(Big) Data Analytics for strain and product development
|
|
|
- Antony Phelps
- 5 years ago
- Views:
Transcription
1 (Big) Data Analytics for strain and product development Wynand Alkema Principal Scientist Data Head of University 1
2 NIZO in short Independent, private contract research company for the food industry Application & Processing Centre HQ in The Netherlands (Food Valley) Offices in USA, France, Japan 160 FTE From lab to practice Food-grade pilot plant From research to business solution Research Centre
3 Challenges for Food Industry How can we improve fermentation? - microbial cell as a factory - produce ingredients - improve taste, stability How can we improve safety? - prevent spoilage - spores, biofilms, fungi - pathogenic bacteria How can we improve health? - commensal bacteria, probiotic bacteria - produce healthy ingredients
4 What is Big Data Analytics? Science of collecting, combining and analyzing large amounts of data Extract novel information that can be used for making faster and more informed decisions Scope Numerical, research type of data Scientific text World-wide web Financial data, time course data IP related data Legislative information from regulatory bodies Consumer related data 4
5 Statistical and domain expertise The 6-Vs of big Data Volume Volumes of gigabytes and terabytes More data beats better algorithms Velocity Process data in real time Visualization Data without proper visualization reduces value Variety Structured, unstructured, both Video, text, audio, images Veracity Do we know and trust the data sources? Can we weigh the data? Value Always look for a suitable business case IT, hardware knowledge
6 Sources of big data (examples) Biological data (~omics data. The simultaneous measurement of thousands of biological entities) Genomes ( ), Proteins (10 3 ), Metabolites (10 3 ) Literature data Scientific papers (10 7 ) -> 2 papers per minute are added US-Patents (10 5 applications per year) Factory data Inline measurements of manufacturing parameters Consumer data Twitter, Facebook, weblogs 6
7 The big data reservoir Getting information off the Internet is like taking a drink from a firehose. 7
8 Data Torture the data, and it will confess to anything. Spurious correlations 8
9 Strain and product improvement 9
10 Ingredients with taste modifying activity Food industry looks for Low salt Low sugar Low fat Finding novel ingredient is expensive and time consuming Literate mining to automatically discover taste modifying ingredients Unbiased approach Covering a wide range of scientific literature Covering a wider range of possible new ingredients 10
11 The sensory ontology Hierarchically structured. Structured vocabulary Includes synonyms etc. Only part is shown here, total > 500 terms. Any data integration project that does not have an ontology will fail. 11
12 Connecting ingredients to taste Taste Ontology e.g. sweet, sour, bitter,umami, salty, ropiness, TASR1 Literature source 25 million scientific abstracts ~500 keywords, assembled by experts search Ingredient ontology e.g. mannitol,sucrose,sorbitol, alphaterpineol, 4-methylpentanoic acid,ethyl propionate,flavonoid,caffeine ~ ingredients Co-citation in a text is a connection. Many co-citations is a strong connection. Use statistics to correct for frequently used terms! 12
13 keywords Big Data 25 million papers 13
14 The taste literature landscape
15 Points of interest : modulators Show heatmap
16 Points of interest : modulators Show heatmap
17 Points of interest : modulators Show heatmap Ergotheoneine
18 Strain selection 18
19 New strains, new functions Identifying strains and functionalities requires experimental data, assay development. Testing multiple functionalities under multiple conditions; trial and error. Safety assessment. Use genome mining to preselect the strain function combination with the highest chance of success 19
20 Hydrolyzes lactose Bacterial Genomes The genome is a barcode that defines the properties of the organism. Antibiotic resistance Grows on glucans 20
21 21 Together to the next level >150 organisms >100 genomes >200 phenotypic measurements data points
22 GENOBOX : From genome to prediction Individual Lactococcus genomes Statistical model Flavor formation Off flavor formation GI survival Heat stress survival Vitamin B12 Yield Gene Statistical containers models (>50 in in total) : : Expert curated sets of of (1- ~10) ~100) genes genes that that are are linked to linked a functional to a function. trait. Traffic lights : Based on BLAST applying matching Statistical of Gene models Containers to each genome. to the genome. Costs of sequencing : 200 euro per organism
23 Final remarks Competitive advantage Informed decisions Efficiency gain New IP Challenges Education & awareness Data Stewardship Business cases 23
24 24
25 Points of interest : receptors Also show heatmap
26 Connecting
27 Interpretation
28 Interpretation Ergotheoneine
NIZO: HOTSPOT FOR MICROBIOME RESEARCH
NIZO: HOTSPOT FOR MICROBIOME RESEARCH Helping you create microbiome modulators Nils Hijlkema, business development manager Personal Care & Pharma 26/03/2018 NIZO for better food & health Independent, private
AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
Types of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
Driving sustainable growth through innovation Rob van Leen, Chief Innovation Officer & Member Executive Committee Delft, September 25, 2017
Driving sustainable growth through innovation Rob van Leen, Chief Innovation Officer & Member Executive Committee Delft, September 25, 2017 ROYAL DSM HEALTH NUTRITION MATERIALS Safe harbor statement This
Real Applications of Big Data. Challenges and Opportunities
Real Applications of Big Data. Challenges and Opportunities David Gil University of Alicante Polytechnic School - EPSA Department of Computer Technology Introduction to Big Data Projects Benchmarking (weka,
GMI: Global Microbial Identifier
GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge through the use of Whole Genome Sequencing (WGS) Jørgen Schlundt Professor Technical University of
Data Science at the UNC Eshelman School of Pharmacy
Data Science at the UNC Eshelman School of Pharmacy Alexander Tropsha Associate Dean for Pharmacoinformatics and Data Science UNC Eshelman School of Pharmacy University of North Carolina, Chapel Hill,
Artificial Intelligence and Machine Learning in IoT
Artificial Intelligence and Machine Learning in IoT Dr. Christine Preisach Vice President Data Science in IoT PUBLIC What is IoT: Examples and Facts Save time and improve quality of life with: Optimized
Knowledge Discovery and Data Mining
Knowledge Discovery and Data Mining Unit # 19 1 Acknowledgement The following discussion is based on the paper Mining Big Data: Current Status, and Forecast to the Future by Fan and Bifet and online presentation
Food Safety (Bio-)Informatics
Food Safety (Bio-)Informatics Henk C. den Bakker Assistant Professor in Bioinformatics and Epidemiology Center for Food Safety University of Georgia hcd82599@uga.edu Overview Short introduction of Food
Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D.
Cory Brouwer, Ph.D. Dr. Cory R. Brouwer is Director of the Bioinformatics Services Division and Associate Professor of Bioinformatics and Genomics at UNC Charlotte. He and his team provide a wide range
Bioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
Cellular Agriculture
Cellular Agriculture What We Are Going To Talk About Silicon Valley The Consumer The New Sustainability Cellular Agriculture The Future Food system is too complex, too expensive and too fragile. Farms
Big Data in Agriculture Challenges. Pascal Neveu INRA Montpellier
Big Data in Agriculture Challenges INRA Montpellier The rise of Big Data in agriculture More data production from heterogeneous sources 2 The rise of Big Data in agriculture More and more data services
Introduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
Microbially Mediated Plant Salt Tolerance and Microbiome based Solutions for Saline Agriculture
Microbially Mediated Plant Salt Tolerance and Microbiome based Solutions for Saline Agriculture Contents Introduction Abiotic Tolerance Approaches Reasons for failure Roots, microorganisms and soil-interaction
Machine Learning and Data Fusion Methods for Phenotype-based Threat Assessment of Unknown Bacteria
Machine Learning and Data Fusion Methods for Phenotype-based Threat Assessment of Unknown Bacteria Dr. Paul Sheehan Program Manager, BTO SBIR/STTR Industry Day DARPA Conference Center Arlington, VA August
BIO8041 BIO3030. Antimicrobial Drug Discovery
BIO8041 BIO3030 Antimicrobial Drug Discovery Module overview Intended Knowledge Outcomes The aim of this module is to demonstrate various routes to the discovery of microbial products with commercial value.
^[now][transl comput]ational[epi]genomic$
![^[now][transl comput]ational[epi]genomic$](/thumbs/89/99216092.jpg "^[now][transl comput]ational[epi]genomic$")
^[now][transl comput]ational[epi]genomic$ ^[now][transl comput]ational[epi]genomic$ Lab for Bioinformatics and computational genomics 30 genome hackers mostly engineers (statistics) scientists, technicians,
INTERNATIONAL EXPERT IN PROBIOTICS AND LIVESTOCK NUTRITION
INTERNATIONAL EXPERT IN PROBIOTICS AND LIVESTOCK NUTRITION About VISION Become the leading company in researching, producing and distributing probiotics and livestock nutrition products in Asia. MISSION
Why study sequence similarity?
Sequence Similarity Why study sequence similarity? Possible indication of common ancestry Similarity of structure implies similar biological function even among apparently distant organisms Example context:
How Targets Are Chosen. Chris Wayman 12 th April 2012
How Targets Are Chosen Chris Wayman 12 th April 2012 A few questions How many ideas does it take to make a medicine? 10 20 20-50 50-100 A few questions How long does it take to bring a product from bench
Dr. Sabri M. Naser Department of Biology and Biotechnology An-Najah National University Nablus, Palestine
Molecular identification of lactic acid bacteria Enterococcus, Lactobacillus and Streptococcus based on phes, rpoa and atpa multilocus sequence analysis (MLSA) Dr. Sabri M. Naser Department of Biology
Data Informatics. Seon Ho Kim, Ph.D.
Data Informatics Seon Ho Kim, Ph.D. seonkim@usc.edu What is Big Data? What is Big Data? Big Data is data whose scale, diversity, and complexity require new architecture, techniques, algorithms, and analytics
Global Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource
Global Biomolecular Information Infrastructure and Australia Graham Cameron Director The EMBL Australia Bioinformatics Resource What is bioinformatics? Methods, data, IT to exploit biomolecular information
Future of Analytics The Lure, Promise and Pitfall of Data
Future of Analytics The Lure, Promise and Pitfall of Data Terry Smagh Business Unit Executive Analytics Asia Pacific We all walk past solvable problems and leave opportunities untapped every day TM WHAT
THE BENEFITS AND USES OF MICROBES
MODULE 4 MICROBES AND MICROBIAL BIOTECHNOLOGY U N I T 2 THE BENEFITS AND USES OF MICROBES A. MICROBIAL BIOTECHNOLOGY 1 Read What is biotechnology? and decide which of the words below can be used instead
HISTORY OF CHLORINE DIOXIDE
HISTORY OF CHLORINE DIOXIDE 1814 Sir Humphrey Davy, a British chemist, discovers chlorine dioxide (CD), a result of potassium chlorate reacting with sulfuric acid. Although he fully understood the chemistry,
Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich
Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich Technical Support Specialist Hygiena, LLC Whole genome sequencing (WGS) has become the ultimate
Microbial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut
Microbial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut Jill Banfield Talk Overview i) AMD microbial biofilms: an example of reproducible community assembly
Summary Report. Training Course for Microbial Data Analysis
Summary Report Training Course for Microbial Data Analysis Hosted by: WFCC-MIRCEN World Data Center for Microorganisms (WDCM) Organized by: World Federation for Culture Collections (WFCC) The Center for
Advancing Information Management and Analysis with Entity Resolution. Whitepaper ADVANCING INFORMATION MANAGEMENT AND ANALYSIS WITH ENTITY RESOLUTION
Advancing Information Management and Analysis with Entity Resolution Whitepaper February 2016 novetta.com 2016, Novetta ADVANCING INFORMATION MANAGEMENT AND ANALYSIS WITH ENTITY RESOLUTION Advancing Information
CS4491/CS 7265 BIG DATA ANALYTICS
CS4491/CS 7265 BIG DATA ANALYTICS BIG DATA * The contents are adapted from Dr. Jeongkyu Lee@UB Mingon Kang, Ph.D Computer Science, Kennesaw State University Era of Big Data 2011: Amount of Digital Information
Data representation for clinical data and metadata
Data representation for clinical data and metadata WP1: Data representation for clinical data and metadata Inconsistent terminology creates barriers to identifying common clinical entities in disparate
Module Catalogue for the Master Degree Program Microbiology (M.Sc.)
Module Catalogue for the Master Degree Program Microbiology (M.Sc.) 2018 Faculty of Biological Sciences List of abbreviations: cp credit point(s), L Lecture, S Seminar, E Exercise, P Practical course,
Bioinformatics and computational tools
Bioinformatics and computational tools Etienne P. de Villiers (PhD) International Livestock Research Institute Nairobi, Kenya International Livestock Research Institute Nairobi, Kenya ILRI works at the
BIG Data Analytics AWS Training
BIG Data Analytics AWS Training About Instructor Name: Kesav Total IT work experience: 20+ Years BIG Data Solutions Architect: 5+ Years DW & BI Solution Architect: 15+ Years Big Data Implementations Experience:
NIAID-funded Bacterial Bioinformatics Resource Center (BRC) designed to support infectious disease research
July 2018 } } NIAID-funded Bacterial Bioinformatics Resource Center (BRC) designed to support infectious disease research Special emphasis on 22 pathogenic genera Bacillus, Bartonella, Borrelia, Brucella,
Linguamatics NLP for Electronic Health Records
1 Linguamatics 2013 Linguamatics NLP for Electronic Health Records 2 Linguamatics 2013 Click Agenda to to edit edit Master Master title style title style Linguamatics and I2E Overview Customer case studies
Semantic Enrichment and the Information Manager
WHITEPAPER Semantic Enrichment and the Information Manager Turning Content into Insight It is more resource intensive to bring a drug to market than ever before: Pharmaceutical companies spend an average
Human Microbiome Project: A Community Resource. Lita M. Proctor, Ph.D. Coordinator, Human Microbiome Project NHGRI/NIH
Human Microbiome Project: A Community Resource Lita M. Proctor, Ph.D. Coordinator, Human Microbiome Project NHGRI/NIH 2016 HIV Microbiome Workshop November 17, 2016 1 Human Microbiome Project: 2007 to
Michigan Institute for Data Science (MIDAS) Overview!
The Future of Data Science: A Convergence of Academia, Industry, and Government Speakers October 6, 2015 Michigan Institute for Data Science (MIDAS) Overview Al Hero and Brian Athey MIDAS Co-directors
On-premise vs. cloud-based solutions. A dilemma for businesses
ise vs. cloud-based solutions A dilemma for businesses ise vs. cloud-based solutions If it s in the cloud, it must be better, right? Well, maybe, and maybe not. Introduction Consider any technology today,
Reading: 1) Chapter 14 in Biology for a Changing World, by Shuster, Vigna, Sinha, and Tontonoz (2012)
Biology 100 Winter 2013 North Seattle Community College Reading Guide 12 Natural selection and adaptation Reading: 1) Chapter 14 in Biology for a Changing World, by Shuster, Vigna, Sinha, and Tontonoz
Fluorescent markers for strains in mixed cheese starter cultures
Fluorescent markers for strains in mixed cheese starter cultures fermentation, starter cultures, fluorescent proteins Svetlana Alexeeva (svetlana.alexeeva@wur.nl) MSc - 6 months Cheese manufacturing relies
Introduction to Bioinformatics
Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control
This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
Mochamad Nurcholis. Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013
Mochamad Nurcholis Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013 Microbial Identification Type Conventional Identification DNA Hybridization PCR Amplification DNA
Seizing the Power of Predictive Analytics in Government INDUSTRY PERSPECTIVE
Seizing the Power of Predictive Analytics in Government INDUSTRY PERSPECTIVE 2 Industry Perspective Executive Summary Most of us have access to more data than we could ever use in a lifetime think about
Probiotics Do they have a role in the pig industry?
Martin Kenny* - University of Bristol Hauke Smidt University of Wageningen Elena Mengheri INRAN, Roma Probiotics Do they have a role in the pig industry? EAAP Congress Dublin 2007 2 Outline of presentation
Аquaphotomics in biotechnology - new tools and opportunities
Аquaphotomics in biotechnology - new tools and opportunities Prof. Albert Krastanov UNIVERSITY OF FOOD TECHNOLOGIES AQUAPHOTOMICS time-efficient allows rapid, chemical-free, noninvasive in vivo assessment
Short Course Instructors
Short Course Instructors Andrew Allen, Ph.D., Professor of Biostatistics and Bioinformatics and Director of the new Duke Center of Statistical Genetics and Genomics, Duke University, has expertise in statistical
PAREXEL GENOMIC MEDICINE SERVICES. Applying genomics to enhance your drug development journey
PAREXEL GENOMIC MEDICINE SERVICES Applying genomics to enhance your drug development journey YOUR JOURNEY. OUR MISSION. Genomic expertise to simplify the route to product approval and maximize patient
Smarter Analytics for Big Data
Smarter Analytics for Big Data Anjul Bhambhri IBM Vice President, Big Data February 27, 2011 The World is Changing and Becoming More INSTRUMENTED INTERCONNECTED INTELLIGENT The resulting explosion of information
PROVIDING ADAPTED TECHNOLOGICAL INNOVATION SOLUTIONS
PROGRAM MICROBIOTA OPPORTUNITIES PROVIDING ADAPTED TECHNOLOGICAL INNOVATION SOLUTIONS TO FULLY EXPLORE MICROBIOTA OPPORTUNITIES BIOASTER programs undertake your most challenging projects through: specialised
Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping
Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction
Microbial Biotechnology BIOL410
Microbial Biotechnology BIOL410 Course outline Introduction: microbial biotechnology scope and history Microbial Diversity Microbial metabolism Fermentation Microbial Biotechnology in Agriculture and Aquaculture
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,
Processing Very Large Genomic Files
Processing Very Large Genomic Files Michael Robinson School of Computer Information Science Florida International University Miami, Florida, USA michael.robinson@cs.fiu.edu Abstract We have developed a
Introduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
Phenotype MicroArray Product Guide
Phenotype MicroArray Product Guide USA & Canada 2006 Biolog, Inc. All rights reserved Printed in the United States of America Patented Technology Phenotype MicroArrays and their use are covered by U.S.
Patentability/Literature Research
Patentability/Literature Research The probiotic-based solution to combat cholera as presented here comprises of two major innovative components: (1) the metabolite-dependent pathogen inhibition by a probiotic
The Promise of Molecular Technology
The Promise of Molecular Technology Unlocking new sources of molecular diversity to create products that are better, cheaper and more sustainable for all TABLE OF CONTENTS 03 Overview - About Zymergen
Production of antifungals by food-grade microorganisms
Production of antifungals by food-grade microorganisms antifungal compounds, lactic acid bacteria Eddy Smid (eddy.smid@wur.nl) Prof. Dr J. Hugenholtz (FBR) MSc - 6 months Most food and beverages are continuously
Data Mining and Knowledge Discovery in Large Databases
Outline We are drowning in data, but we are starving for knowledge Part 2: Clustering - Hierarchical Clustering - Divisive Clustering - Density based Clustering Data Mining and Knowledge Discovery in Large
Genetic Engineering: Genetically Modified Foods and You!
Genetic Engineering: Genetically Modified Foods and You! GMOs: What s the difference? igem works almost exclusively with microorganisms: single-celled, short lifespans, easy to manipulate with standardized
DEPARTMENT: MICROBIOLOGY PROGRAMME: B SC. Statements of Programme Specific Outcomes (PSOs)
DEPARTMENT: MICROBIOLOGY PROGRAMME: B SC Statements of Programme Specific Outcomes (PSOs) 1. Understand the contributions of various scientist in microbiology and scope of various branches of it 2. Understand
Student Manual. pglo Transformation
Student Manual pglo Transformation Lesson 1 Introduction to Transformation In this lab you will perform a procedure known as genetic transformation. Remember that a gene is a piece of DNA which provides
Course Descriptions. BIOL: Biology. MICB: Microbiology. [1]
![Course Descriptions. BIOL: Biology. MICB: Microbiology. [1]](/thumbs/72/66855241.jpg "Course Descriptions. BIOL: Biology. MICB: Microbiology. [1]")
Course Descriptions BIOL: Biology http://www.calendar.ubc.ca/vancouver/courses.cfm?code=biol [1] BIOL 112 (3) Biology of the Cell The principles of cellular and molecular biology using bacterial and eukaryotic
Big Data, Predictive Analytics, and Security
Big Data, Predictive Analytics, and Security ITEA Annual Symposium 4 October 2016 Reston, VA 16-BIGPASEC-10A Mark J. Kiemele, Ph.D. President and Co-Founder Air Academy Associates Office: 719-531-0777
- OMICS IN PERSONALISED MEDICINE
SUMMARY REPORT - OMICS IN PERSONALISED MEDICINE Workshop to explore the role of -omics in the development of personalised medicine European Commission, DG Research - Brussels, 29-30 April 2010 Page 2 Summary
Genomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
Teaching Bioinformatics in the High School Classroom. Models for Disease. Why teach bioinformatics in high school?
Why teach bioinformatics in high school? Teaching Bioinformatics in the High School Classroom David Form Nashoba Regional High School dform@nrsd.net Relevant, real life examples It s visual Allows for
Perspectives on the Priorities for Bioinformatics Education in the 21 st Century
Perspectives on the Priorities for Bioinformatics Education in the 21 st Century Oyekanmi Nash, PhD Associate Professor & Director Genetics, Genomics & Bioinformatics National Biotechnology Development
Bacterial Transformation Lab - pglo
Bacterial Transformation Lab - pglo Name: Date: Pre-Lab Score: Lab Overview: In this investigation, you will gain an understanding of the techniques of culturing E. coli bacteria and transforming using
Design of Information Systems 1st Lecture
Design of Information Systems 1st Lecture Evaluation method http://online.ase.ro http://sinf.ase.ro Final grade: 50% seminar grade (minimum 5) 50% course grade 1 st written test (in the 6 th week): 2p
Microarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments
Biotechnology Pathway
Biotechnology Pathway The Biotechnology Systems (BS) Career Pathway encompasses the study of using data and scientific techniques to solve problems concerning living organisms with an emphasis on applications
IMPACT OF DIET ON MICROBIOTA COMPOSITION AND FUNCTION IN THE SMALL INTESTINE Microbiome Drug Development Summit
IMPACT OF DIET ON MICROBIOTA COMPOSITION AND FUNCTION IN THE SMALL INTESTINE Microbiome Drug Development Summit 2017 29-06-2017 Els van Hoffen Senior scientist and project manager Nutrition & Health els.vanhoffen@nizo.com
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS
Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS Chapter Summary Mapping of human genes means identifying the chromosome and the position on that chromosome where a particular gene is located. Initially
COURSE CATALOGUE UPV SEMESTER 3
COURSE CATALOGUE UPV SEMESTER 3 emplant COURSE CATALOGUE ERASMUS MUNDUS MASTER PROGRAMME IN PLANT BREEDING Contents Joint Courses...3 Semester 3 UPV...5 Joint Courses JOINT COURSES Description, contents,
The Challenge of Managing Access to New and Novel Forms of Data: An Application of UDC
The Challenge of Managing Access to New and Novel Forms of Data: An Application of UDC Suzanne Barbalet Discovery Team UK Data Service, University of Essex Nathan Cunningham Associate Director Big Data,
THE HUMAN MICROBIOME: RECENT DISCOVERIES AND APPLICATIONS TO MEDICINE
THE HUMAN MICROBIOME: RECENT DISCOVERIES AND APPLICATIONS TO MEDICINE American Society for Clinical Laboratory Science April 21, 2017 Richard A. Van Enk, Ph.D., CIC FSHEA Director, Infection Prevention
Investor Presentation November 2017
Investor Presentation November 2017 1 DISCLAIMER The material contained in this document is a presentation of general information about the proposed activities of Microba Pty Ltd as at the date of this
The HL7 Clinical Genomics Work Group
HL7 Clinical Genomics Domain Information Model The HL7 Clinical Genomics Work Group Prepared by Amnon Shabo (Shvo), PhD HL7 Clinical Genomics WG Co-chair and Modeling Facilitator Pedigree (family health
MicroSEQ TM ID Rapid Microbial Identification System:
MicroSEQ TM ID Rapid Microbial Identification System: the complete solution for reliable genotypic microbial identification 1 The world leader in serving science Rapid molecular methods for pharmaceutical
Detection of Mobile Genetic Elements (MGEs) in Bacterial Genomes
Detection of Mobile Genetic Elements (MGEs) in Bacterial Genomes PhD student: Zheng WANG Supervisor: Professor Margaret IP Department of Microbiology, CUHK Date: 3rd Dec, 2013 Contents Introduction Methodology
Genetic Mutations Ap Bio Pogil Answers Proteineore
We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer, you have convenient answers with genetic mutations ap
S-BIOMEDIC. Company Profile
S-Biomedic is a Belgium based life science company exploring the unexploited cosmetic and therapeutic potential of the skin microbiome. The skin microbiome a habitat of billions of beneficial and harmful
Big Data Science and Civil Infrastructure
Big Data Science and Civil Infrastructure Dr. Alok Aggarwal CEO and Chief Data Scientist October 09, 2015 Scry Analytics About Scry Analytics LOCATIONS San Jose, California; Raleigh, North Carolina; Delhi-Gurgaon,
FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING. From wet lab to dry lab complete sample analysis
FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING From wet lab to dry lab complete sample analysis »Progress in science depends on new techniques, new discoveries
ECS 234: Genomic Data Integration ECS 234
: Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG
IBM Briefing Hva med 2017?
IBM Briefing Hva med 2017? DnD Februar 2017 Stein F. Andresen Stein.f.andresen@no.ibm.com The recent evolution of the GTO: It s all about Data 2012 2013 2014 Cloud Mobile Social Internet of Things Volume
BIOTECHNOLOGY P.G DIPLOMA Duration - 1 year MODULE I o INTRODUCTION TO GENERAL MICROBIOLOGY
BIOTECHNOLOGY P.G DIPLOMA Duration - 1 year MODULE I o INTRODUCTION TO GENERAL MICROBIOLOGY o BASIC CONCEPTS Sterilization techniques Microbiological culture media and its importance Isolation of microorganisms
Microbials. Impact on agriculture and the seed industry. Marcus Meadows-Smith. BioConsortia, Inc.
Microbials Impact on agriculture and the seed industry Marcus Meadows-Smith BioConsortia, Inc. Seed Central, UC Davis, 9 February 2017 Agenda 1) Introduction to Microbials - Marcus Meadows-Smith, CEO,
Computational methods in bioinformatics: Lecture 1
Computational methods in bioinformatics: Lecture 1 Graham J.L. Kemp 2 November 2015 What is biology? Ecosystem Rain forest, desert, fresh water lake, digestive tract of an animal Community All species
The Impact of Big Data and Social Networking for Decision making
ISSN 2278 0211 (Online) The Impact of Big Data and Social Networking for Decision making Syeda Sirin Sahnaz School of Computing Sciences, Kaziranga University, Assam, India Sandip Rakshit School of Computing
University of Groningen. Bacterial natural products Ceniceros, Ana
University of Groningen Bacterial natural products Ceniceros, Ana IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document
Next Generation Sequencing Applications in Food Safety and Quality
Next Generation Sequencing Applications in Food Safety and Quality Our science National and international centre of excellence for interdisciplinary investigation and problem solving across plant and bee