Food Safety (Bio-)Informatics

Size: px
Start display at page:

Download "Food Safety (Bio-)Informatics"

Transcription

1 Food Safety (Bio-)Informatics Henk C. den Bakker Assistant Professor in Bioinformatics and Epidemiology Center for Food Safety University of Georgia

2 Overview Short introduction of Food Safety Informatics The digital immune system

3 Food Safety Informatics? The use of information and computer science to advance food safety A combination of different individual disciplines: Statistics Computer science Epidemiology Bioinformatics Using Big Data approaches, The Internet of Things

4 The rise of a digital immune system (DIS) Coined by David Lipman Further worked out by Michael Schatz and Adam Phillippy in 2012* Would work in much the same way as an adaptive, biological immune system: Observe the microbial landscape Detect potential threats Neutralize threads before they can cause widespread harm Distributed sensor sequencing and bioinformatics where a network of mobile sequencing devices serves a real-time stream of microbial genomes to a global compute cloud for analysis. *Schatz, M.C, & A. Phillippy GigaScience 1 (1): 4. doi: / x-1-4.

5 What is necessary for a digital immune system? A catalogue of microbial diversity, so we can tell the normal from the abnormal (a potential thread) Centralized (genome) databases, such as NCBI, EMBL and DDBJ Rapid bioinformatics tools to deal with the growing amount of (realtime) data sequencing devices (preferably inexpensive and portable) that can act as the sensors in a distributed, real-time sequencing network

6 The digital immune system

7 Applying the digital immune system to food safety: The GenomeTrakr project Project spear-headed by the FDA* GenomeTrakr is the first distributed network of labs to utilize whole genome sequencing for pathogen identification Consists of 15 federal labs, 25 state health and university labs, 1 U.S. hospital lab, 2 other labs located in the U.S., 20 labs located outside of the U.S., and collaborations with independent academic researchers. Data curation and bioinformatic analyses and support are provided by the National Center for Biotechnology Information (NCBI) at the National Institutes of Health The GenomeTrakr network has sequenced more than 167,000 isolates, and closed more than 175 genomes. The network is regularly sequencing over 5,000 isolates each month. *

8 The sensors and the network Illumina short read sequencers, in particular the MiSeq Generate genome sequences as short reads, typically >> 200,000 per bacterial genome

9 The sensors and the network

10 Using whole genome sequencing (WGS) data in outbreak investigations WGS data give unprecedented resolution Ability to use genomic changes that can help us to infer relatedness with strains in past and present (Single Nucleotide Polymorphisms). After ~ 2 years of using WGS for outbreak investigations*: aid in finding the food vehicle for cold cases and sporadic cases, as WGS can phylogenetically link isolates from human cases and food. Sequencing of both food product and patient derived isolates, outbreaks can be confirmed following product testing, allowing for an early association of an outbreak with a contaminated food. WGS can help in a rapid and precise outbreak case definition, and thus productively redirect epidemiological resources * Jackson et al Clin Infect Dis.;63(3):380-6

11 NCBI Pathogen detection

12 The database is growing

13 How close is the GenomeTrakr network to a digital immune system? Close, but far from real-time: Still dependent on classical microbiology to isolate pathogens, which adds days to weeks to the protocol Sequenchers are state of the art, but the sequencing procedure takes 2 to 3 days The increasing size of the database becomes prohibitively large for real-time searches

14 New sequencing technologies and (quasi- )metagenome sequencing Novel sequencing protocols that need either no or very limited steps for enrichment of target organisms Novel sequencing technologies e.g., Oxford Nanopore

15 The databases are getting larger and larger

16 Fortunately we can surf the Big Data wave Source:

17 A rediscovery of old data structures/algorithms Big Data is years ahead of the big increase in genomic data In an effort to speed up analyses and searches of genomic data, old data structures and algorithms are rediscovered and/or reimplemented: De Bruijn Graph (De Bruijn, 1946) genome assembly Bloom filter (Bloom, 1970) MinHash (Broder, 1997); efficient comparison of datasets

18 MinHash; comparing large datasets with smaller sketches Originally developed to compare large electronic documents (Broder, 1998) Summarizes documents as subsets (sketch) of a fixed size of their information, using a specific criterion to select the members of the subset Example: a sketch of a thousand words is approximately large enough to infer the similarity of a document with millions of words Translated to bacterial genomes, we can use the same strategy to divide genomes up in words (kmers) and use a MinHash approach to estimate the relatedness of these genomes Ondov, Brian D. et al Genome Biology 17 (1): 132.

19 BIGSI: Searching microbial big data BLAST has been the traditional search algorithm for genetic and genomic database centers such as NCBI (US), EBI (Europe). However the majority of genomic data (by now hundreds of thousands) are stored as un-assembled genomes, consisting of hundreds of thousands to millions of small reads BLAST is generally not fast enough to search these databases realtime

20 From Bloom filters to BIGSI By David Eppstein - self-made, originally for a talk at WADS 2007, Public Domain, Advantages: small storage for large sets of elements Fast search Disadvantage: False positives

21 BIGSI: extension of the bloom filter bitsliced genomic signature index (BIGSI) Allows for superfast search of big sequence data databases 3 antibiotic resistance genes (MCR-1, MCR-2, MCR3) could be searched in 1.73 seconds in a data-base of 447,833 viral and bacterial genomes. P. Bradley, H.C. den Bakker, E. Rocha, G. McVean, Z. Iqbal biorxiv ; doi:

22 Summary In food safety, the Genome Trackr network is the closest thing we have to a digital immune system In order to use this network to detect early threads we need further improvements: Improvement of sample preparation methods/culture free methods Sequenching technology (faster, easier, smaller) Bioinformatics These improvements are coming fast

Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich

Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich Technical Support Specialist Hygiena, LLC Whole genome sequencing (WGS) has become the ultimate

More information

Challenges and opportunities for whole genome sequencing based surveillance of antibiotic resistance

Challenges and opportunities for whole genome sequencing based surveillance of antibiotic resistance Challenges and opportunities for whole genome sequencing based surveillance of antibiotic resistance Prof. Willem van Schaik Professor in Microbiology and Infection Institute of Microbiology and Infection

More information

Bioinformatics- Data Analysis

Bioinformatics- Data Analysis Bioinformatics- Data Analysis Erin H. Graf, PhD, D(ABMM) Infectious Disease Diagnostics Laboratory, Children s Hospital of Philadelphia Department of Pathology and Laboratory Medicine, University of Pennsylvania

More information

GMI: Global Microbial Identifier

GMI: Global Microbial Identifier GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge through the use of Whole Genome Sequencing (WGS) Jørgen Schlundt Professor Technical University of

More information

Whole Genome Sequencing for food safety FSA Chief Scientific Advisor Report and 2013 Listeria pilot study

Whole Genome Sequencing for food safety FSA Chief Scientific Advisor Report and 2013 Listeria pilot study Whole Genome Sequencing for food safety FSA Chief Scientific Advisor Report and 2013 Listeria pilot study Dr Edward Hayes Date: July 2016, Version 1 Foodborne Pathogens 280,000 cases of Campylobacter,

More information

Whole Genome Sequencing for TB diagnostics. Adam Witney. Institute for Infection and Immunity St George s, University of London

Whole Genome Sequencing for TB diagnostics. Adam Witney. Institute for Infection and Immunity St George s, University of London Whole Genome Sequencing for TB diagnostics Adam Witney Institute for Infection and Immunity St George s, University of London INSTITUTE FOR INFECTION & IMMUNITY WGS applications in TB diagnostics Resistance

More information

Whole Genome Sequence Data Quality Control and Validation

Whole Genome Sequence Data Quality Control and Validation Whole Genome Sequence Data Quality Control and Validation GoSeqIt ApS / Ved Klædebo 9 / 2970 Hørsholm VAT No. DK37842524 / Phone +45 26 97 90 82 / Web: www.goseqit.com / mail: mail@goseqit.com Table of

More information

Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis

Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens Mitchell Holland, Noblis Agenda Introduction Whole Genome Sequencing Analysis Pipeline Sequence Alignment SNPs and

More information

Next Generation Sequencing Applications in Food Safety and Quality

Next Generation Sequencing Applications in Food Safety and Quality Next Generation Sequencing Applications in Food Safety and Quality Our science National and international centre of excellence for interdisciplinary investigation and problem solving across plant and bee

More information

The Genomic Transformation of Health

The Genomic Transformation of Health The Genomic Transformation of Health or: an introduction to the potential of genomics in healthcare Dr Tom Connor School of Biosciences and Systems Immunity University Research Institute Cardiff University

More information

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Using New ThiNGS on Small Things. Shane Byrne

Using New ThiNGS on Small Things. Shane Byrne Using New ThiNGS on Small Things Shane Byrne Next Generation Sequencing New Things Small Things NGS Next Generation Sequencing = 2 nd generation of sequencing 454 GS FLX, SOLiD, GAIIx, HiSeq, MiSeq, Ion

More information

Bioinformatics Tools and Pipelines for Real-Time Pathogen Surveillance

Bioinformatics Tools and Pipelines for Real-Time Pathogen Surveillance Bioinformatics Tools and Pipelines for Real-Time Pathogen Surveillance Errol Strain, Ph.D. Chief, Biostatistics Branch FDA/OFVM/CFSAN/OAO/DPHIA 3/24/2014 Overview 1. Validation and Proficiency Testing

More information

AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE

AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE We provide: AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE State of the art genomics and bioinformatics analysis Training in experimental techniques, analysis and modelling

More information

Food Safety & High-Throughput Sequencing (HTS) What Does the Future Hold? Perspectives from the Industry, Governmental Agencies and Academia An IFSH

Food Safety & High-Throughput Sequencing (HTS) What Does the Future Hold? Perspectives from the Industry, Governmental Agencies and Academia An IFSH Food Safety & High-Throughput Sequencing (HTS) What Does the Future Hold? Perspectives from the Industry, Governmental Agencies and Academia An IFSH HTS Initiative's Palantir, May 30-31, 2018 Chicago Marriott

More information

Setting the Course: Virginia's experience navigating information technology and bioinformatics needs for whole genome sequencing

Setting the Course: Virginia's experience navigating information technology and bioinformatics needs for whole genome sequencing Setting the Course: Virginia's experience navigating information technology and bioinformatics needs for whole genome sequencing Lauren Turner, Ph.D. Virginia Division of Consolidated Laboratory Services

More information

Canada's IRIDA platform for genomic epidemiology. Gary Van Domselaar Chief, Bioinformatics National Microbiology Lab Public Health Agency of Canada

Canada's IRIDA platform for genomic epidemiology. Gary Van Domselaar Chief, Bioinformatics National Microbiology Lab Public Health Agency of Canada Canada's IRIDA platform for genomic epidemiology Gary Van Domselaar Chief, Bioinformatics National Microbiology Lab Public Health Agency of Canada Integrated Rapid Infectious Disease Analysis informatics

More information

Global outbreak of severe Mycobacterium chimaera disease after cardiac surgery: a molecular epidemiological study

Global outbreak of severe Mycobacterium chimaera disease after cardiac surgery: a molecular epidemiological study Global outbreak of severe Mycobacterium chimaera disease after cardiac surgery: a molecular epidemiological study Jakko van Ingen et al www.thelancet.com/infection Vol 17 October 2017 Background Since

More information

National Institute of Biology - NIB

National Institute of Biology - NIB National Institute of Biology - NIB NIB was established by the Republic of Slovenia as a public, non-profit research institute in 1960 and is today the leading research institution in biological sciences.

More information

Development and Implementation of a Quality System for Next-Generation Sequencing

Development and Implementation of a Quality System for Next-Generation Sequencing Development and Implementation of a Quality System for Next-Generation Sequencing Lauren Turner, PhD Lead Scientist Virginia Division of Consolidated Laboratory Services DCLS Phased Implementation of NGS

More information

Next generation sequencing in diagnostic laboratories: opportunities and challenges

Next generation sequencing in diagnostic laboratories: opportunities and challenges Next generation sequencing in diagnostic laboratories: opportunities and challenges Vitali Sintchenko Marie Bashir Institute for Emerging Infectious Diseases & Biosecurity Declaration No conflict of interest

More information

Introduction to Whole Genome Sequencing and its Applications in Microbial Diagnostics

Introduction to Whole Genome Sequencing and its Applications in Microbial Diagnostics Introduction to Whole Genome Sequencing and its Applications in Microbial Diagnostics Workshop on Whole Genome Sequencing and Analysis, 19-21 Mar. 2018 Whole genome sequencing is currently revolutionising

More information

FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS

FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

Genomics and its Impact on Diagnostic Microbiology

Genomics and its Impact on Diagnostic Microbiology Genomics and its Impact on Diagnostic Microbiology Rick Holliman Lead Public Health Microbiologist for London Outline Where are we now? What is coming our way? How will things change? Where will we be?

More information

Implementation of genomics technologies in regulatory food microbiology testing

Implementation of genomics technologies in regulatory food microbiology testing Implementation of genomics technologies in regulatory food microbiology testing Dr. Catherine Carrillo Canadian Food Inspection Agency 2011 Her Majesty the Queen in Right of Canada (Canadian Food Inspection

More information

Food Safety & High-Throughput Sequencing (HTS) What Does the Future Hold? Perspectives from the Industry, Governmental Agencies and Academia An IFSH

Food Safety & High-Throughput Sequencing (HTS) What Does the Future Hold? Perspectives from the Industry, Governmental Agencies and Academia An IFSH Food Safety & High-Throughput Sequencing (HTS) What Does the Future Hold? Perspectives from the Industry, Governmental Agencies and Academia An IFSH HTS Initiative's Palantir, May 30-31, 2018 Chicago Marriott

More information

Bioinformatics and computational tools

Bioinformatics and computational tools Bioinformatics and computational tools Etienne P. de Villiers (PhD) International Livestock Research Institute Nairobi, Kenya International Livestock Research Institute Nairobi, Kenya ILRI works at the

More information

Functional profiling of metagenomic short reads: How complex are complex microbial communities?

Functional profiling of metagenomic short reads: How complex are complex microbial communities? Functional profiling of metagenomic short reads: How complex are complex microbial communities? Rohita Sinha Senior Scientist (Bioinformatics), Viracor-Eurofins, Lee s summit, MO Understanding reality,

More information

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as

More information

The EMBL-Bioinformatics and Data-Intensive Informatics

The EMBL-Bioinformatics and Data-Intensive Informatics The EMBL-Bioinformatics and Data-Intensive Informatics Graham Cameron EMBL-EBI What is the EMBL-EBI? Non-profit organization Part of the European Molecular Biology Laboratory Based on the Wellcome Trust

More information

Experimental Design Microbial Sequencing

Experimental Design Microbial Sequencing Experimental Design Microbial Sequencing Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu General rules for preparing

More information

CBC Data Therapy. Metagenomics Discussion

CBC Data Therapy. Metagenomics Discussion CBC Data Therapy Metagenomics Discussion General Workflow Microbial sample Generate Metaomic data Process data (QC, etc.) Analysis Marker Genes Extract DNA Amplify with targeted primers Filter errors,

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

ngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian

ngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian Metagenomics T TM storage genetics assembly ncrna custom genotyping RNA-seq de novo mendelian ChIP-seq exome genomics indel ngs trio prediction metagenomics SNP resequencing bioinformatics diagnostics

More information

Bioinformatics Sequence And Genome Analysis David W Mount

Bioinformatics Sequence And Genome Analysis David W Mount Bioinformatics Sequence And Genome Analysis David W Mount We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer,

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases

More information

Looking Ahead: Improving Workflows for SMRT Sequencing

Looking Ahead: Improving Workflows for SMRT Sequencing Looking Ahead: Improving Workflows for SMRT Sequencing Jonas Korlach FIND MEANING IN COMPLEXITY Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, and SMRTbell are trademarks of Pacific Biosciences

More information

What can whole genome sequencing do for you? Michael Deason

What can whole genome sequencing do for you? Michael Deason What can whole genome sequencing do for you? Michael Deason Unprecedented resolution Entirely new technological approach Increasingly inexpensive Obvious uses retain challenges of interpretation Are there

More information

Unlocking Genomic Diversity! without Assembly or Alignment!

Unlocking Genomic Diversity! without Assembly or Alignment! Unlocking Genomic Diversity! without Assembly or Alignment!!! Borevitz Laboratory! Division of Plant Sciences and! Division of Ecology, Evolution and Genetics! Research School of Biology (RSB)! The Australian

More information

The Basics of Understanding Whole Genome Next Generation Sequence Data

The Basics of Understanding Whole Genome Next Generation Sequence Data The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next Generation

More information

Pathogenic organisms no thanks: Use of next generation sequencing techniques in risk assessment and HACCP

Pathogenic organisms no thanks: Use of next generation sequencing techniques in risk assessment and HACCP Pathogenic organisms no thanks: Use of next generation sequencing techniques in risk assessment and HACCP Lisbeth Truelstrup Hansen Professor Microbial Food Safety and Environmental Hygiene Mail: litr@food.dtu.dk

More information

BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES

BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes What are the starting and end points for

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

More information

Machine Learning and Data Fusion Methods for Phenotype-based Threat Assessment of Unknown Bacteria

Machine Learning and Data Fusion Methods for Phenotype-based Threat Assessment of Unknown Bacteria Machine Learning and Data Fusion Methods for Phenotype-based Threat Assessment of Unknown Bacteria Dr. Paul Sheehan Program Manager, BTO SBIR/STTR Industry Day DARPA Conference Center Arlington, VA August

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

Programme Manager GROW Colombia JOB VACANCY

Programme Manager GROW Colombia JOB VACANCY Programme Manager GROW Colombia JOB VACANCY Job details Salary: 39,150-47,850 Post No: 1003398 Contract length: 46 months Department: Organisms & Ecosystems Opening date: 22 January 2018 Closing date:

More information

Beef Industry Safety Summit Renaissance Austin Hotel 9721 Arboretum Blvd. Austin, TX March 1-3

Beef Industry Safety Summit Renaissance Austin Hotel 9721 Arboretum Blvd. Austin, TX March 1-3 1 USDA, Food Safety and Inspection Service Beef Industry Safety Summit - 2016 Renaissance Austin Hotel 9721 Arboretum Blvd. Austin, TX 78759 March 1-3 Uday Dessai MPH, MS, PhD Senior Public Health Advisor

More information

Hybrid Error Correction and De Novo Assembly with Oxford Nanopore

Hybrid Error Correction and De Novo Assembly with Oxford Nanopore Hybrid Error Correction and De Novo Assembly with Oxford Nanopore Michael Schatz Jan 13, 2015 PAG Bioinformatics @mike_schatz / #PAGXXIII Oxford Nanopore MinION Thumb drive sized sequencer powered over

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

CENTER FOR BIOTECHNOLOGY

CENTER FOR BIOTECHNOLOGY CENTER FOR BIOTECHNOLOGY Keith A. McGee, Ph.D., Program Director Math and Science Building, 3 rd Floor 1000 ASU Drive #870 Phone: 601-877-6198 FAX: 601-877-2328 Degree Offered Required Admission Test M.

More information

(Big) Data Analytics for strain and product development

(Big) Data Analytics for strain and product development (Big) Data Analytics for strain and product development Wynand Alkema Principal Scientist Data Analytics @NIZO Head of Bioinformatics @Nijmegen University 1 NIZO in short Independent, private contract

More information

Visit our Career Flowchart to get more information on some of these career paths.

Visit our Career Flowchart to get more information on some of these career paths. Visit our Career Flowchart to get more information on some of these career paths. Academic Research Faculty: This career path consists of university or college professors who conduct research. They select

More information

Advanced Technology in Phytoplasma Research

Advanced Technology in Phytoplasma Research Advanced Technology in Phytoplasma Research Sequencing and Phylogenetics Wednesday July 8 Pauline Wang pauline.wang@utoronto.ca Lethal Yellowing Disease Phytoplasma Healthy palm Lethal yellowing of palm

More information

Microbial sequencing solutions

Microbial sequencing solutions Microbial sequencing solutions Scalable, simple, fast TARGETED GENOME Sequencing f every lab, every budget, every application Ion Trent semiconduct sequencing Ion Trent technology has pioneered an entirely

More information

EURL WORKING GROUP ON WHOLE GENOME SEQUENCING AND PULSENET INTERNATIONAL

EURL WORKING GROUP ON WHOLE GENOME SEQUENCING AND PULSENET INTERNATIONAL EURL WORKING GROUP ON WHOLE GENOME SEQUENCING AND PULSENET INTERNATIONAL EURL-Campylobacter workshop, 9/10-2018 Joakim Skarin, SVA Objectives of the WG-NGS To promote the use of NGS across the EURL networks

More information

The Basics of Understanding Whole Genome Next Generation Sequence Data

The Basics of Understanding Whole Genome Next Generation Sequence Data The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next

More information

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

From classical molecular typing to WGS in a food safety context: WGS at EFSA

From classical molecular typing to WGS in a food safety context: WGS at EFSA From classical molecular typing to WGS in a food safety context: WGS at EFSA Beatriz Guerra EURL-AR WGS Training, Copenhage, Denmark, 27.09.17 WGS FOR FOOD SAFETY AT EFSA Molecular Typing Recent Past:

More information

Biomedical Informatics in BIG DATA Era

Biomedical Informatics in BIG DATA Era Biomedical Informatics in BIG DATA Era Yang C. Fann, Ph.D. Director, Intramural IT and Bioinformatics Program National Institute of Neurological Disorders and Stroke Disclaimer The opinions or assertions

More information

2014 APHL Next Generation Sequencing (NGS) Survey

2014 APHL Next Generation Sequencing (NGS) Survey APHL would like you to complete the Next Generation Sequencing (NGS) in Public Health Laboratories Survey. The purpose of this survey is to collect information on current capacities for NGS testing and

More information

New York State s experience with analyzing, interpreting, and sharing whole genome sequence data for surveillance of enteric organisms.

New York State s experience with analyzing, interpreting, and sharing whole genome sequence data for surveillance of enteric organisms. New York State s experience with analyzing, interpreting, and sharing whole genome sequence data for surveillance of enteric organisms. InForm 11/18/15 William Wolfgang, PhD Wadsworth Center, NYSDOH william.wolfgang@health.ny.gov

More information

Introduction to NGS. Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018

Introduction to NGS. Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018 Introduction to NGS Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018 Life science data deluge Massive unstructured data from several areas DNA, patient journals,

More information

State strategies for bioinformatics in BRICs and the UK. Professor Brian Salter

State strategies for bioinformatics in BRICs and the UK. Professor Brian Salter State strategies for bioinformatics in BRICs and the UK Professor Brian Salter This new facility is the embodiment of our investment in big data and bioinformatics. We are not only ensuring that people

More information

Carl Woese. Used 16S rrna to develop a method to Identify any bacterium, and discovered a novel domain of life

Carl Woese. Used 16S rrna to develop a method to Identify any bacterium, and discovered a novel domain of life METAGENOMICS Carl Woese Used 16S rrna to develop a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary

More information

Lesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome

Lesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

Lecture 21. Microbiology & Metagenomics

Lecture 21. Microbiology & Metagenomics Lecture 21. Microbiology & Metagenomics Michael Schatz April 16, 2018 JHU 600.749: Applied Comparative Genomics Part I: Introduction Microbial Taxonomy Towards a natural system of organisms: proposal for

More information

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation

More information

Machine Learning. HMM applications in computational biology

Machine Learning. HMM applications in computational biology 10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES

BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes Gene calling The simpliest thing is to look

More information

Antimicrobial Resistance Prediction Using Deep Convolutional Neural Networks on Whole Genome Sequencing Data

Antimicrobial Resistance Prediction Using Deep Convolutional Neural Networks on Whole Genome Sequencing Data Antimicrobial Resistance Prediction Using Deep Convolutional Neural Networks on Whole Genome Sequencing Data PRIMES Research Report by: Andrew Zhang Mentor: Dr. Gil Alterovitz PRIMES Conference October

More information

ProNNaC Whole Genome Sequencing. Staphylococcus aureus

ProNNaC Whole Genome Sequencing. Staphylococcus aureus ProNNaC Whole Genome Sequencing and Staphylococcus aureus NRL for Coagulase Positive Staphylococci including S.aureus Angelo Romano National Reference Laboratory for Coagulase Positive Staphylococci, including

More information

Overview of CIDT Challenges and Opportunities

Overview of CIDT Challenges and Opportunities Overview of CIDT Challenges and Opportunities Peter Gerner-Smidt, MD, DSc Enteric Diseases Laboratory Branch InFORM II Phoenix, AZ, 19 November 2015 National Center for Emerging and Zoonotic Infectious

More information

Our website:

Our website: Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate

More information

Analytics Behind Genomic Testing

Analytics Behind Genomic Testing A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical

More information

Array-Ready Oligo Set for the Rat Genome Version 3.0

Array-Ready Oligo Set for the Rat Genome Version 3.0 Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.

More information

Rue Juliette Wytsmanstraat Brussels Belgium T F

Rue Juliette Wytsmanstraat Brussels Belgium T F Kevin Vanneste, PhD Bioinformatics Platform Platform Biotechnology and Molecular Biology Department Expertise, Service Provision and Customer Relations Collaboration between the EURL-VTEC and the Platform

More information

Transcriptomics analysis with RNA seq: an overview Frederik Coppens

Transcriptomics analysis with RNA seq: an overview Frederik Coppens Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)

More information

Whole-Genome Sequencing (WGS) for Food Safety

Whole-Genome Sequencing (WGS) for Food Safety Whole-Genome Sequencing (WGS) for Food Safety Errol Strain, Ph.D. Director, Biostatistics and Bioinformatics Staff Center for Food Safety and Applied Nutrition U.S. Food Drug Administration IFSH Meeting

More information

ELIXIR: data for molecular biology and points of entry for marine scientists

ELIXIR: data for molecular biology and points of entry for marine scientists ELIXIR: data for molecular biology and points of entry for marine scientists Guy Cochrane, EMBL-EBI EuroMarine 2018 General Assembly meeting 17-18 January 2018 www.elixir-europe.org Scales of molecular

More information

Download the Lectin sequence output from

Download the Lectin sequence output from Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).

More information

Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the

Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4

More information

10. BIOTECHNOLOGY (Code No. 045)

10. BIOTECHNOLOGY (Code No. 045) 10. BIOTECHNOLOGY (Code No. 045) An unprecedented growth of human knowledge in the field of Biological Sciences coupled with equally significant developments in the field of technology have brought significant

More information

Questionnaire on the use of High Throughput Sequencing, Bioinformatics and Computational Genomics (HTS-BCG) in the OIE Reference Centre network

Questionnaire on the use of High Throughput Sequencing, Bioinformatics and Computational Genomics (HTS-BCG) in the OIE Reference Centre network Questionnaire on the use of High Throughput Sequencing, Bioinformatics and Computational Genomics (HTS-BCG) in the OIE Reference Centre network Massimo Palmarini MRC-University of Glasgow Centre for Virus

More information

Meet the iseq 100 System.

Meet the iseq 100 System. Meet your new lab partner our smallest, most accessible, and affordable next-generation sequencing (NGS) solution ever. Want deeper biological insights, better experimental efficiency, and greater discovery

More information

ILSI Europe The European branch of the International Life Sciences Institute

ILSI Europe The European branch of the International Life Sciences Institute ILSI Europe The European branch of the International Life Sciences Institute 1 Who we are Vision We build multi-stakeholder science-based solutions for a sustainable and healthier world. 2 What we do Mission

More information

Faramarz Valafar.

Faramarz Valafar. Faramarz Valafar faramarz@sciences.sdsu.edu http://informatics.sdsu.edu/ Biomedical Informatics Research Center (BMIRC) Office: GMCS 625 San Diego State University Molecular Diagnostics for Drug Resistant

More information

New Lab Tech. Bruce L. Akey BS MS DVM Director, Texas A&M Veterinary Medical Diagnostic Laboratory

New Lab Tech. Bruce L. Akey BS MS DVM Director, Texas A&M Veterinary Medical Diagnostic Laboratory New Lab Tech Bruce L. Akey BS MS DVM Director, Texas A&M Veterinary Medical Diagnostic Laboratory WSLHA July 9, 2015 Usefulness Se/Sp Throughput Turnaround New Technologies MALDI TOF Next Generation Sequencing

More information

Lecture 8: Predicting metagenomic composition from 16S survey data

Lecture 8: Predicting metagenomic composition from 16S survey data Lecture 8: Predicting metagenomic composition from 16S survey data Taxonomic and functional stability of microbiota Nature. 2012; 486(7402): 207 214. doi:10.1038/nature11234 2 1 7/6/16 A model of functional

More information

MB 668 Microbial Bioinformatics and Genome Evolution. 4 credits Spring, 2017

MB 668 Microbial Bioinformatics and Genome Evolution. 4 credits Spring, 2017 MB 668 Microbial Bioinformatics and Genome Evolution 4 credits Spring, 2017 Instructors: T. Sharpton, R. Mueller and S. Giovannoni Thomas Sharpton (Microbiology): thomas.sharpton@oregonstate.edu Office

More information

An Industrial Lab s Experience of NGS. Dr Greg Jones

An Industrial Lab s Experience of NGS. Dr Greg Jones An Industrial Lab s Experience of NGS Dr Greg Jones Campden BRI The partner of choice for the development and application of technical knowledge and commercially relevant solutions for the food and drink

More information

Carl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life

Carl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life METAGENOMICS Carl Woese Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary

More information

Functional annotation of metagenomes

Functional annotation of metagenomes Functional annotation of metagenomes Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction Functional analysis Objectives:

More information

FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING. From wet lab to dry lab complete sample analysis

FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING. From wet lab to dry lab complete sample analysis FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING From wet lab to dry lab complete sample analysis »Progress in science depends on new techniques, new discoveries

More information

Practical Bioinformatics for Biologists (BIOS 441/641)

Practical Bioinformatics for Biologists (BIOS 441/641) Practical Bioinformatics for Biologists (BIOS 441/641) - Course overview Yanbin Yin MO444 1 Room and computer access Room entry code: 2159 Computer access: user poduser 2 Compared to BIOS 443/643 and 646

More information

Transcriptome analysis

Transcriptome analysis Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize

More information

Human Genomics. Higher Human Biology

Human Genomics. Higher Human Biology Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary

More information

Assembly and Validation of Large Genomes from Short Reads Michael Schatz. March 16, 2011 Genome Assembly Workshop / Genome 10k

Assembly and Validation of Large Genomes from Short Reads Michael Schatz. March 16, 2011 Genome Assembly Workshop / Genome 10k Assembly and Validation of Large Genomes from Short Reads Michael Schatz March 16, 2011 Genome Assembly Workshop / Genome 10k A Brief Aside 4.7GB / disc ~20 discs / 1G Genome X 10,000 Genomes = 1PB Data

More information