U937 macrophages Human monocytic cell line ATCC CRL Plasmids Legionella vector for expression of mcherry from a ptac promoter, X.

Transcription

1 "#$%&'("#$%&'()&(*+,&)-'*).)/*'($0'))$.*1 2(,1%/,/3&($4/(5$1+'6&,'(75%-&$'5('))058(9 Strain or plasmid Relevant properties Reference E. coli XL1-Blue reca1 enda1 gyra96 thi-1 hsdr17 supe44 rela1 lac [F proab Stratagene laciqzm15 Tn10 (Tetr)] DH5alpha F 80lacZ"M15 "(laczya-argf) U169 reca1 enda1 hsdr17 (rk, Invitrogen mk+) phoa supe44 # thi-1 gyra96 rela1 MG1655 F-, lambda-, rph-1 ATCC L. pneumophila Lens L. pneumophila serogroup 1 isolate, strain Lens (CIP ) Cazalet et al., 2004 Lens dota Lens lpl2613::kan Ferhat et al., 2009 Lens lssbd Lens lpl1509lpl1510::kan This study Paris L. pneumophila serogroup 1 isolate, strain Paris Cazalet et al., 2004 Paris lssbd Paris lpp1473lpp1474::kan This study Paris tolc Paris lpp0754::kan This study Eucaryotic cells A. castellanii Environmental isolate P. Pernin (Faculty of Pharmacy, Lyon, France) D. discoideum Dd04 [act15]:cnxa:gfp (Dicty Stock Center n DBS ) Müller-Taubenberger et al., 2001 THP1 macrophages Human monocytic cell line, gift from Mathias Faure, CIRI Inserm Tsuchiya et al., 1980 U1111, Lyon, France U937 macrophages Human monocytic cell line ATCC CRL Plasmids pxdc50 Legionella vector for expression of mcherry from a ptac promoter, X. Charpentier laciq, CmR plssbd Expression of mcherry and lssbd genes from a ptac promoter, laciq, CmR pxdc61 Legionella vector for expression of hybrid proteins from fusion with ß- X. Charpentier lactamase coding sequence blam, laciq, CmR pblam-rtxa162 Coding sequence of the last 162 aminoacids of RtxA fused to blam This study coding sequence pblam-rtxa731 Coding sequence of the last 731 aminoacids of RtxA fused to blam This study coding sequence pblam-fabi Fusion between enoyl-actyl carrier protein reductase FabI and BlaM de Felipe et al., 2008 (used as non secreted control) pmcherry mcherry coding sequence inserted in NdeI/KpnI, to replace blam in plasmid pxdc61 This study pmcherry-rtxa162 Same as pblam-rtxa162 with blam replaced by mcherry (NdeI/KpnI) This study pmcherry-rtxa731 Same as pblam-rtxa731with blam replaced by mcherry (NdeI/KpnI) This study pacyc184kan Plasmid pacyc184 with kanamycine cassette constitutive promoter This study pkan inserted(pk) plssbd h Genes lssbd (L. pneumophila Paris) cloned in pacyc184kan under the control of the pkan promoter This study ptolc h Gene tolc (L. pneumophila Paris) cloned in pacyc184kan under the This study control of the pkan promoter plssbd-tolc h Genes lssbd and tolc (L. pneumophila Paris) cloned in pacyc184kan under the control of the pkan promoter This study

2 "#$%&')":%'-/%).)/*'($0'))$.*1 :%'-/%):;&(*:<8/%/.)/*$5&-+,'71$0/.+)$%/&-7,&(='(4%/4'5(57$0/$&%4/$/* A/)$%'6$'5()'$/)8/%/&**/*80/(&++%5+%'&$/&(*&%/'(*'6&$/*'(B5,*9 C&-/ #/D./(6/EFGH?GI J/)6%'+$'5( P1-lssBD-Lens CGGGATCCATAAGCAGATCCCCGAAGGG lssbd deletion in Lens strain P2-lssBD-Lens CTTGCGGCAGCGTGATGTCTTCGCGGAGTATTCATATG lssbd deletion in Lens strain P3-lssBD-Lens ATTTCGATTCCACCGCCGCACTTAGAGAACGTTGATG lssbd deletion in Lens strain P4-lssBD-Lens CGGGATCCTAAGAGCAACCGATATCATTAAAAAGC lssbd deletion in Lens strain P1-lssBD-Paris TTACCAGATTGTTGATGCGAATG lssbd deletion in Paris strain P2-lssBD-Paris CTTGCGGCAGCGTGATGATTGTCTTCTCGGAGTATTCATATG lssbd deletion in Paris strain P3-lssBD-Paris ATTTCGATTCCACCGTAAGCAATCAGCACTTAGAGAGCG lssbd deletion in Paris strain P4-lssBD-Paris GGGTGATTCCAGCGAATTAGAG lssbd deletion in Paris strain P1-tolC-Paris ATTACAGAGAATTCCTTACCAACCG tolc deletion in Paris strain P2-tolC-Paris CTTGCGGCAGCGTGATGATCTACCAGAGGAGGTATATCCG tolc deletion in Paris strain P3-tolC-Paris ATTTCGATTCCACCGTTAGCAACTACACGTGTCAATGGA tolc deletion in Paris strain P4-tolC-Paris AAGCCTGATGTTATATTACCCAAGC tolc deletion in Paris strain P1-rtxA-Paris GCGCAAACCCAATATACATCAG rtxa deletion in Paris strain P2-rtxA-Paris CTTGCGGCAGCGTGACAGATTCAGCTAACATGTTCTGTCC rtxa deletion in Paris strain P3-rtxA-Paris ATTTCGATTCCACCGGAACAGTAAGATGAACTCATTACATTGG rtxa deletion in Paris strain P4-rtxA-Paris CACACTTAATTTAGGGTAATCAAATTGG rtxa deletion in Paris strain S-lssBD-SalI CCTTTAAGTCGACTAAATTTACTGCTTAATATAAAG lssbd (Lens) cloning for R-lssBD-SphI ATGCATGCTACCGTAACAACTTCATCAACG lssbd (Lens) cloning for S-lssParis-SalI GCGTCGACTAATCATAAAAATCATATGAATACTCCG lssbd (Paris) cloning for R-lssParis- SphI ATTTCGAAAGCATGCTTTTACACACTAATTAACGCTCTC lssbd (Paris) cloning for S-rtxA162- KpnI GCGGTACCAATGGTGGTAATGGCAATGATG Construction of BlaM-RtxA S-rtxA731- KpnI GCGGTACCTCTAGTGGTAGTAAACGTTCTGGAGG Construction of BlaM-RtxA R-rtxA-XbaI CCTCTAGAACCAATGTAATGAGTTCATCTTACTGTTC Construction of BlaM-RtxA S-mCherry- NdeI GAGATATACATATGGTTTCCAAGGG Construction of mcherry-rtxa R-mCherry- KpnI CGGGGTACCTTTGTACAGCTCATCCATGCC Construction of mcherry-rtxa

3 " #$" #%" #&" #'" #(" #)" #*" #+" " '" +" $%" $)" %" %'" %+" &%",-./" 01234" 05//67" 05//67"8 95//67" " #$" #%" #&" #'" #(" #)" #*" " '" +" $%" $)" %" %'" %+" &%" :;<=/" :;<=/"05//67" :;<=/"0325>" D=E-"AFC" D=E-"AFC" "#$%&'()G"H<2I3F"2J"/3<;=./",-./"KD#":;<=/"KD";.1"1-<=L;ML-"/3<;=./"

4 "#$%#&'()'*$ +&'()%./$ +""#$% +""#$$,-""#$% "#$%&'()0$12)")"3%(%)2$"&$4""#$$)"567*8$)*%+,"(-,.//% /9'$*'6)9$"&$)*%+,"(-,.//%%#&'()'*$:2$./$8)76%#$;'#8$6#*$4""#$$*'7%<6=<'$568$688'88'*$:2$

5 2 5 HHH" R e c o v e r e d C F U /m l *+%",'./% P a r is W T *+%",' -"#$% P a r is r tx A "#$%&'()"#$%&'&()&"*+","-"#$"./0,(0" #"-"#$"./0,(0"1,2")*(20'/)0&$"3("20',3("4,'32",($"302",536307"0*",$%&'&"*(0*",".*(*6,7&'"*+" 89:;8<=<"%/.,("&>30%&63,6")&662"1,2",22&22&$"*(&"%*/'",?&'")*(0,)0@".*(*6,7&'2"1&'&"1,2%&$",($"'&.,3(3(A"5,)0&'3,"1&'&"B/,(CD&$"57">6,C(A"*(",A,'">6,0&2"+*'"9EF"GHHH">IJ@JJK"/23(A" L0/$&(0M2"0;0&20NO"

6 D Figure S4: Cytotoxicity of rtxa strains towards A. castellanii The death of A. castellanii infected by WT strain Paris (B) and rtxa derivative strain (C) was assessed by direct observation through optical microscopy and compared to uninfected cells control (A) after 48 hours of infection. In D, the cytotoxicity of L. pneumophila Lens, Paris and mutant derivatives towards eucaryotic host cells has been measured using the Alamar blue dye, 48 hours after the initial contact.