Gantz* and Ethan
Supplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
Construct Design and Cloning Guide for Cas9-triggered homologous recombination
Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner
Using mutants to clone genes
Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
Figure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi
Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
Virus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening
Supplementary Information Virus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening Tao Zhou 2,3, Hang Zhang 2,4, Tongfei Lai 1, Cheng Qin 1, Nongnong
Biol 321 Spring 2013 Quiz 4 25 pts NAME
Biol 321 Spring 2013 Quiz 4 25 pts NAME 1. (3 pts.) a. What is the name of this compound? BE EXPLICIT deoxyribose 5 b. Number the carbons on this structure: 4 1 3 2 2. (4 pts.) Circle True or False. If
Revised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
SUPPLEMENTARY INFORMATION
Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers Wataru Sakai, Elizabeth M. Swisher, Beth Y. Karlan, Mukesh K. Agarwal, Jake Higgins, Cynthia Friedman, Emily Villegas,
Erhard et al. (2013). Plant Cell /tpc
Supplemental Figure 1. c1-hbr allele structure. Diagram of the c1-hbr allele found in stocks segregating 1:1 for rpd1-1 and rpd1-2 homozygous mutants showing the presence of a 363 base pair (bp) Heartbreaker
Percent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
A) (5 points) As the starting step isolate genomic DNA from
GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB
Nature Biotechnology: doi: /nbt.4199
Supplementary Figure 1 Base editing activities of engineered A3A-BE3 variants with mutations designed to disrupt non-specific interactions with substrate ssdna. Graphs illustrating the frequencies of C
7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
CRISPR/Cas9 Efficiency and Biological Impacts in Transgenic Poplars and Eucalypts. Estefania Elorriaga and Steven H. Strauss Oregon State University
CRISPR/Cas9 Efficiency and Biological Impacts in Transgenic Poplars and Eucalypts Estefania Elorriaga and Steven H. Strauss Oregon State University Background Outline CRISPR, goals, target genes Mutagenesis
CRISPR/Cas9 Gene Editing
CRISPR/Cas9 Gene Editing Fragment Analyzer Automated CE System Identify single-cell mutations and determine mutation frequency. Mutation analysis by capillary electrophoresis provides significant benefits
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 ATP1A1 variants with in-frame deletions are enriched in ouabain-resistant cell populations. (a) Total editing efficacy along with spectrum and frequency of individual indels as determined
Supplementary Information. Isl2b regulates anterior second heart field development in zebrafish
Supplementary Information Isl2b regulates anterior second heart field development in zebrafish Hagen R. Witzel 1, Sirisha Cheedipudi 1, Rui Gao 1, Didier Y.R. Stainier 2 and Gergana D. Dobreva 1,3* 1 Origin
embryos. Asterisk represents loss of or reduced expression. Brackets represent
Supplemental Figures Supplemental Figure 1. tfec expression is highly enriched in tail endothelial cells (A- B) ISH of tfec at 15 and 16hpf in WT embryos. (C- D) ISH of tfec at 36 and 38hpf in WT embryos.
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:
User Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption
User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)
Innovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050
Innovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050 Greg Gocal, Ph.D., Senior Vice President, Research and Development CRISPR Precision
ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster
Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs
Enzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
Introduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products
Introduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products which one is right for you? CRISPR Workflow abm s Toolbox
TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:
Only for teaching purposes - not for reproduction or sale CELL TRANSFECTION transient stable TRANSGENIC ANIMALS - Two methods to produce transgenic animals: 1- DNA microinjection 2- embryonic stem cell-mediated
File name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References.
1 2 File name: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References. 3 1 4 Supplementary Figures 5 6 7 Figure S1 Comparison of the One-Step-Assembly
Analysis of gene function
Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or
Targeted complete next generation sequencing and quality control of transgenes and integration sites in CHO cell line development
Targeted Locus Amplification Technology Targeted complete next generation sequencing and quality control of transgenes and integration sites in CHO cell line development Cergentis B.V. Yalelaan 62 3584
CRISPR Genome Editing Embryo Microinjection Service Catalog
CRISPR Genome Editing Embryo Microinjection Service Catalog CRISPR Genome Editing Services (Drosophila) Embryo Microinjection Services (Drosophila & Mosquito) ellgenetics.com +8862-2651-1809 +8862-2782-9911
SUPPLEMENT MATERIALS FOR CURTIN,
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 SUPPLEMENT MATERIALS FOR CURTIN, et al. Validating genome-wide association candidates: Selecting, testing, and characterizing
High-throughput genotyping of CRISPR/Cas9-mediated mutants using fluorescent
High-throughput genotyping of CRISPR/Cas9-mediated mutants using fluorescent PCR-capillary gel electrophoresis Muhammad Khairul RAMLEE, Tingdong YAN, Alice M. S. CHEUNG, Charles CHUAH, Shang LI Figure
GENOME 371, Problem Set 6
GENOME 371, Problem Set 6 1. S. pombe is a distant relative of baker s yeast (which you used in quiz section). Wild type S. pombe can grow on plates lacking tryptophan (-trp plates). A mutant has been
Biotechnology Chapter 20
Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the
Application Note: Generating GFP-Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors
Application Note: Generating GFP-Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors Table of Contents: I. Background Pg. 1 II. Analysis of Gene Target
Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin
Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu
A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish
Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae
Supplementary Figure 1. Quantitative RT-PCR experimental validation of CRISPR/Cas9 and sgrnas expression in HEK293A transfected cells.
Supplementary Figure 1. Quantitative RT-PCR experimental validation of CRISPR/Cas9 and sgrnas expression in HEK293A transfected cells. HEK293A cells were transfected with the indicated combinations of
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10163 Supplementary Table 1 Efficiency of vector construction. Process wells recovered efficiency (%) Recombineering* 480 461 96 Intermediate plasmids 461 381 83 Recombineering efficiency
Authors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
Isolation of single-base genome-edited human ips cells without
Nature Methods Isolation of single-base genome-edited human ips cells without antibiotic selection Yuichiro Miyaoka, Amanda H. Chan, Luke M. Judge, Jennie Yoo, Miller Huang, Trieu D. Nguyen, Paweena P.