Supporting Information for Small, smll

Transcription

1 Supporting Information for Small, smll

2 Supporting Information for smll DNA - Carbon Nanotubes Conjugates prepared by a versatile method using streptavidin-biotin recognition** Sébastien Lyonnais 1, Laurence Goux-Capes 1, Christophe Escudé 2, Denis Cote 3, Arianna Filoramo 1 * and Jean-Philippe Bourgoin 1 1 Laboratoire d Electronique Moléculaire CEA Saclay, DSM/DRECAM/SPEC, Gif/Yvette, France 2 Régulation et Dynamique des Génomes, USM 0503 MNHN, CNRS UMR 5153, INSERM U565, Paris, France 3 LPA, Laboratoire Pierre Aigrain, Ecole Normale Supérieure, CNRS UMR 8551, Paris, France * arianna.filoramo@cea.fr These authors contributed equally Supporting Information on Experimental Details: Compounds: Streptavidin, T4-DNA Ligase and restriction enzymes were purchased from New England Biolabs. STV was stored into 20µl aliquots at +4 C at a concentration of 0.5mg/ml in 10mM sodium phosphate, 150mM NaCl ph 7.2. Poly-L-lysine and Spermidine (SpdCl 3 ) were purchased from Sigma-Aldrich. DNA and PCR primers concentrations were measured using a Genequant-pro microspectrophotometer (Ge Healthcare). PCR primers listed in Table 1 were synthesized with a free 5 -end or 5 -biotin by Eurogentec (Belgium). Nucleic Acids constructs: Long DNA fragments were obtained by PCR using the long expand PCR system kit (Roche Diagnostic). The PCR reactions were carried out according to the manufacturer s instruction, using λ-dna (Sigma) as a template and primers that were designed in order to produce fragments of approximately 2.4kbp or 10kbp. Fragments carrying a biotin at one or both extremities were obtained by using biotinylated primers. After 20 cycles of amplification in three stages (30s at 94 C, 30 s at the annealing temperature and 8 min. at 72 C increasing the last stage by 10 s per cycle) and a concluding extension of 7 min. at 72 C, primers and unincorporated dntp were removed using PCR purification kits (Qiagen). The annealing temperature was 68 C for the 10kbp fragment and 62 C for the 2.4kbp fragment. The DNA construction presented in Figure 3 required three different DNA fragments which could be assembled together by ligation of

3 complementary sticky ends. The 1.85kbp fragment was obtained by double digestion of pbluescript SK + (Stratagene) with BsaI and DraIII and purification of the desired fragment by gel extraction using a commercial kit (Qiagen). The 1.2kbp and the 468bp fragments were synthesized by PCR, using pbluescript SK + as a template. The sequences of the primers were designed with non-hybridizing 5'-ends in order to introduce cleavage sites for BsaI. This class IIS restriction enzyme, cleaves outside its recognition site and therefore can generate any 4nt overhang, the sequence of which being chosen by designing the primers. The shortest fragment was biotinylated by incorporation of Biotin-16-dUTP (Roche) during the PCR. The PCR reactions as well as the quantification of incorporated biotin were carried out according to previously described processes [33, 34]. For both fragments, primers and unincorporated dntp were removed using a Qiagen PCR purification kit. Fragments were next digested overnight at 50 C with BsaI and the cleaved extremities were removed by ultrafiltration using a microcon YM50 column (Millipore) which was centrifugated at 5000rpm for 5min. at room temperature. The 3.5kbp construct was assembled by incubating a 3/1/1 ratio of fragments 456/1.2kbp/1.83kbp (about 0.1µM for the shortest fragment) and 100U of T4 DNA ligase (New England Biolabs) in 50µl of the recommended buffer overnight at 16 C. It was finally purified by gel extraction. Supporting Tables: Table S1. Oligonucleotides names and sequences used in this study Size Oligo Sequence (5 3 ) 468bp 1.2kbp 2.4kbp 10kbp 468rv 468fw 1230rv 1230fw 2400rv 2400fw 10000rv 10000fw ATGCTGGTCTCTACCGGCGATAAGTCGTGTCTTAC CGCTTGGTCTCTGCTCGGTATCAGCTCACTCAAAG ATGCTGGTCTCTGAGCATTGGTAACTGTCAGACC TGGAGCTCCAGCTTTTGTTC CGAGATAGGGTTGAGTGTTG AGTGCTGCCATAACCATGAG ATACGCTGTATTCAGCAACACCGTCAGGAACAG CTGATGAGTTCGTGTCCGTACAACTGGCGTAATC

4 Supporting Figures: Figure S1: Water-soluble SWNT and their coating by STV. a) AFM image of SWNT purified by a combination of HNO 3 and H 2 O 2 treatments and solubilised in water. The diameters of the naked SWNT used in this study are around 1.3nm. b-c) STVcoated SWNT in conditions of full coverage obtained after removal of unbound STV by dialysis at 4 C in a solution buffered at ph 7.0..After incubation with STV, the SWNT were found covered with a regular layer of globular particles The STVcoated SWNT present an average diameter of 5nm (± 0.3nm). A complete coating of the SWNT by a layer of STV was obtained in 30 minutes at room temperature with the protocol described in the method section. When using highly diluted STV solution (typically well below 1pg/ml), we observed that the proteins were able to bind to the SWNT as individual entities with clusters of proteins with some preferential binding at the SWNT extremities (see Figure 3d for example, and ref. [18] ). Naked and coated SWNT were absorbed on mica using surface functionalization with poly-l-lysine, which significantly enhanced SWNT binding to mica, and thus made easier the AFM imaging in air of the adsorbates. Scale bars: 250nm.

5 Figure S2. A DNA bridge between two SWNT. a) Electrophoresis assay characterising the coupling of 2.4kbp bisbiotinylated DNA fragments with SWNT. Lane 1: SWNT incubated with bis-biotinylated 2,4kbp DNA fragments without STV. Lane 2: bis-biotinylated DNA reacted with STV (R=1) in absence of SWNT. Lane 3: bis-biotinylated DNA mixed with STV-coated SWNT. Again DNA was trapped in the well only after an incubation with STV-coated SWNT. In this example the fluorescence of the band corresponding to the unbound DNA fragments represents 30% of the total DNA. Thus, the yield of the conjugates formation reached ca 70% in these conditions, where the STV-coated SWNT were dialyzed to remove unbound STV. b) AFM image of two STV-coated SWNT linked by one 10kbp bis-biotinylated DNA fragment. In this case, we also observed a single DNA molecule attached by both extremities to the same SWNT, but only in very rare cases. DNA- SWNT conjugates were deposited on poly-l-lysine coated mica surface. The scale bar is 200nm.