Corneal Epithelial Cell Attachment with Endogenous Laminin and Fibronectin

Size: px
Start display at page:

Download "Corneal Epithelial Cell Attachment with Endogenous Laminin and Fibronectin"

Transcription

1 Corneal Epithelial Cell Attachment with Endogenous Laminin and Fibronectin Masahito Ohji, Lawrence Mandarino, Nirmala SundarRaj, and Richard A. Thoft Purpose. To evaluate the role of endogenously produced laminin and fibronectin as well as the effect of exogenous laminin and fibronectin in the attachment of human corneal epithelial cells in vitro. Methods. Primary cultured human corneal epithelial cells labeled with 3 H-thymidine were seeded onto plates coated with laminin or fibronectin, or onto uncoated bacteriologic plates. Attachment of cells was measured in the presence or absence of antisera against laminin or fibronectin, by counting radioactivity. Results. Human corneal epithelial cells attached to plates coated with human laminin or human fibronectin in a dose-dependent manner, with 69% and 50% of cells attached to the wells coated with 40 ng/m\ of laminin and fibronectin, respectively (P < 0.001). The percentage of attachment to uncoated bacteriologic plates increased from 1.2% at 45 min of incubation to 6.7% at 90 min, 22.2% at 3 hr, and 40.1% at 6 hr of incubation. Cycloheximide, a protein synthesis inhibitor, completely inhibited cell attachment. Rabbit antiserum against human fibronectin reduced cell attachment to the uncoated plates to 67% of the control value (P < 0.01), whereas rabbit antiserum against human laminin decreased the attachment to 52% of the control (P < 0.01). A combination of these two antisera reduced cell attachment to 46% of the control (P < 0.01). Conclusions. Endogenous laminin and fibronectin as well as exogenous laminin and fibronectin play significant roles in the attachment of human corneal epithelial cells in culture. Invest Ophthalmol Vis Sci. 1993; 34: V>«orneal epithelial cells rest on a thin layer of extracellular matrix (ECM) called basement membrane, which plays a crucial role in epithelial adhesion to underlying stroma. 1 ECM have many effects on cell adhesion, proliferation, and differentiation, and the nature of these effects depend on types of ECM and associated cells. 2 " 5 From The Eye and Ear Institute, Department of Ophthalmology, University of Pittsburgh, Pittsburgh, Pennsylvania. Supported by National Eye Institute grants, EY06185 (RAT), core grant (RAT), EY03263 (MS), EY08391 (LM); unrestricted grants from Research to Prevent lilindness, New York, New York; and The Eye and Ear Institute Foundation, Pittsburgh. Submitted for publication: July 20, 1992; December 28, Proprietary interest category: N. Reprint requests: Nirmala SunderRaj, The Eye and Ear Institute, 203 Lothrop Street, Pittsburgh, PA Fibronectin is not detected on the basement membrane in normal rabbit cornea 6 but appears beneath migrating epithelial cells during cornea wound healing. There are conflicting reports regarding the role of fibronectin in corneal epithelial healing. Nishida et al reported that exogenously added fibronectin promoted corneal wound healing in vivo and in vitro. 78 However, a recent clinical study showed that topical fibronectin had no effect on human persistent epithelial defects. 9 In addition, others have reported that fibronectin neither promotes wound healing in animals after epithelial scrape or keratectomy in vivo, nor does it promote wound closure. 10 " 14 Laminin, a glycoprotein that is one of the major components of basement membrane, 15 is also thought to play significant roles in wound healing. Laminin is Investigative Ophthalmology & Visual Science, July 1993, Vol. 34, No. 8 Copyright Association for Research in Vision and Ophthalmology 2487

2 2488 Investigative Ophthalmology & Visual Science, July 1993, Vol. 34, No. 8 resynthesized within 48 hr in rabbit corneal wound healing. 16 In addition, recent reports suggest correlation between early appearance of laminin and hemidesmosome formation or focal adhesion Epithelial cells not only react to exogenously added ECM but also produce endogenous ECM However, information about the role of endogenously produced ECM in corneal wound healing is very limited, compared to a large number of reports describing effects of exogenously supplied ECM. This report evaluates the role of endogenously produced fibronectin and laminin as well as the effects of exogenously supplied fibronectin and laminin, on human corneal epithelial cell attachment in vitro. MATERIALS AND METHODS Corneal Epithelial Cells Preparation Human corneal cells were obtained by the method of Ebato et al. 20 Briefly, four 2X2 mm limbal explants were placed on a 35-mm dish with the epithelial side up and were allowed to dry for approximately 5 min. One milliliter of modified supplemented hormonal epithelial medium, 21 consisting of equal volumes of Dulbecco's Modified Eagle Medium (DMEM, Gibco-BRL, Gaithersburg, MD) and Ham's F12 (Gibco-BRL) enriched with 15% fetal bovine serum, 10 ng/ml epidermal growth factor (Earth Chemical, Hyogo, Japan), 0.1 Mg/ m l cholera toxin (Sigma, St. Louis, MO), 1 mm 1-glutamine (Gibco-BRL), 5 jug/ml insulin (Collaborative Research, Bedford, MA), 0.5% dimethyl sulfoxide (Fisher, Pittsburgh, PA) and 20 /ug/ml gentamicin (Elkins-Sinn, Cherry Hill, NJ), was added. Culture medium was changed every 2 or 3 days until corneal epithelial cells had covered 80% of the dish. Corneas were obtained from the Eye Bank of Western Pennsylvania. Adhesion Assay When corneal epithelial outgrowth had reached approximately 80% of the dish, the explants were removed and corneal epithelial cells were labeled with 2 ml of supplemented hormonal epithelial medium containing 25 ^Ci/ml of 3 H-thymidine (20 Ci/mmol, NEN, Boston, MA) for 24 hr. 22 The cells were treated with 0.25% trypsin/0.1% ethylenediaminetetraacetic acid for approximately 10 min then, 0.5 mg/ml soybean trypsin inhibitor in DMEM (Sigma) was added to stop trypsin digestion. Cells were suspended and washed with DMEM three times and a final suspension was prepared to a density of 1.0 X 10 5 cells/ml or 5.0 X 10 5 cells/ml in DMEM containing 0.2% heat denatured bovine serum albumin (Sigma). In some assays, 25 Mg/ml cycloheximide was added to the culture 2 hr before cells were harvested and it was included in the medium throughout the assays to determine the effect of inhibition of protein synthesis on cell attachment. For assays of cell attachment to exogenously provided ECM, bacteriologic 24-well plates (Coaster, Cambridge, MA) were coated at 37 C for 2 hr with 250 ix\ of human fibronectin (Gibco-BRL) or human laminin (Telios, San Diego, CA) diluted to 40 Mg/ml with DMEM. The coated plates as well as noncoated plates used for studying endogenously produced laminin and fibronectin were incubated with 10 mg/ml of bovine serum albumin at 37 C for 1 hr to block nonspecific binding sites. In each well, 5 x 10 4 cells labeled with 3 H-thymidine were seeded and the cells were allowed to attach to the plate for 45 min to 6 hr. After incubation, unattached cells were rinsed by washing three times with phosphate buffered saline with Ca ++ and Mg ++. The cells that remained attached were lysed with 1 ml of 1% sodium dodecyl sulfate (Bio-Rad, Richmond, CA) and radioactivity of each sample was measured by liquid scintillation counting (Beckman, Fullerton, CA). Attachment of cells was calculated by dividing the radioactivity in cells that remained attached by the total radioactivity in the original cell suspension. In inhibition assays, cells were allowed to attach in the presence of rabbit antiserum against human laminin (Telios) or rabbit antiserum against human fibronectin (Telios), which had been diluted 1:20 with DMEM containing 0.2% bovine serum albumin with or without cycloheximide. Percentages of attachment under these conditions were compared to control values obtained by allowing cells to attach in the absence of antisera. Detection of Laminin and Fibronectin Synthesized by Epithelial Cells Nonlabeled human corneal epithelial cells were seeded on 35-mm plastic dishes at a density of 3 X 10 5 /dish in the same manner as that described for the attachment assay. The cells were labeled with 200 MCi/ml of 35 S-methionine in methionine-free medium for 24 hr. The medium was collected and immunoprecipitated with the rabbit antisera against human laminin or human fibronectin. Immunoprecipitates were subjected to sodium dodecyl sulfate 7% polyacrylamide gel electrophoresis, 23 then autoradiography. Statistics Differences between means were compared by t tests. RESULTS Cell Attachment to Exogenously Provided ECM After 45 min of incubation, human corneal epithelial cells attached to plates coated with human laminin or human fibronectin in a dose-dependent manner, with 69% and 50% of cells attached to the wells coated with

3 Endogenous Corneal Epithelial Attachment Factors Mg/ml of laminin and fibronectin, respectively (P < 0.001, Fig. l).the attachment to the fibronectin-or laminin-coated plates did not increase between 45 min and 6 hr (data not shown). Inhibition assays using rabbit antisera against human laminin or human fibronectin were carried out to confirm that the attachments were promoted specifically by laminin or fibronectin. Rabbit antiserum against human laminin inhibited the attachment to the laminin-coated plates, yielding 24% of the control attachment, whereas it did not inhibit the attachment to the fibronectin coated plates (P < 0.001, Figure 2). Conversely, antiserum against human fibronectin inhibited the attachment to the fibronectin-coated plates, yielding 6% of the control attachment but did not inhibit the attachment to the laminin coated plates (P< 0.01, Fig. 2). To evaluate the role of de novo synthesis of proteins in the adhesion to plates coated with ECM, cells were treated with cycloheximide to inhibit protein synthesis. Cycloheximide treatment did not change the pattern of cell attachment to fibronectin- or laminincoated plates (Fig. 3) S«E o laminin fibronectin coated materials anti-serum against laminin anti-serum against fibronectin FIGURE 2. Inhibition of cell adhesion to bacteriologic plates coated with laminin or fibronectin with antisera against laminin or fibronectin at 45 min incubation. Data are presented as mean ± SD (**P < 0.0 1, ***P < 0.00 J) of values from four experiments, each done in triplicate. Cell Attachment to Bacteriologic Plates Cornea] epithelial cells attached to the uncoated plates in a time-dependent manner. The percentage of attachment increased from 1.2% at 45 min incubation to 6.7% at 90 min, 22.2% at 3 hr, and 40.1% at 6 hr incubation (Figure 4). The attachment to the uncoated plates at 6 hr was approximately 80% of that seen on fibronectin coated plates at 6 hr incubation. Treatment of the cells with 25 ug/ml cycloheximide, which inhibits de novo protein synthesis, completely inhibited their attachment to the uncoated plates (Fig. 4). To evaluate the role of endogenously produced laminin or fibronectin in cell adhesion, inhibition assays were carried out using rabbit antiserum against human laminin or antiserum against human fibronec coating concentraion (ug/ml) - -laminin -a- fibronectin FIGURE l. Cell attachment to bacteriologic plates coated with laminin or fibronectin at 45 min incubation. Human corneal epithelial cells attached more to the plate coated with 40 Mg/ml of laminin than that coated with 40 Mg/in' of fibronectin (P < 0.001), Data are presented as mean ± SD of values from four experiments, each done in triplicate. fibronectin laminin coated materials cycloheximide(-) cycloheximide(+) FIGURE 3. Effect of 25 Mg/ml cycloheximide treatment on cell attachment to bacteriologic plates coaled with lamiriin or fibronectin at. 45 min incubation. Error bars represent SEM from four assays, each assay clone in triplicate.

4 2490 Investigative Ophthalmology 8c Visual Science, July 1993, Vol. 34, No t 2 incubation time (h) -o- cycloheximide(-) - - cycloheximide(+) FIGURE 4. Cell adhesion to uncoated bacteriologic plates: time dependence and effect of cycloheximide treatment. Error bars represent SEM from six assays, each assay done in triplicate. tin. Rabbit antiserum against human fibronectin reduced cell attachment to the uncoated plates to 67% of the control value (P < 0.01, Figure 5), whereas rabbit antiserum against human laminin decreased the attachment to 5 2% of the control (P < 0.01) and a combination of these two antisera reduced cell attachment to 46% of the control (P < 0.01). Conversely, preimmune rabbit serum did not inhibit the cell attachment. Detection of Laminin and Fibronectin Synthesized by Epithelial Cells Biosynthesis of fibronectin and laminin by human corneal epithelial cells was biochemically assessed. The medium precipitated with rabbit serum against human laminin showed two bands corresponding to laminin on autoradiography by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Figure 6; purified laminin showed two bands 190 kda and 400 kda). When culture supernatants were immunoprecipitated with rabbit antisera against human fibronectin, bands corresponding to human fibronectin were detected (purified fibronectin showed a 220-kDa band). species. In the current study the role of matrix components in human corneal epithelial attachment was evaluated, which previously had not been elucidated well. Results of the current study indicate that human corneal epithelial cells adhere to both fibronectin and laminin. Although human corneal epithelial cells can attach both to exogenous fibronectin and laminin, laminin is a better substrate for their attachment. Conversely rabbit corneal epithelial cells were previously shown to adhere better to fibronectin than to laminin. 24 The discrepancy between that report and our results may be attributable to species-specific differences in the corneal epithelial cells. Rabbit and human corneal epithelial cells have been shown to differ in their rate of proliferation and differentiation as monitored by specific keratin expression. 25 Sources (animal species) of the matrix components may cause different results in experimental findings. In fact, in our preliminary experiments, human corneal epithelial cells did not attach efficiently to mouse laminin obtained from two different sources. The use of 3 H-thymidine to monitor cell attachment in these experiments theoretically could have influenced the results, because this method would label proliferating cells preferentially, which might behave differently from cells that are more quiescent. However, in preliminary experiments, we used a method to measure cell attachment that involved electronic cell counting after attached cells had been released by trypsinization, and we achieved the same results. Because this method would not distinguish between proliferating and nonproliferating cells, we believe that the use of 3 H-thymidine did not bias the results. In the maintenance of healthy corneal epithelium in the normal eye or during wound healing, endogenously produced ECM may be as much as or more -^ 120 DISCUSSION Corneal epithelial cell attachment to underlying connective tissue is important not only in normal eyes but also during wound healing. Extracellular matrix is believed to play crucial roles in the attachment. Current information about corneal epithelial attachment mainly comes from animal experiments that have examined the effects of exogenously added matrix components on the cell attachment. The extracellular matrix influence may vary not only depending on the responding cell type but also depending on the animal anti-fibronectin anti-laminin anti-fn & anti-lm preimmune serum antisera FIGURE 5. Inhibition of cell adhesion to uncoated bacteriologic plates with antisera against laminin or fibronectin at 3 hr incubation. Data are presented as means ± SD (*P < 0.05, ** p < 0.01) of results from four experiments, each done in triplicate.

5 Endogenous Corneal Epithelial Attachment Factors demonstrating that cell attachment does not occur if protein synthesis is inhibited by cycloheximide. Laminin and fibronectin are two of the matrix components that are newly synthesized and used by the cells for attachment. This is evident from the inhibition of cell attachment by antisera against laminin and fibronectin. Other endogenously produced ECM such as collagen are also likely to play a part in cell attachment, because a combination of antisera against laminin and fibronectin did not completely inhibit cell attachment to the uncoated dishes. Although fibronectin is thought to play a key role in wound healing, there are conflicting reports about promotion of corneal wound healing by exogenously added fibronectin.7"12 In our experiments, attachment to the uncoated bacteriologic plates requires longer incubation than that with fibronectin-coated plates. However, the attachment to the uncoated plates is approximately 80% of that to fibronectin coated plates when incubated for 6 hr. Therefore, endogenously produced ECM may be sufficient and exogenously added fibronectin may not be critical in cell adhesion. In summary, we showed that endogenous laminin and fibronectin as well as exogenous laminin and fibronectin play significant roles in human corneal epithelial cell attachment in vitro. Factors stimulating endogenous laminin and fibronectin synthesis may be useful in treatment of ocular surface diseases characterized by poor adhesion of epithelium to substrate. Mr kda Key Words 45 corneal epithelium, attachment, endogenous, laminin, fibronectin - References 1 6. Autoradiography after immunoprecipitation and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Lane 1, culture supernatant immunoprecipitated with antiserum against human laminin; lane 2, culture supernatant immunoprecipitated with antiserum against human fibronectin; lane 3, culture supernatant immunoprecipitated with preimmune rabbit serum. FIGURE important than exogenously provided ECM as observed in other cell types.17'26 However, influences of endogenously produced ECM in the attachment of human corneal epithelial cell had not been elucidated. To evaluate the role of endogenously produced ECM, we examined cell adhesion to bacteriologic plates that were not coated with matrix components (coated with bovine serum albumin to block nonspecific cell binding). The ability of corneal epithelial cells to attach to these bacteriologic dishes and its time dependency suggest that these cells de novo synthesize ECM, which are used for their attachment. This is also suggested by 1. Khodadoust AA, Silverstein AM, Kenyon KR, Dowling JE. Adhesion of regenerating corneal epithelium: the role of basement membrane. Am J Ophthalmol. 1968;65: Vlodavsky I, Gospodarowicz D. Respective roles of laminin and fibronectin in adhesion of human carcinoma and sarcoma cells. Nature. 1981; 289: Aumailley M, Timpl R. Attachment of cells to basement membrane collagen type IV. J Cell Biol. 1986;103: Adams JC, Watt FM. Fibronectin inhibits the terminal differentiation of human keratinocytes. Nature 1989; 340: Terranova VP, Rohrbach DH, Martin GR. Role of laininin in the attachment of PAM 212 (epithelial) cells to basement membrane collagen. Cell 1980; 22: Fujikawa LS, Foster CS, Gipson IK, Colvin RB. Basement membrane components in healing rabbit corneal epithelial wounds: Immunofluorescence and ultrastructural studies. J Cell Biol. 1984;98: Nishida T, Nakagawa S, Nishibayashi C, Tanaka H, Manabe R. Fibronectin enhancement of corneal epi-

6 2492 Investigative Ophthalmology & Visual Science, July 1993, Vol. 34, No. 8 thelial wound healing of rabbits in vivo. Arch Ophthalmol 1984; 102: Nishida T, Nakagawa S, Awata T, Ohashi Y, Watanabe K, Manabe R. Fibronectin promotes epithelial migration of cultured rabbit cornea in situ. J Cell Biol. 1983;97: Gordon J, Johnson P. Results of a randomized double-masked, multicenter clinical trial of fibronectin in the treatment of persistent epithelial defects (PED). Invest Ophthalmol Vis Sci. ARVO abstracts. 1992; 33: Boisjoly HM, Sun R, Giasson M, Beaulieu A. Topical fibronectin and aprotinin for keratectomy wound healing in rabbits. Arch Ophthalmol. 1990; 108: Newton C, Hatchell DL, Klintworth GK, Brown CF. Topical fibronectin and corneal epithelial wound healing in the rabbit. Arch Ophthalmol. 1988; 106: Soong HK, Hassan T, Varani J, Huang SC, Brennan M. Fibronectin does not enhance epidermal growth factor-mediated acceleration of corneal epithelial wound closure. Arch Ophthalmol. 1989; 107: Phan TMM, Foster CS, Wasson PJ, Fujikawa LS, Zagachin LM, Colvin RB. Role of fibronectin and fibrinogen in healing of corneal epithelial scrape wounds. Invest Ophthalmol Vis Sci. 1989;30: Phan TMM, Foster CS, Zagachin LM, Colvin RB. Role of fibronectin in the healing of superficial keratectomies in vitro. Invest Ophthalmol Vis Sci. 1989; 30: Timple R, Rohde H. Laminin a glycoprotein from basement membranes. J Biol Chem. 1979; 254: Gipson IK, Spurr-Michaud S, Tisdale A, Keough M. Reassembly of the anchoring structures of the corneal epithelium during wound repair in the rabbit. Invest Ophthalmol Vis Sci. 1989;30: Kurpakus MA, Stock EL, Jones JCR. Analysis of wound healing in an in vitro model: early appearance of laminin and a 125 X10 3 M r polypeptide during adhesion complex formation./ Cell Sci. 1990;96: Carter WG, Wayner EA, Bouchard TS, Kaur P. The role of integrins a2/31 and a3/31 in cell-cell and cellsubstrate adhesion of human epidermal cells. / Cell Biol. 1990; 110: O'Keefe EJ, Woodley D, Castillo G, Russell N, Payne RE. Production of soluble and cell-associated Fibronectin by cultured keratinocytes. J Invest Dermatol. 1984;82: Ebato B, Friend J, Thoft RA. Comparison of central and peripheral human corneal epithelium in tissue culture. Invest Ophthalmol Vis Sci. 1987; 28: Jumblatt MM, Neufeld AH. /3-Adrenergic and serotonergic responsiveness of rabbit corneal epithelial cells in culture. Invest Ophthalmol Vis Sci. 1983; 24: Charonis AS, Skubitz APN, Koliakos GG, et al. A novel synthetic peptide from the Bl chain of laminin with heparin-binding and cell adhesion-promoting activities. J Cell Biol. 1988; 107: Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227: Cameron JD, Hagen ST, Waterfield RR, Furcht LT. Effects of matrix proteins on rabbit corneal epithelial cell adhesion and migration. Curr Eye Res. 1988; 7: Kiritoshi A, SundarRaj N, Thoft RA. Differentiation in cultured limbal epithelium as defined by keratin expression. Invest Ophthalmol Vis Sci. 1991; 32: Carter WG, Kaur P, Gil SG, Gahr PJ, Wayner EA. Distinct functions for integrins a3/31 in focal adhesions and «6j84 bullous pemphigoid antigen in a new stable anchoring contact (SAC) of keratinocytes: relation to hemidesmosomes.y Cell Biol. 1990; 111:

Differentiation in Cultured Limbal Epithelium as Defined by Keratin Expression

Differentiation in Cultured Limbal Epithelium as Defined by Keratin Expression Investigative Ophthalmology & Visual Science, Vol. 32, No. 12, November 1991 Copyright Association for Research in Vision and Ophthalmology Differentiation in Cultured Limbal Epithelium as Defined by Keratin

More information

A Tissue Culture Assay of Corneal Epithelial Wound Closure

A Tissue Culture Assay of Corneal Epithelial Wound Closure A Tissue Culture Assay of Corneal Epithelial Wound Closure Marcia M. Jumblarr and Arthur H. Neufeld Experimental assays have been developed using cultured tissue derived from rabbit corneal epithelium

More information

Lab Module 7: Cell Adhesion

Lab Module 7: Cell Adhesion Lab Module 7: Cell Adhesion Tissues are made of cells and materials secreted by cells that occupy the spaces between the individual cells. This material outside of cells is called the Extracellular Matrix

More information

Role of Fibronectin in the Healing of Superficial Keratectomies In Vitro

Role of Fibronectin in the Healing of Superficial Keratectomies In Vitro prr Investigative Ophthalmology & Visual Science, Vol. 30, No. 3, March 1989 Copyright Association for Research in Vision and Ophthalmology Role of Fibronectin in the Healing of Superficial Keratectomies

More information

Comparison of Central and Peripheral Human Corneal Epithelium in Tissue Culture

Comparison of Central and Peripheral Human Corneal Epithelium in Tissue Culture Comparison of Central and Peripheral Human Corneal Epithelium in Tissue Culture unshu Ebato, Judith Friend, and Richard A. Thofr Past attempts to grow human corneal epithelium in culture had limited success,

More information

Basement Membrane Synthesis by Human Corneal Epithelial Cells In Vitro

Basement Membrane Synthesis by Human Corneal Epithelial Cells In Vitro Basement Membrane Synthesis by Human Corneal Epithelial Cells In Vitro Masahito Ohji, Nirmala SundarRaj, John R. Hassell, and Richard A. Thoft Purpose. Collagen gels may prove to be potential carriers

More information

CytoSelect 48-Well Cell Adhesion Assay (Collagen IV-Coated, Fluorometric Format)

CytoSelect 48-Well Cell Adhesion Assay (Collagen IV-Coated, Fluorometric Format) Product Manual CytoSelect 48-Well Cell Adhesion Assay (Collagen IV-Coated, Fluorometric Format) Catalog Number CBA-061 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction

More information

Application Note. BD PureCoat ECM Mimetic Cultureware Collagen I Peptide: Novel Synthetic, Animal-free Surface for Culture of Human Keratinocytes

Application Note. BD PureCoat ECM Mimetic Cultureware Collagen I Peptide: Novel Synthetic, Animal-free Surface for Culture of Human Keratinocytes Page 1 BD PureCoat ECM Mimetic Cultureware Collagen I Peptide: Novel Synthetic, Animal-free Surface for Culture of Human Keratinocytes Kerry Thompson, Jeff Partridge, Elizabeth Abraham, Paula Flaherty,

More information

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.

More information

Application Note 493

Application Note 493 Corning PureCoat ECM Mimetic Cultureware Collagen I Peptide: Novel Synthetic, Animal-free Surface for Culture of Human Keratinocytes Kerry Thompson, Jeff Partridge, Elizabeth Abraham, Paula Flaherty, Susan

More information

CytoSelect 48-Well Cell Adhesion Assay (Laminin-Coated, Colorimetric Format)

CytoSelect 48-Well Cell Adhesion Assay (Laminin-Coated, Colorimetric Format) Product Manual CytoSelect 48-Well Cell Adhesion Assay (Laminin-Coated, Colorimetric Format) Catalog Number CBA-056 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cell

More information

CytoSelect 48-Well Cell Adhesion Assay (ECM Array, Fluorometric Format)

CytoSelect 48-Well Cell Adhesion Assay (ECM Array, Fluorometric Format) Product Manual CytoSelect 48-Well Cell Adhesion Assay (ECM Array, Fluorometric Format) Catalog Number CBA-071 CBA-071-5 48 assays 5 x 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures

More information

J. Cell Sci. Suppl. 8, (1987) Printed in Great Britain The Company of Biologists Limited 1987

J. Cell Sci. Suppl. 8, (1987) Printed in Great Britain The Company of Biologists Limited 1987 J. Cell Sci. Suppl. 8, 199-29 (1987) Printed in Great Britain The Company of Biologists Limited 1987 199 ACTIVATION OF KERATINOCYTE FIBRONECTIN RECEPTOR FUNCTION DURING CUTANEOUS WOUND HEALING F R E D

More information

Promotion of HDF Cell Attachment and Proliferation

Promotion of HDF Cell Attachment and Proliferation Promotion of HDF Cell Attachment and Proliferation Objectives To qualitatively assess the effect of fibronectin (Fn) on HDF cell attachment Fn Attachment Assay To observe HDF cell proliferation and position

More information

CytoSelect 48-Well Cell Adhesion Assay (Collagen IV-Coated, Fluorometric Format)

CytoSelect 48-Well Cell Adhesion Assay (Collagen IV-Coated, Fluorometric Format) Product Manual CytoSelect 48-Well Cell Adhesion Assay (Collagen IV-Coated, Fluorometric Format) Catalog Number CBA-061 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction

More information

CytoSelect 48- Well Cell Adhesion Assay (Laminin- Coated, Colorimetric Format)

CytoSelect 48- Well Cell Adhesion Assay (Laminin- Coated, Colorimetric Format) Product Manual CytoSelect 48- Well Cell Adhesion Assay (Laminin- Coated, Colorimetric Format) Catalog Number CBA- 056 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cell

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse

More information

Negatively charged microspheres provide an additional surface for cell attachment leading to proliferation, tissue regeneration and wound healing

Negatively charged microspheres provide an additional surface for cell attachment leading to proliferation, tissue regeneration and wound healing Negatively charged microspheres provide an additional surface for cell attachment leading to proliferation, tissue regeneration and wound healing Authors: Correa LG, Peter R, Clerici G, Ritter V. 2017

More information

CytoSelect 48-Well Cell Adhesion Assay (Collagen IV-Coated, Colorimetric Format)

CytoSelect 48-Well Cell Adhesion Assay (Collagen IV-Coated, Colorimetric Format) Product Manual CytoSelect 48-Well Cell Adhesion Assay (Collagen IV-Coated, Colorimetric Format) Catalog Number CBA-060 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction

More information

Tumor tissues or cells were homogenized and proteins were extracted using

Tumor tissues or cells were homogenized and proteins were extracted using SUPPLEMENTAL MATERIALS AND METHODS Western Blotting Tumor tissues or cells were homogenized and proteins were extracted using T-PER tissue protein extraction buffer. Protein concentrations were determined

More information

FIVEphoton Biochemicals

FIVEphoton Biochemicals sapp ELISA Kit (Soluble Amyloid Precursor Protein beta ELISA Kit) General Protocol FIVEphoton Biochemicals For research use only. Not for diagnostics. Part No. h,m,r,rb sapp -ELISA This protocol is provided

More information

Collagen Gel for Ocular Surface

Collagen Gel for Ocular Surface No. 6 Reports 901 Collagen Gel for Ocular Surface Harry S. Geggel,* Judith Friend, and Richard A. Thofr A replacement ocular surface requires a substrate that is easily manipulated surgically, does not

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods:

SUPPLEMENTAL MATERIAL. Supplemental Methods: SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells

More information

Integrins in the Wounded and Unwounded Stratified Squamous Epithelium of the Cornea

Integrins in the Wounded and Unwounded Stratified Squamous Epithelium of the Cornea Integrins in the Wounded and Unwounded Stratified Squamous Epithelium of the Cornea Mary Ann Stepp*-\ Sandra Spurr-Michaud* and Ilene K. Gipson*-f Purpose. The authors determined the synthesis, cell surface

More information

Integrins in the Wounded and Unwounded Stratified Squamous Epithelium of the Cornea

Integrins in the Wounded and Unwounded Stratified Squamous Epithelium of the Cornea Integrins in the Wounded and Unwounded Stratified Squamous Epithelium of the Cornea Mary Ann Stepp*-\ Sandra Spurr-Michaud* and Ilene K. Gipson*-f Purpose. The authors determined the synthesis, cell surface

More information

Integrins in the Wounded and Unwounded Stratified Squamous Epithelium of the Cornea

Integrins in the Wounded and Unwounded Stratified Squamous Epithelium of the Cornea Integrins in the Wounded and Unwounded Stratified Squamous Epithelium of the Cornea Mary Ann Stepp*-\ Sandra Spurr-Michaud* and Ilene K. Gipson*-f Purpose. The authors determined the synthesis, cell surface

More information

Arf6 Activation Assay Kit

Arf6 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product

More information

In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay. Josephine MY Ko and Maria Li Lung *

In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay. Josephine MY Ko and Maria Li Lung * In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay Josephine MY Ko and Maria Li Lung * Clinical Oncology Department, The Univerisity of Hong Kong, Hong Kong, Hong Kong SAR *For

More information

Instructions For Research Use Only. Not For Use In Diagnostic Procedures

Instructions For Research Use Only. Not For Use In Diagnostic Procedures Instructions For Research Use Only. Not For Use In Diagnostic Procedures 3D Culture Cell Harvesting Kit For harvesting and lysate preparation from 3D Culture for Western analysis Sufficient reagents for

More information

FIVEphoton Biochemicals

FIVEphoton Biochemicals Canine Amyloid-Beta A ELISA Protocol FIVEphoton Biochemicals For research use only. Not for diagnostics. Part No. cab1-40elisa FIVEphoton Biochemicals 4907 Morena Blvd, Ste 1403 San Diego, CA 92117 Tel:

More information

The Construction of Cell-Density Controlled Three- Dimensional Tissues by Coating Micrometer-Sized Collagen. Fiber Matrices on Single Cell Surfaces

The Construction of Cell-Density Controlled Three- Dimensional Tissues by Coating Micrometer-Sized Collagen. Fiber Matrices on Single Cell Surfaces Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Page S1 Electronic Supplementary Information (ESI) for RSC Advances The Construction of Cell-Density

More information

RheB Activation Assay Kit

RheB Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table

More information

The role of the ninth and tenth type III domains of human fibronectin in cell adhesion

The role of the ninth and tenth type III domains of human fibronectin in cell adhesion ELSEVIER FEBS Letters 340 (1994) 197-201 FEBS 13711 LETTERS The role of the ninth and tenth type III domains of human fibronectin in cell adhesion Helen J. Mardon*, Kate E. Grant Nuffield Department of

More information

Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids.

Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. The cells were harvested 72 h after transfection. FLAG-tagged deubiquitinases

More information

FIVEphoton Biochemicals

FIVEphoton Biochemicals Human Cyclophilin B (CYPB) ELISA Kit Protocol Protocol for other species is identical except for dilutions of species specific standard. Use the protocol shipped with the kit for your experiment. FIVEphoton

More information

APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual

APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual FOR RESEARCH USE ONLY NOT FOR USE IN CLINICAL DIAGNOSTIC PROCEDURES [ PROPERTIES ] 1th Edition

More information

Cell Migration, Chemotaxis and Invasion Assay Using Staining

Cell Migration, Chemotaxis and Invasion Assay Using Staining Cell Migration, Chemotaxis and Invasion Assay Using Staining Protocol Hillary Sherman and Mark Rothenberg Corning Life Sciences 836 North St. Bldg. 300, Suite 3401 Tewksbury, MA 01876 Introduction Cell

More information

CytoSelect 24- Well Cell Contraction Assay Kit (Floating Matrix Model)

CytoSelect 24- Well Cell Contraction Assay Kit (Floating Matrix Model) Product Manual CytoSelect 24- Well Cell Contraction Assay Kit (Floating Matrix Model) Catalog Number CBA- 5020 24 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Wound healing

More information

CELLCOAT Protein Coated Cell Culture Vessels

CELLCOAT Protein Coated Cell Culture Vessels CELLCOAT Protein Coated Cell Culture Vessels 1 Cell/ 2 HTS The Greiner BioOne CELLCOAT product line comprises cell culture vessels which are coated with proteins of the extracellular matrix (,, ) or synthetic

More information

Cdc42 Activation Assay Kit

Cdc42 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

Rab5 Activation Assay Kit

Rab5 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product

More information

DIRECTION BOOKLET HUMAN FIBRONECTIN ELISA KIT. Catalog Number J64057 (previously BT- 700)

DIRECTION BOOKLET HUMAN FIBRONECTIN ELISA KIT. Catalog Number J64057 (previously BT- 700) Instruction Manual Introduction: DIRECTION BOOKLET HUMAN FIBRONECTIN ELISA KIT Catalog Number J64057 (previously BT- 700) Fibronectin is a major cell surface glycoprotein important in cell-to-cell interactions,

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

Supplemental Information

Supplemental Information Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai

More information

Description of supplementary material file

Description of supplementary material file Description of supplementary material file In the supplementary results we show that the VHL-fibronectin interaction is indirect, mediated by fibronectin binding to COL4A2. This provides additional information

More information

Protein electrophoresis: Introduction to SDS-PAGE

Protein electrophoresis: Introduction to SDS-PAGE Protein electrophoresis: Introduction to SDS-PAGE Aim: -Separation of proteins in an electric field by electrophoresis. Purposes: -Estimation of molecular masses -Relative abundances of major proteins

More information

CytoSelect 24-Well Cell Haptotaxis Assay (8 µm, Collagen I-Coated, Fluorometric Format)

CytoSelect 24-Well Cell Haptotaxis Assay (8 µm, Collagen I-Coated, Fluorometric Format) Product Manual CytoSelect 24-Well Cell Haptotaxis Assay (8 µm, Collagen I-Coated, Fluorometric Format) Catalog Number CBA-101-COL 12 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction

More information

Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG02138

Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG02138 Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02138 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research

More information

Immunoprecipitation Protocol

Immunoprecipitation Protocol Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify

More information

FIVEphoton Biochemicals

FIVEphoton Biochemicals Presenilin 2 (PSEN2, PS-2) ELISA Kit General Protocol FIVEphoton Biochemicals For research use only. Not for diagnostics. Part No. PS2-ELISA FIVEphoton Biochemicals 4907 Morena Blvd, Suite 1403 San Diego,

More information

FlashPlate File #15. High Throughput Screening. J. Watson SmithKline Beecham Pharmaceuticals, UK.

FlashPlate File #15. High Throughput Screening. J. Watson SmithKline Beecham Pharmaceuticals, UK. Drug Discovery Research Clinical Screening High Throughput Screening FlashPlate File #15 Use of Novel FlashPlate Technology to Measure camp Accumulation in Chinese Hamster Ovary Cells Expressing Human

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

CytoSelect 24-Well Cell Migration Assay (5 µm, Fluorometric Format)

CytoSelect 24-Well Cell Migration Assay (5 µm, Fluorometric Format) Revised Protocol Product Manual CytoSelect 24-Well Cell Migration Assay (5 µm, Fluorometric Format) Catalog Number CBA-102 12 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction

More information

ab Ran Activation Assay Kit

ab Ran Activation Assay Kit ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last

More information

Cell Contraction Assay

Cell Contraction Assay Product Manual Cell Contraction Assay Catalog Number CBA-201 24 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Wound healing comprises of three processes: epithelialization,

More information

Storage on Arrival. Aliquot and store at -20 C for up to 6 months. Store at -20 C. Aliquot and store at -80 C for up to 6 months

Storage on Arrival. Aliquot and store at -20 C for up to 6 months. Store at -20 C. Aliquot and store at -80 C for up to 6 months Human Lung Epithelial Stem Cells Catalog No. ax3005 ax3580 ax0047 ax0047x Product Name Lung Epithelial Stem Cells Lung Epithelial Stem Cell Culture Medium SureGrowth Recombinant Human FGF2 SureGrowthX

More information

Radius 24-Well Cell Migration Assay (Fibronectin Coated)

Radius 24-Well Cell Migration Assay (Fibronectin Coated) Product Manual Radius 24-Well Cell Migration Assay (Fibronectin Coated) Catalog Number CBA-125-FN 24 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cell migration is a highly

More information

Radius 24-Well Cell Migration Assay (Laminin Coated)

Radius 24-Well Cell Migration Assay (Laminin Coated) Product Manual Radius 24-Well Cell Migration Assay (Laminin Coated) Catalog Number CBA-125-LN 24 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cell migration is a highly

More information

Gα i Activation Assay Kit

Gα i Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product

More information

Monoclonal antibody to fibronectin which inhibits. Extracellular matrix assembly

Monoclonal antibody to fibronectin which inhibits. Extracellular matrix assembly Volume 217, number 1, 124-128 FEB 04787 June 1987 Monoclonal antibody to fibronectin which inhibits extracellular matrix assembly M.A. Chernousov, A.I. Faerman, M.G. Frid, O.Yu. Printseva and V.E. Koteliansky

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs

More information

Phos-tag beads as an immunoblotting enhancer for selective detection of phosphoproteins in cell lysates

Phos-tag beads as an immunoblotting enhancer for selective detection of phosphoproteins in cell lysates Notes & Tips Phos-tag beads as an immunoblotting enhancer for selective detection of phosphoproteins in cell lysates Emiko Kinoshita-Kikuta, Eiji Kinoshita *, and Tohru Koike Department of Functional Molecular

More information

ab BrdU Immunohistochemistry Kit

ab BrdU Immunohistochemistry Kit ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product

More information

Frequently Asked Questions (FAQ)

Frequently Asked Questions (FAQ) Frequently Asked Questions (FAQ) Matrigen Softwell Hydrogels Version 1.0 Contents General Questions... 3 Cell Culture and Experimental Questions... 6 Quality Control Technical Questions... 8 SoftTrac Products...

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 100 L,

More information

Protocol(Research use only)

Protocol(Research use only) Immunohistochemistry (without pretreatment) p2 Immunohistochemistry (Microwave pretreatment) p3 Immunohistochemistry (Autoclave pretreatment) p4 Immunohistochemistry (Trypsin pretreatment) p5 Immunohistochemistry

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

LAMININ. For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7

LAMININ. For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7 LAMININ For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7 TABLE OF CONTENTS BACKGROUND AND PRINCIPLE... 4 REAGENTS AND EQUIPMENT PROVIDED...

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

Acetyl-p53 (K381) Cell-Based Colorimetric ELISA Kit

Acetyl-p53 (K381) Cell-Based Colorimetric ELISA Kit Acetyl-p53 (K381) Cell-Based Colorimetric ELISA Kit Catalog No. KA8015C Detection and Quantification of Acetyl-p53 (K381) Protein Concentration in Cell. Research Purposes Only. Not Intended for Diagnostic

More information

VEGFR2 (Phospho-Tyr1175)

VEGFR2 (Phospho-Tyr1175) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 VEGFR2 (Phospho-Tyr1175) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02081 Please read the provided manual

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

A Peptide From Fibronectin Cell-Binding Domain Inhibits Attachment of Epithelial Cells

A Peptide From Fibronectin Cell-Binding Domain Inhibits Attachment of Epithelial Cells Investigative Ophthalmology & Visual Science, Vol. 29, No. 12, December 1988 Copyright Association for Research in Vision and Ophthalmology A Peptide From Fibronectin Cell-Binding Domain Inhibits Attachment

More information

Matrices sourcebook. Your guide to Gibco extracellular matrices products

Matrices sourcebook. Your guide to Gibco extracellular matrices products Matrices sourcebook Your guide to Gibco extracellular matrices products Introduction Gibco products, including extracellular matrices, 3D scaffolds, and attachment proteins, are essential tools for providing

More information

Type IV Collagen and Corneal Epithelial Adhesion and Migration

Type IV Collagen and Corneal Epithelial Adhesion and Migration Investigative Ophthalmology & Visual Science, Vol. 32, No. 10, September 1991 Copyright Association for Research in Vision and Ophthalmology Type IV Collagen and Corneal Epithelial Adhesion and Migration

More information

PKA α/β CAT (Phospho-Thr197)

PKA α/β CAT (Phospho-Thr197) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 PKA α/β CAT (Phospho-Thr197) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG01634 Please read the provided manual

More information

Gα 13 Activation Assay Kit

Gα 13 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product

More information

FIVEphoton Biochemicals

FIVEphoton Biochemicals Human E3/Ubiquitin-protein ligase (E3/UBPL) ELISA Kit Biotin Detection Antibody Format 96T. FIVEphoton Biochemicals For research use only. Not for diagnostics. Part No. he3ubpl-elisa 4907 Morena Blvd,

More information

Epithelial Cells cells lining the trachea Epithelium layer of epithelial cells in the tissue Many epithelial cell types exist on apical surface

Epithelial Cells cells lining the trachea Epithelium layer of epithelial cells in the tissue Many epithelial cell types exist on apical surface Matthew Pilewski Epithelial Cells cells lining the trachea Epithelium layer of epithelial cells in the tissue Many epithelial cell types exist on apical surface Epithelium form tight junctions that keep

More information

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS A PREPARATIVE METHOD FOR OBTAINING ENUCLEATED MAMMALIAN CELLS Michael H. Wigler and I. Bernard Weinstein Institute of Cancer Research and Departments of Medicine and Microbiology, College of Physicians

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

ONE-HOUR Western TM Multiplex Kit II

ONE-HOUR Western TM Multiplex Kit II ONE-HOUR Western TM Multiplex Kit II Technical Manual No. 0256 Version 06192009 I Description... 1 II Kit Contents.. 2 III Related Products 2 IV Key Features. 2 V Storage... 2 VI ONE-HOUR Multiplex Western

More information

Western blotting technique: principle, procedure and application

Western blotting technique: principle, procedure and application Western blotting technique: principle, procedure and application The term blotting refers to the transfer of biological samples from a gel to a membrane and their subsequent detection on the surface of

More information

Kit Components (Included) Cat # # of vials Product Name Quantity Storage Human Renal Cortical Epithelial Cells (HRCEpiC)

Kit Components (Included) Cat # # of vials Product Name Quantity Storage Human Renal Cortical Epithelial Cells (HRCEpiC) 3D Renal Tubule Formation Kit 3D-RTF Cat # 3D-4110 Product Description The human kidney is frequently exposed to drugs and toxic compounds, which can result in nephrotoxicity. A drug s uptake and clearance

More information

Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo *

Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * INSERM U1009, Gustave Roussy, Villejuif, France *For correspondence: isabelle.plo@gustaveroussy.fr [Abstract]

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

Supplemental Methods:

Supplemental Methods: Supplemental Methods: Cell Culture 84A human mammary epithelial cells (HMEC s) were a kind gift from Martha Stampfer (Lawrence Berkeley Laboratory, Berkeley CA). Cells were maintained in DFCI- medium supplemented

More information

BD BioCoat Growth Factor Reduced. MATRIGEL Invasion Chamber. Catalog No Lot No Guidelines for Use FOR RESEARCH USE ONLY

BD BioCoat Growth Factor Reduced. MATRIGEL Invasion Chamber. Catalog No Lot No Guidelines for Use FOR RESEARCH USE ONLY BD BioCoat Growth Factor Reduced MATRIGEL Invasion Chamber Catalog No. 354483 Lot No. 47169 Guidelines for Use FOR RESEARCH USE ONLY NOT FOR USE IN DIAGNOSTIC PROCEDURES 1996 Becton Dickinson and Company

More information

3T3-L1 Differentiation Protocol

3T3-L1 Differentiation Protocol 3T3-L1 Differentiation Protocol Written by Eisuke Kato on 2013/10/09 MATERIALS Dulbecco's Modified Eagles Medium (D-MEM) (High Glucose) with L-Glutamine and Phenol Red High glucose (Wako Chem 044-29765,

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

Product Datasheet. LMO2 Antibody NB Unit Size: 0.1 ml

Product Datasheet. LMO2 Antibody NB Unit Size: 0.1 ml Product Datasheet LMO2 Antibody NB110-83978 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Protocols, Publications, Related Products, Reviews,

More information

Comparative cell growth study using CELLSTAR AutoFlask

Comparative cell growth study using CELLSTAR AutoFlask Comparative cell growth study using CELLSTAR AutoFlask Introduction With the increasing amount of cell culture work performed in today s life sciences laboratories, the need for automation is evident.

More information

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358 CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

ReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit

ReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit ReliaBLOT TM Introduction: IP/Western Blot Reagents Cat. No. WB120, rabbit ReliaBLOT TM IP/Western Blot Reagents and Procedures (patent pending) provide an improved method for the detection of immunoprecipitated

More information

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

More information

LAMININ-5 DEGRADATION DUE TO MUSTARD IN CULTURED NORMAL HUMAN EPIDERMAL KERATINOCYTES (NHEK)

LAMININ-5 DEGRADATION DUE TO MUSTARD IN CULTURED NORMAL HUMAN EPIDERMAL KERATINOCYTES (NHEK) LAMININ-5 DEGRADATION DUE TO MUSTARD IN CULTURED NORMAL HUMAN EPIDERMAL KERATINOCYTES (NHEK) Prabhati Ray, Xiannu Jin, Yan Leng, and Zhuangwu Li Department of Biology, Division of Experimental Therapeutics,

More information

SYNTHESIS AND BEATING IN CULTURED RAT HEART CELLS

SYNTHESIS AND BEATING IN CULTURED RAT HEART CELLS Published Online: 1 March, 1969 Supp Info: http://doi.org/10.1083/jcb.40.3.850 Downloaded from jcb.rupress.org on October 10, 2018 Cultured rat heart cells grown as monolayers in tissue culture will beat

More information