Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates

Similar documents
SUPPLEMENTAL FIGURES AND TABLES

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)

supplementary information

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

SUPPLEMENTARY INFORMATION

Supplementary Materials for

This is the author's accepted version of the manuscript.

SUPPLEMENTARY INFORMATION

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

Nature Medicine: doi: /nm.4169

Supplementary Information

Supplementary Figure 1. Nur77 and leptin-controlled obesity. (A) (B) (C)

Supplementary Figures and supplementary figure legends

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.

Supplementary Materials for

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Wnt16 smact merge VK/AB

Supplementary Information

Supplementary information Activation of AMP-activated protein kinase

Nature Structural & Molecular Biology: doi: /nsmb.1583

SUPPLEMENTARY INFORMATION

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95

b alternative classical none

Supplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:

SUPPLEMENTARY INFORMATION

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

HCT116 SW48 Nutlin: p53

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Supplementary Materials for

Online Supplementary Information

a KYSE270-CON KYSE270-Id1

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines

SANTA CRUZ BIOTECHNOLOGY, INC.

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Supplementary Figure 1.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

supplementary information

Supplementary Figure 1. Adipogenic protein expression in WT and KO MEFs after 7 days of adipogenic differentiation.

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

WT Day 90 after injections

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Figures

14_integrins_EGFR

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Pei et al. Supplementary Figure S1

Xu et al., Supplementary Figures 1-7

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

TRIM31 is recruited to mitochondria after infection with SeV.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

J. Cell Sci. 128: doi: /jcs : Supplementary Material. Supplemental Figures. Journal of Cell Science Supplementary Material

Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplemental Figure Legends:

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17

Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected

SUPPLEMENTARY INFORMATION

HEK293T. Fig. 1 in the

Supplementary Methods

Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1

Regulation of axonal and dendritic growth by the extracellular calcium-sensing

GFP CCD2 GFP IP:GFP

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.

Supporting Information

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides


Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Supplementary figures

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression

Supplementary Figure 1

immunofluorescence. Name of antibodies Manufacturer Catalog Number Rabbit anti-pdyn Rabbit anti-kor-1

Transcription:

Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100 μm. (b) Quantification results (n=6~8 from 2~3 sets). (c) Either TSA or apicidin (50 nm) did not affect RVSMC survival, as determined with MTT assay. Pi (2 mm) was treated for 6 days

(n=5 from 1 set). (d) TSA (0.6 mg kg -1, i.p. for 9 days) did not affect serum calcium levels in the presence or absence of VC. VC was induced by VD 3, (5x10 5 IU kg -1 day, s.c. for initial 3 days) in 6~7-week-old C57BL/6 male mice (n=8~10 from 2 sets). (e) HDAC1 sirna successfully reduced the protein amount of HDAC1 in A10 cells, a rat vascular smooth muscle cell line. (f) Western blot analysis to show the successful Ad-HDAC1 infection. (g) Efficiency of knock-down of HDAC2 by HDAC2 sirna. (h) Generation of vascular smooth muscle-specific HDAC1 deletion. Aorta samples were used for the detection of HDAC1 in either HDAC1 fl/fl mice (WT) or SM22 -cre;hdac1 fl/fl mice (HDAC1-cKO). (i) Vascular smooth muscle-specific disruption of HDAC1 did not affect the serum calcium level. VD 3 (5x10 5 IU kg -1 day, s.c. for initial 3 days) was administered to 6~8-week-old HDAC1-cKO male mice (n=9~13 from 3 sets). * p<0.05, ** p<0.01, NS: not significant. Numerals in bar graphs are the numbers of samples.

Supplementary Figure 2. Diverse calcification stresses reduce HDAC1 protein amounts, but not mrna amounts in vitro. (a) Quantification of the Pi-induced reduction of HDAC1 protein amounts (n=10 from 6 sets). (b) Quantification result for HDAC2. Note that reduction of HDAC1 was greater than that of HDAC2 (n=10 from 6 sets). (c) Time course of HDAC1 protein reduction by Pi treatment in RVSMCs. (d) Pi-induced calcium deposition in human coronary artery smooth muscle cells (HCASMCs). Pi was treated for 6 days (n=4 from 2 sets). (e) Pi reduced the protein amount of

HDAC1 in HCASMCs. (f) Time course of osteogenic media (OM)-induced VC (n=9~12 from 2 sets). (g) OM also induced the reduction of HDAC1 protein amounts. (h) Reduction of HDAC1 protein amounts was reproduced by diverse calcification stresses such as CaCl 2 (8 mm), OM, and Pi (2 mm), but not by -glycerophosphate ( -GP, 10 mm). (i) Phosphonoformic acid (PFA, 100 ), an inhibitor of Pi transporter, blocked Pi-induced calcium deposition. Both PFA and Pi were treated for 6 days. (j) Effects of phosphonoformic acid (PFA, 100 ), an inhibitor of Pi transporter on Pi-induced HDAC1 protein reduction. (k) Changes in HDAC2-9 mrna levels by Pi in RVSMCs. Each sample was measured in duplicate (n=3 from 2 sets). * p<0.05, ** p<0.01

Supplementary Figure 3. Diverse calcification stresses reduce HDAC1 protein amounts, but not mrna amounts in vivo models. Scale bar, 25 μm. (a) Immunohistochemical analysis showed that VD 3 -administration induced reduction of HDAC1 at calcifying focus in blood vessels. (b) Quantification result of (a) (8~9 fields from 3 mouse-histology samples). (c) VD 3 -administration did not affect mrna levels of HDAC1 (n=12 from 3 sets). (d) HDAC2 mrna level was not altered by VD 3 -administration in mice (n=11 from 3 sets). (e) Quantification result of immunohistochemical analysis of HDAC1 expression in the aorta obtained from ApoE knockout mice with carotid artery ligation model (Fig. 3g, 5 fields from 2 mouse-histology samples). (f) Quantification result of immunohistochemical analysis of HDAC1 expression in the human intimal calcification model (Fig.

3h, 4~12 fields from 2~4 human-histology samples). (g) HDAC1 mrna level was not significantly altered in calcified human coronary artery samples (n=2~4, measured in duplicate). * p<0.05, ** p<0.01, NS: not significant.

Supplementary Figure 4. HDAC1 K74 is ubiquitinated in VC. (a) HDAC1 degradation is proteasome-dependent. MG132 and alternative proteasome inhibitors such as lactacystin, epoxomicin, or N-[N-(N-Acetyl-L-leucyl)-L-leucyl]-L-norleucine (ALLN) successfully restored the Pi-induced reduction of HDAC1 protein amount in RVSMCs. MG132 (10 ), lactacystin (10 ), epoxomicin (1 ), and ALLN (5 ) were treated 8 hours before harvest. (b) Administration of MG132 to mice prevented the reduction of HDAC1 protein amount in the aorta. MG132 (2.5 mg kg -1 day, i.p.) was administered for 9 days, whereas VD 3 was treated for the first 3 days (n=20~24 from 4 sets). (c) MG132 did not affect serum calcium levels in the presence or absence of VC. (d) Sequence homology of HDAC1 in the various species. Note that all amino acids spanning two ubiquitination candidate

sites of K74 and K89 of HDAC1 are well-conserved. (e) Exogenous HDAC1 was also degraded by Pi. In A10 cells, mammalian expression vector of either pbj5.1-flag-hdac1wild type (WT, 1 g) or pbj5.1-flag-hdac1 K74R (1 g) was transfected with Lipofectamin LTX and Pi (2 mm) was treated for 3 days. Then, the anti-flag antibody was used for Western blot analysis. Note that wild-type HDAC1 protein amount was reduced by Pi, whereas ubiquitination-resistant K74R mutant was not. (f) Structure of synthetic peptide spanning K74 (K74 decoy peptide). Fifteen amino acids (black) spanning K74 (red) were linked with the nuclear localization signal (bright blue color) and conjugated with FITC. (g) Successful delivery of K74 decoy peptide either to RVSMCs. K74 peptide was treated for 1 day at the concentration of 100 nm in RVSMCs. Scale bar, 100 μm.

Supplementary Figure 5. cdna microarray analysis to find E3 ligase. (a) cdna microarray analysis to find the E3 ligase induced by Pi. Hierarchical clustering in the microarray analysis showed that the expression of 893 genes was changed in Pi-treated RVSMCs. (b) A Venn diagram was used to represent groupings of genes that showed expression level changes; the molecular function categories included binding, catalytic activity, and signal transducer activity. (c) Dysregulated genes that are expected to have E3 ligase function.

Supplementary Figure 6. MDM2 physically interacts with HDAC1 and potentiates calcium deposition. (a) Pi-treatment for 3 or 6 days increased MDM2 protein expression in RVSMC. (b) Changes in the protein amount of the other four E3 ligases that were significantly upregulated in

quantitative RT-PCR analysis (Fig. 5a) were further confirmed by Western blot analysis. Note that none of the other E3 ligases was significantly altered by Pi-treatment (n=5~7 from 3 sets). (c) Immunoprecipitation shows the physical interaction between exogenous HDAC1 and exogenous MDM2. Transfected MDM2 (anti-ha antibody) successfully recruited HDAC1 (Flag) in 293T cells. (d) Reverse immunoprecipitation to show that transfected HDAC1 pulled down MDM2 in 293T cells. (e) Transient transfection of HA-MDM2 potentiated Pi-induced VC (n=6 from 2 sets). (f) MDM2- induced HDAC1 ubiquitination was attenuated in HDAC1 K74R, but not K89.

Supplementary Figure 7. p53 is not involved in Pi-induced VC. (a) MDM2 sirna (25 nm) successfully reduced the protein amounts of endogenous MDM2 in A10 cells. (b) Administration of VD 3 significantly reduced the protein amount of p53, an alternative target of MDM2, in aorta. (c) Pi also reduced p53 in RVSMCs. However, this reduction was not blunted by treatment with MDM2 sirna (n=4~18 from 2~5 experimental sets). (d) p53 sirna (50 nm) successfully reduced the protein

amounts of endogenous p53 in A10 cells. (e) p53 sirna failed to potentiate Pi-induced VC (n=12 from 3 experimental sets). (f) One micromolar pifithrin-α, a p53 inhibitor, failed to induce VC in RVSMCs (n=4 from 2 sets).

Supplementary Figure 8. Quantification of immunohistochemical analysis. (a) Immunohistochemical analysis showed the increase in MDM2 expression in VD 3 -administered mice. Scale bar, 40 μm. (b) Quantification results of (a). Eight to 12 fields from 4 mouse-histology samples were examined. (c) MDM2 expression in the atherosclerosis-associated calcification model. ApoE KO mouse aorta was subjected to carotid artery ligation (ApoE+ligation). Scale bar, 40 μm. (d) Quantification results of (c). Four to 5 fields from 2 mouse-histology samples were measured. (e)

Quantification results obtained from the immunohistochemical analysis of MDM2 in human coronary intimal calcification samples (Fig. 7c). Four fields from 2 mouse-histology samples were measured.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.

Supplementary Figure 9. Uncropped blots.