CDK5 is essential for TGF-β1-induced epithelial-mesenchymal transition and breast cancer progression

Similar documents
Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Journal of Cell Science Supplementary Material

Li et al., Supplemental Figures

Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

SUPPLEMENTARY INFORMATION

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Supplementary Information

supplementary information

Supplementary Table-1: List of genes that were identically matched between the ST2 and

Supplemental Materials and Methods

cells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in

Online Supplementary Information

Supplementary Figure 1. Isolation of GFPHigh cells.

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

0.9 5 H M L E R -C tr l in T w is t1 C M

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

Figure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly

Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE1 through. Akt/ROCK1 to stimulate cell motility.

Isolation, culture, and transfection of primary mammary epithelial organoids

Supplemental Information. A Mesenchymal-to-Epithelial Transition. Initiates and Is Required for the Nuclear. Reprogramming of Mouse Fibroblasts

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Resveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy

supplementary information

Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway

a KYSE270-CON KYSE270-Id1

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

USP19 modulates autophagy and antiviral immune responses by. deubiquitinating Beclin-1

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Methods Plasmid constructs

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary data 1. Prmers and probes used in Taqman real-time PCR.

SUPPLEMENTARY INFORMATION

Sarker et al. Supplementary Material. Subcellular Fractionation

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Table S1. Alteration of ZNF322A and FBXW7 protein expression levels in relation to clinicopathological parameters in 135 lung cancer patients.

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Materials for

Quick Cell Proliferation Testing Solution

Chemically defined conditions for human ipsc derivation and culture

Supplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition. through modulation of the mir-130b-zeb1 axis

Supplementary Information. ATM and MET kinases are synthetic lethal with. non-genotoxic activation of p53

SUPPLEMENTARY MATERIAL. JNK activity supports multiple phases of 3D-mammary epithelial acinus formation

Supporting Information for

Supplementary Materials for

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

RRM2B inhibits cell migration and spreading by Egr-1-mediated PTEN/Akt1

Supplementary information.

supplementary information

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3

3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]

Supplementary Materials

Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.

Supporting Information

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al.,

Supplemental Methods Cell lines and culture

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Supplementary Materials for

Flag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)

Synthesis of the pyridinyl analogues of dibenzylideneacetone. (pyr-dba) via an improved Claisen-Schmidt condensation,

Xu et al., Supplementary Figures 1-7

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.

SUPPLEMENTARY INFORMATION

Hossain_Supplemental Figure 1

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Figure 1. Expression pattern of Irs4 in MMTV-induced tumours, murine

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

HCT116 SW48 Nutlin: p53

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera

Combinatorial microenvironmental regulation of liver progenitor differentiation by Notch ligands, TGFβ, and extracellular matrix

TE5 KYSE510 TE7 KYSE70 KYSE140

of Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.

MTT-Cell Based Proliferation/Toxicity Assay

Hypoxia-induced carbonic anhydrase IX facilitates lactate flux in human breast cancer cells by non-catalytic function

SUPPLEMENTARY INFORMATION

Long Noncoding RNA LOC Suppresses Apoptosis by. Targeting mir p and mir-4767 in Vascular Endothelial Cells

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

MiR-150 promotes cellular metastasis in non-small cell lung cancer by targeting

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

supplementary information

Supplementary Figure 4A: Scheme of the lentiviral vectors, as integrated proviruses, that have

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg

Developmental Reprogramming in Mesenchymal Stromal Cells of Human Subjects with Idiopathic Pulmonary Fibrosis

Expression of the FGFR2 mesenchymal splicing variant in epithelial cells drives epithelial-mesenchymal transition

Supplemental Information. for. epithelial cells to induce tumor formation

Actin cap associated focal adhesions and their distinct role in cellular mechanosensing

Transcription:

Supplementary information for: CDK5 is essential for TGF-β1-induced epithelial-mesenchymal transition and breast cancer progression Qian Liang, Lili Li, Jianchao Zhang, Yang Lei, Liping Wang, Dong-Xu Liu, Jingxin Feng, Pingfu Hou, Ruosi Yao, Yu Zhang, Baiqu Huang and Jun Lu * 1

Supplementary Materials and Methods Plasmids and virus infection The pbi-gfp-cdk5dn (dominant-negative CDK5 with a D144N kinase-dead mutant) expression plasmid was kindly provided by Dr. Barry D. Nelkin (Department of Oncology, Johns Hopkins University School of Medicine, Baltimore, USA). The CDK5dn constructs were subcloned into a lentiviral expression vector pwpxld (Addgene) by the PCR using the same primers as CDK5. The human p35 expression construct was cloned into the vector pwpxld by PCR using the following primers (forward primer 5'-AGCTTTGTTTAAACATGGGCACGGTGCTGTCC-3' and reverse primer 5'-CCGGAATTCTCACCGATCCAGGCCTAG-3') from MDA-MB-231 cdna. The human Twist and Snail expression construct were cloned into the vector pwpxld by PCR using the following primers (Twist, forward primer 5'-CGACGCGTTTAGTGACCGTCAGAATT-3' and reverse primer 5'-GGGTCATATGGATGCCACCCGG-3'; Snail, forward primer 5'-CGCGGATCCATGCCGCGCTCTTTCCTCGT-3' and reverse primer 5'-CCGGAATTCTCAGCGGGGACATCCTGAGC-3') from pcdna4-twist and pcdna3-snail expression plasmids respectively. The pcdna4-twist expression plasmid was kindly provided by Dr. Carlotta Glackin (Department of Neurosciences at Beckman Research Institute of City of Hope, Duarte, California, USA) and the pcdna3-snail expression plasmid was kindly provided by Dr. K-J Wu (Institute of Biochemistry and Molecular Biology, 2

National Yang-Ming University, Taipei, Taiwan). The protocol of virus package and infection of the pwpxld transfer vectors were the same as the pdsl-hpugip transfer vectors. Trans-well assay under the condition of CDK5 inhibitor treatment MDA-MB-231 and BT549 cells were treated with 10μM Rv for 24h. The following experimental procedures were the same as described in the main body of the text. MCF10A cells were infected with overexpression or control viruses. Seventy-two hours after infection, the stably transfected cells were added TGF-β1 and induced for forty-eight hours. The induced and non-induced cells were starved for 24h, and 5 10 4 cells in DMEM/F12 (with insulin, hydrocortisone and cholera toxin) media were plated into the upper chamber, and MCF10A complete medium was placed in the lower chamber. The chambers were coated with fibronectin. For migration assay, cells were stained with crystal violet after incubation for 24h. For invasion assay, the upper chambers were coated with Matrigel and stained after 60h. Randomly selected fields were photographed (Nikon ECLIPSE 80i) and stained cells were statistic analyzed. Cell proliferation assay Cell growth rates were assessed by the MTT assay. The control and transfected cells (MDA-MB-231, 2.5 10 3 ; BT549, 1 10 3 ) were seeded in 96-well plates. Rv was added after cells completed adhesion. After incubation for indicated time, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium 3

bromide solution was added to each well and incubated at 37 C for 4h before removal of the culture medium. DMSO was then added and the cultures were shaken for 30 min at room temperature. Cell viability was determined by measuring the absorbance at 490 nm. The results were plotted as mean±sd of three separate experiments with ten determinations per experiment for each experimental condition. Supplementary Figures 4

Figure S1. Upregulation of CDK5 and p35 and increase of CDK5 kinase activity during TGF-β1-induced EMT. (a) and (b) morphologic change of HMLE (a) and MDCK (b) cells cultured without or with TGF-β1 (5ng/ml, 48h), Scale bar=100μm. (c) and (d) immunoblotting analysis of the expression of CDK5 and the epithelial marker E-cadherin and the mesenchymal markers 5

N-cadherin and α-sma. (e) immunoblotting analysis of the levels of FAK, p-fak Y397 and p-fak S732 under the conditions of different combination of DMSO, TGF-β1 and TGF-β1 inhibitor LY364947 in MCF10A cells. 6

Figure S2. Knockdown of CDK5 inhibited TGF-β1-induced EMT. Immunoblotting analysis of expression of the epithelial marker Occludin and the mesenchymal markers Fibronectin and Vimentin in MCF10A cultured without or with TGF-β1 after infection of shcdk5-1# or empty vector. 7

Figure S3. Inhibition of CDK5 kinase activity inhibited breast cancer cell 8

motility and tumorigenesis. (a) and (b) migration (24h; a) and invasion (48h; b) assays in MDA-MB-231 and BT549 cells after treatment with Rv or DMSO (control). The mean was derived from cell counts of 5 fields, and each experiment was repeated 3 times (***, P<0.001, compared with the control). Representative images of migrated and invaded cells are shown. (c) immunoblotting analysis of expression of the mesenchymal marker α-sma in MDA-MB-231 and BT549 cells after treatment with Rv or DMSO. (d) and (e) proliferation of MDA-MB-231 cells (d) and BT549 cells (e) expressing control or shcdk5-1# vector were measured using MTT assays. (f) and (g) proliferation of MDA-MB-231 cells (f) and BT549 cells (g) cultured with Rv or DMSO and blank controls were measured using MTT assays. 9

Figure S4. The kinase activity of CDK5 was essential for its function via phosphorylation of FAK at Ser-732 and affected F-actin remodeling. (a) immunoblotting analysis of expression of CDK5, FAK, p-fak Y397 and p-fak S732 in MDA-MB-231 (left) and BT549 (right) cells after treatment with Rv or DMSO. (b) immunoblotting analysis of expression of CDK5, FAK and p-fak S732 in MDA-MB-231 (left) and BT549 (right) cells after infection of CDK5, CDK5dn or empty vector. (c) and (d) immunofluorescence staining for F-actin by phalloidine in MDA-MB-231 (c) and BT549 (d) cells after infection of CDK5, CDK5dn or empty vector. Scale bar=50μm. Arrows indicate the F-actin bundles. 10

Figure S5. Knockdown of CDK5 inhibited Twist- and Snail-induced EMT. (a) morphologic change of MCF10A cells overexpressing Twist or Snail, Scale bar=100μm. (b) immunoblotting analysis of the expression of CDK5 and the epithelial marker E-cadherin and the mesenchymal markers N-cadherin and α-sma in MCF10A overexpressing Twist (Left) or Snail (Right). (c) 11

immunoblotting analysis of expression of the epithelial marker E-cadherin and the mesenchymal markers N-cadherin and α-sma in MCF10A overexpressing Twist (Left) or Snail (Right) after infection of shcdk5-1# or empty vector. (d) immunofluorescence staining for the epithelial marker E-cadherin and mesenchymal marker N-cadherin in MCF10A overexpressing Twist (Left) or Snail (Right) after infection of shcdk5-1# or empty vector. Scale bar=50μm. 12