Efficient dual sirna and drug delivery using engineered lipoproteoplexes

Size: px
Start display at page:

Download "Efficient dual sirna and drug delivery using engineered lipoproteoplexes"

Transcription

1 Supporting Information Efficient dual sirna and drug delivery using engineered lipoproteoplexes Che Fu Liu, Raymond Chen, Joseph A. Frezzo, Priya Katyal, Lindsay K. Hill, Liming Yin, Nikita Srivastava, Haresh T. More, P. Douglas Renfrew, ^ Richard Bonneau ^ and Jin Kim Montclare a Department of Chemical and Biomolecular Engineering, NYU Tandon School of Engineering, Brooklyn, New York 11201, United States Department of Biomedical Engineering, State University of New York Downstate Medical Center, Brooklyn, New York 11203, United States Department of Radiology, New York University School of Medicine, New York, New York 10016, United States Department of Chemistry, New York University, New York, New York 10003, United States a Department of Biochemistry, SUNY Downstate Medical Center, Brooklyn, New York 11203, United States Center for Genomics and Systems Biology, New York University, New York Courant Institute of Mathematical Sciences, Computer Science Department, New York University, New York, NY 10009, United States ^Center for Computational Biology, Flatiron Institute, Simons Foundation, th Avenue New York, NY 10010, United States These authors contributed equally Doxorubicin docking in CSP. In the ligand conformer generating protocols, a total of 552 doxorubicin conformers passed the filtering criteria and were used in the docking simulations (Figure S1a). Low energy docked models tended to cluster near the N-terminus of the CSP helical bundle. The lowest energy docking conformation is shown in Figure S1. It has a binding energy of Rosetta Energy Units indicating that the energy of the system is lower when the ligand is present and binding is favorable. Doxorubicin can form hydrogen bonds with THR40. The CSP backbone requires little movement to accommodate the ligand and the CA RMSD between the model and the experimentally determined structure is 0.1 Angstroms. 1

2 Figure S1. a) Predicted docked conformation of doxorubicin in the central channel of CSP pentamer. b) Low energy surface charge of CSP pentamer. 2

3 1 2 3 Figure S2. Expression of CSP on 12% SDS-PAGE. Lanes 1, Ladder, lane 2 preexpression and lane 3 post expression. Figure S3. Purification profiles on 12% SDS-PAGE. Lane 1: Ladder, lane 2: Flow through, lane 3: wash, lane 4: 100mM Imidazole elution, lane 5-6: 200mM imidazole Elution, lane 7-9: 500mM Imidazole elution and lane 10: 1M imidazole elution fractions. 3

4 Figure S4. Confocal microscopy of MCF-7 cells treated with (a, b) Dox CSP and (c,d) Dox L2000 4

5 Figure S5. Histograms plots depict original flow cytometry analysis of Dox Cy5-siRNA CSP L2000. The percent of cells containing Cy5-siRNA was calculated from (a), and within sirna bearing cells, percent of cells bearing dox was calculated from (b). Similarly, percent of cells containing Dox was calculated from (c), and within dox bearing cells, percent of cells containing Cy5-siRNA was calculated from (d). Note: the cells were treated with Dox and Cy5-siRNA in the presence of CSP and L

6 Table S1. Values for Cell Viability Study CSP & Dox Treatment Equivalent Dox Conc. Actual Dox Conc. Actual CSP Conc. Neg Ctrl CSP CSP CSP CSP CSP CSP Dox Dox Dox Dox Dox Dox Dox CSP Dox CSP Dox CSP Dox CSP Dox CSP Dox CSP

7 Table S2. Values for Cell Viability Study -L2000 & sirna Treatment Equivalent Dox Conc. Actual Dox Conc. Actual CSP Conc. L2000:CSP:siRNA (wt/wt) Neg Ctrl (Opti) L2000 Dox :8:1 L2000 Dox :8:1 L2000 Dox CSP :8:1 L2000 Dox CSP :8:1 L2000 sirna :8:1 L2000 sirna :8:1 L2000 sirna CSP :8:1 L2000 sirna CSP :8:1 L2000 sirna Dox CSP 0.4 L2000 sirna Dox CSP :8: :8:1 7

8 Table S3. Values for Cell Viability Study -L2000 & sirna Treatment Equivalent CSP Mass (µg) Actual CSP Mass (µg) Actual L2000 Mass (µg) Actual sirna Mass (µg) Neg Ctrl (Opti) L2000 Dox L2000 Dox L2000 Dox CSP L2000 Dox CSP L2000 sirna L2000 sirna L2000 sirna CSP L2000 sirna CSP L2000 sirna Dox CSP L2000 sirna Dox CSP

9 Figure S6. Relative cell viability of MCF-7 cells after 48 hours treatment with L2000 transfection reagent controls based on MTT assay, normalized to the negative control which consists only of EMEM, Opti-MEM, and 50 mm Tris-HCl, 0.5 M NaCl ph 8 buffer. Data represented is one trial. Error bars represent standard deviation across four replicates. 9

Protein Engineered Nanomaterials

Protein Engineered Nanomaterials Protein Engineered Nanomaterials The Webinar Will Begin at 1 PM Eastern Time Brought to you by: This Webinar Is Hosted By ATE Central acts as an information Hub for the National Science Foundation ATE

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2009 69451 Weinheim, Germany Reversible Cell-Specific Delivery of Chemotherapy Drugs Using Aptamer- Functionalized Liposomes Zehui Cao, 1 Rong Tong, 2 Abhijit Mishra, 2

More information

SUPPLEMENTARY MATERIALS

SUPPLEMENTARY MATERIALS Anti-SSTR2 peptide based targeted delivery of potent PLGA encapsulated 3,3 -diindolylmethane nanoparticles through blood brain barrier prevents glioma progression SUPPLEMENTARY MATERIALS Supplementary

More information

Supporting Information

Supporting Information Supporting Information Deng et al. 10.1073/pnas.1515692112 SI Materials and Methods FPLC. All fusion proteins were expressed and purified through a three-step FPLC purification protocol, as described (20),

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2015 Terbium-Based Time-Gated Förster Resonance Energy Transfer Imaging for Evaluating Protein-Protein

More information

Protein Purification using His-tag

Protein Purification using His-tag igem TU/e 2017 Biomedical Engineering Eindhoven University of Technology Den Dolech 2, 5612 AZ Eindhoven The Netherlands 2017.igem.org/Team:TU-Eindhoven Protein Purification using His-tag Table of contents

More information

DNA Analysis - Basic Tools and Techniques

DNA Analysis - Basic Tools and Techniques DNA Analysis - Basic Tools and Techniques Zlatko Liber University of Zagreb, Faculty of Science, Zagreb, Croatia Centre of Excellence for Biodiversity and Molecular Plant Breeding, Zagreb, Croatia E-mail:

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2017 Supporting Information Ball-in-ball ZrO 2 Nanostructure for Simultaneous CT Imaging and Highly

More information

Analysis of repetitive DNA in chromosomes by flow cytometry

Analysis of repetitive DNA in chromosomes by flow cytometry Nature Methods Analysis of repetitive DNA in chromosomes by flow cytometry Julie Brind Amour & Peter Lansdorp Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4

More information

Streptavidin HP SpinTrap Streptavidin HP MultiTrap Streptavidin HP SpinTrap Buffer Kit

Streptavidin HP SpinTrap Streptavidin HP MultiTrap Streptavidin HP SpinTrap Buffer Kit GE Healthcare Data File 28-9067-91 AB Protein Sample Preparation Streptavidin HP SpinTrap Streptavidin HP MultiTrap Streptavidin HP SpinTrap Buffer Kit Streptavidin HP SpinTrap and Streptavidin HP MultiTrap

More information

RNA-based, transient modulation of gene expression in human haematopoietic stem

RNA-based, transient modulation of gene expression in human haematopoietic stem Supplementary Information RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells Yvonne Diener 1, Marion Jurk 1, Britta Kandil 1, Yeong-Hoon Choi 2, Stefan

More information

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:

More information

Supporting Information

Supporting Information Supporting Information Polyserotonin Nanoparticles as Multifunctional Materials for Biomedical Applications Nako Nakatsuka, 1,2 Mohammad Mahdi Hasani-Sadrabadi, 1,2,3,4 Kevin M. Cheung, 1,2 Thomas D. Young,

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Protein G HP SpinTrap Protein G HP MultiTrap Protein A/G SpinTrap Buffer Kit

Protein G HP SpinTrap Protein G HP MultiTrap Protein A/G SpinTrap Buffer Kit GE Healthcare Data File 28-9067-90 AB Protein Sample Preparation Protein G HP SpinTrap Protein A/G SpinTrap Buffer Kit Protein G HP SpinTrap and (Fig 1) are designed for the enrichment of proteins of interest,

More information

PhyNexus. Technical Note

PhyNexus. Technical Note PhyNexus Technical Note Optimization Strategies for High Performance Purification and Analysis of Recombinant Proteins with Micro Volume PhyTip Columns and Caliper Life Sciences Automation Introduction

More information

Phenotypic lentivirus screens to identify functional single domain antibodies

Phenotypic lentivirus screens to identify functional single domain antibodies ARTICLE NUMBER: 16080 DOI: 10.1038/NMICROBIOL.2016.80 Phenotypic lentivirus screens to identify functional single domain antibodies Florian I. Schmidt, Leo Hanke, Benjamin Morin, Rebeccah Brewer, Vesna

More information

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means

More information

4/10/2011. Rosetta software package. Rosetta.. Conformational sampling and scoring of models in Rosetta.

4/10/2011. Rosetta software package. Rosetta.. Conformational sampling and scoring of models in Rosetta. Rosetta.. Ph.D. Thomas M. Frimurer Novo Nordisk Foundation Center for Potein Reseach Center for Basic Metabilic Research Breif introduction to Rosetta Rosetta docking example Rosetta software package Breif

More information

For Research Use Only. Not for use in diagnostic procedures.

For Research Use Only. Not for use in diagnostic procedures. Printed December 13, 2011 Version 1.0 For Research Use Only. Not for use in diagnostic procedures. DDDDK-tagged Protein PURIFICATION GEL with Elution Peptide (MoAb. clone FLA-1) CODE No. 3326 / 3327 PURIFICATION

More information

A fluorescent probe for cysteine depalmitoylation reveals dynamic APT signaling

A fluorescent probe for cysteine depalmitoylation reveals dynamic APT signaling SUPPLEMENTARY INFRMATIN A fluorescent probe for cysteine depalmitoylation reveals dynamic APT signaling Rahul S. Kathayat 1, Pablo D. Elvira 1, Bryan C. Dickinson 1 * 1 Department of Chemistry, The University

More information

Streptavidin Mag Sepharose

Streptavidin Mag Sepharose GE Healthcare Life Sciences Data file 28-9921-05 AB Protein sample preparation Streptavidin Mag Sepharose Streptavidin Mag Sepharose (Fig 1) is a magnetic bead for simple and efficient enrichment of target

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2579 Figure S1 Incorporation of heavy isotope-labeled amino acids and enrichment of di-glycine modified peptides. The incorporation of isotopelabeled amino acids in peptides was calculated

More information

Jan 25, 05 His Bind Kit (Novagen)

Jan 25, 05 His Bind Kit (Novagen) Jan 25, 05 His Bind Kit (Novagen) (1) Prepare 5ml of 1X Charge buffer (stock is 8X= 400mM NiSO4): 0.625ml of the stock + 4.375ml DH2O. (2) Prepare 13ml of 1X Binding buffer (stock is 8X = 40mM imidazole,

More information

A Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells

A Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)

More information

Detecting individual extracellular vesicles using a multicolor in situ proximity

Detecting individual extracellular vesicles using a multicolor in situ proximity Supplementary data Detecting individual extracellular vesicles using a multicolor in situ proximity ligation assay with flow cytometric readout Liza Löf a, Tonge Ebai a, Louise Dubois b, Lotta Wik a, K.

More information

Solutions to 7.02 Quiz II 10/27/05

Solutions to 7.02 Quiz II 10/27/05 Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover

More information

Supporting Information. A general chemiluminescence strategy. for measuring aptamer-target binding and target concentration

Supporting Information. A general chemiluminescence strategy. for measuring aptamer-target binding and target concentration Supporting Information A general chemiluminescence strategy for measuring aptamer-target binding and target concentration Shiyuan Li, Duyu Chen, Qingtong Zhou, Wei Wang, Lingfeng Gao, Jie Jiang, Haojun

More information

His Buffer Kit is intended for research use only, and should not be used in any clinical or in vitro procedures for diagnostic purposes.

His Buffer Kit is intended for research use only, and should not be used in any clinical or in vitro procedures for diagnostic purposes. GE Healthcare Instructions 28-4010-39 AC His Buffer Kit Intended use His Buffer Kit is intended for research use only, and should not be used in any clinical or in vitro procedures for diagnostic purposes.

More information

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,

More information

Convenient Purification of Monoclonal Antibodies using HiTrap rprotein A FF

Convenient Purification of Monoclonal Antibodies using HiTrap rprotein A FF GE Healthcare Convenient Purification of Monoclonal Antibodies using HiTrap rprotein A FF M. Carlsson, A. Heijbel, and A-C. Häggqvist GE Healthcare AB, Björkgatan 3, SE-751 84 Uppsala, Sweden Abstract

More information

5.2 Protein purification

5.2 Protein purification Purification of a His 6 -tagged Green Fluorescent Protein (GFP). Protein purification.. Purification of a His 6 -tagged Green Fluorescent Protein (GFP) Principle You can add either a N- or C-terminal His

More information

Resampling improves the efficiency of a fast-switch. equilibrium sampling protocol

Resampling improves the efficiency of a fast-switch. equilibrium sampling protocol Resampling improves the efficiency of a fast-switch equilibrium sampling protocol Edward Lyman * and Daniel M. Zuckerman * Center for Biophysical Modeling and Simulation, University of Utah, 315 S 1400

More information

Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach

Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach Cancer Cell, Volume 16 Supplemental Data Tissue-Penetrating Delivery of Compounds and Nanoparticles into Tumors Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach

More information

Protein G HP SpinTrap Protein G HP MultiTrap

Protein G HP SpinTrap Protein G HP MultiTrap GE Healthcare Data File 28-9067-90 AA Protein enrichment Protein G HP SpinTrap Protein G HP SpinTrap and toolkits (Fig 1) are prepacked, single-use spin columns and 96-well filter plates for the preparation

More information

Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng

Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng Department of Molecular Genetics, Biochemistry and Microbiology,

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

SERVA Ni-NTA Magnetic Beads

SERVA Ni-NTA Magnetic Beads INSTRUCTION MANUAL SERVA Ni-NTA Magnetic Beads Magnetic beads for Affinity Purification of His-Tag Fusion Proteins (Cat. No. 42179) SERVA Electrophoresis GmbH - Carl-Benz-Str. 7-69115 Heidelberg Phone

More information

Si Silencing Duplex. Advanced molecule designed for next-generation applications of RNAi.

Si Silencing Duplex. Advanced molecule designed for next-generation applications of RNAi. SM Now improved with: Si 2 Purfect TRANSFECTION REAGENT PROTOCOL: 2 Si Silencing Duplex Advanced molecule designed for next-generation applications of RNAi. Greater Specificity of Suppression Reliable

More information

Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells

Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin

More information

TECHNICAL BULLETIN. HIS-Select HF Nickel Affinity Gel. Catalog Number H0537 Storage Temperature 2 8 C

TECHNICAL BULLETIN. HIS-Select HF Nickel Affinity Gel. Catalog Number H0537 Storage Temperature 2 8 C HIS-Select HF Nickel Affinity Gel Catalog Number H0537 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description HIS-Select High Flow (HF) is an immobilized metal-ion affinity chromatography (IMAC)

More information

White Paper. Ion Exchange with PureSpeed Tips A Powerful Chromatography Tool

White Paper. Ion Exchange with PureSpeed Tips A Powerful Chromatography Tool Ion Exchange with PureSpeed Tips A Powerful Chromatography Tool Ion exchange chromatography separates molecules by exploiting differences in their overall charge characteristics. Its simplicity makes this

More information

Adenovirus upstream and downstream processing. Dr. Mats Lundgren GE Healthcare Life Sciences

Adenovirus upstream and downstream processing. Dr. Mats Lundgren GE Healthcare Life Sciences Adenovirus upstream and downstream processing Dr. Mats Lundgren GE Healthcare Life Sciences Introduction Viral Vectors Number of 2016 active trials clinical phases globally 170 Clinical trials by main

More information

Single-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition

Single-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition SUPPLEMENTARY INFORMATION Single-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition Mari-Liis Visnapuu 1 and Eric C. Greene 1 1 Department of Biochemistry &

More information

Supplementary information for Small molecule inhibitors block Gas6-inducible TAM activation and tumorigenicity

Supplementary information for Small molecule inhibitors block Gas6-inducible TAM activation and tumorigenicity Supplementary information for Small molecule inhibitors block Gas6-inducible TAM activation and tumorigenicity Stanley G. Kimani 1 *, Sushil Kumar 1 *, Nitu Bansal 2 *, Kamalendra Singh 3, Vladyslav Kholodovych

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3 ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Conformational landscapes of DNA polymerase I and mutator derivatives establish fidelity checkpoints for nucleotide insertion Hohlbein et al. 1 Supplementary Figure S1. Wt

More information

Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez

Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez DNA sequences Strand Sequence 1- GGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGG

More information

Avalanche -Everyday Transfection Reagent

Avalanche -Everyday Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Everyday Transfection Reagent Cat. No. EZT-EVDY-1 Description Size: 0.75 ml 1.5 ml Store at 4 C As the simplified version of our most popular and powerful

More information

Low Background D-A-D Type Fluorescent Probe for Imaging of Biothiols

Low Background D-A-D Type Fluorescent Probe for Imaging of Biothiols Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Electronic supplementary information Low Background D-A-D Type Fluorescent

More information

Using a BioCel System and AssayMap Technology in Phage Display and Antibody Screening. Jason Graves September 20, 2011 AAS User Group Meeting

Using a BioCel System and AssayMap Technology in Phage Display and Antibody Screening. Jason Graves September 20, 2011 AAS User Group Meeting Using a BioCel System and AssayMap Technology in Phage Display and Antibody Screening Jason Graves September 20, 2011 AAS User Group Meeting My Background 15 Years of Automation and Related Experience

More information

Supporting Information

Supporting Information Supporting Information Se/Ru-decorated Porous Metal-Organic Framework Nanoparticles for The Delivery of Pooled sirnas to Reversing Multidrug Resistance in Taxol-resistant Breast Cancer Cells Qingchang

More information

What is an Aptamer? smallest unit of repeating structure

What is an Aptamer? smallest unit of repeating structure What is an Aptamer? apto: mer: to fit smallest unit of repeating structure Aptamers are single stranded folded oligonucleotides that bind to molecular (protein) targets with high affinity and specificity

More information

MBP Excellose handbook - Purification of MBP fusion proteins -

MBP Excellose handbook - Purification of MBP fusion proteins - Introduction MBP Excellose handbook - Purification of MBP fusion proteins - MBP Excellose is a affinity chromatography medium used for simple and rapid purification of MBP (maltose binding protein) fusion

More information

Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid

Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid Supplementary Figures Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid sequence of Drosophila RCC1. Same colors are for Figure 1 with sequence of β-wedge that interacts with Ran in

More information

Nature Methods Optimal enzymes for amplifying sequencing libraries

Nature Methods Optimal enzymes for amplifying sequencing libraries Nature Methods Optimal enzymes for amplifying sequencing libraries Michael A Quail, Thomas D Otto, Yong Gu, Simon R Harris, Thomas F Skelly, Jacqueline A McQuillan, Harold P Swerdlow & Samuel O Oyola Supplementary

More information

Supplementary Information. Single-molecule analysis reveals multi-state folding of a guanine. riboswitch

Supplementary Information. Single-molecule analysis reveals multi-state folding of a guanine. riboswitch Supplementary Information Single-molecule analysis reveals multi-state folding of a guanine riboswitch Vishnu Chandra 1,4,#, Zain Hannan 1,5,#, Huizhong Xu 2,# and Maumita Mandal 1,2,3,6* Department of

More information

Supplementary Figure 1. Electron microscopy of gb-698glyco/1g2 Fab complex. a)

Supplementary Figure 1. Electron microscopy of gb-698glyco/1g2 Fab complex. a) Supplementary Figure 1. Electron microscopy of gb-698glyco/1g2 Fab complex. a) Representative images of 2D class averages of gb-698glyc bound to 1G2 Fab. Top views of the complex were underrepresented

More information

Antimicrobial Susceptibility Testing by Using Virulent

Antimicrobial Susceptibility Testing by Using Virulent Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2018 Supporting Information for Antimicrobial Susceptibility Testing by Using Virulent Phages

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

sirna Transfection Reagent

sirna Transfection Reagent Description RiboJuice 0.3 ml 71115-3 1.0 ml 71115-4 Description RiboJuice efficiently delivers small interfering RNA (sirna) into a wide range of mammalian cell lines for targeted gene suppression (1).

More information

Improved Chemistry for NGS Library Cleanup and Size Selection Speakers: Charles Cowles, PhD & Curtis Knox

Improved Chemistry for NGS Library Cleanup and Size Selection Speakers: Charles Cowles, PhD & Curtis Knox Improved Chemistry for NGS Library Cleanup and Size Selection Speakers: Charles Cowles, PhD & Curtis Knox Promega Corporation Agenda What is size-selective purification and how is it used? Why is there

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

Deep sequencing reveals global patterns of mrna recruitment

Deep sequencing reveals global patterns of mrna recruitment Supplementary information for: Deep sequencing reveals global patterns of mrna recruitment during translation initiation Rong Gao 1#*, Kai Yu 1#, Ju-Kui Nie 1,Teng-Fei Lian 1, Jian-Shi Jin 1, Anders Liljas

More information

Supporting Information. Self-constructing G-quadruplex From AGG Trinucleotide Repeats

Supporting Information. Self-constructing G-quadruplex From AGG Trinucleotide Repeats Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Supporting Information A Novel Nucleic Acid Aptamer Tag: A Rapid Fluorescent Strategy Using A Self-constructing

More information

Application Note 18 RNA/DNA/Protein Sample Preparation METHODS AND MATERIALS INTRODUCTION

Application Note 18 RNA/DNA/Protein Sample Preparation METHODS AND MATERIALS INTRODUCTION Application Note 18 /DNA/Protein Sample Preparation Sequential Purification of, DNA and Protein from a Single Sample using 's /DNA/Protein Purification Kit and Comparison to a Market B. Lam, PhD 1, C.

More information

Structure determination and activity manipulation of the turfgrass ABA receptor FePYR1

Structure determination and activity manipulation of the turfgrass ABA receptor FePYR1 Supplemental information for: Structure determination and activity manipulation of the turfgrass AA receptor FePYR1 Zhizhong Ren 1, 2,#, Zhen Wang 1, 2,#, X Edward Zhou 3, Huazhong Shi 4, Yechun Hong 1,

More information

Use of ScreenExpert RoboColumns u

Use of ScreenExpert RoboColumns u Application Note USD 99 Use of ScreenExpert RoboColumns u for High Throughput Study of Loading Conditions on HyperCel STAR AX and MEP HyperCel Sorbents for MAb Purification in Flow-Through Mode Summary

More information

Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter)

Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter) Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter) HIS-Select HF Nickel Affinity Gel Catalog Number H0537 Automation Guide 2 I. Description 2

More information

Protein Structure Prediction

Protein Structure Prediction Homology Modeling Protein Structure Prediction Ingo Ruczinski M T S K G G G Y F F Y D E L Y G V V V V L I V L S D E S Department of Biostatistics, Johns Hopkins University Fold Recognition b Initio Structure

More information

SUPPLEMENTARY INFORMATION. Design and Characterization of Bivalent BET Inhibitors

SUPPLEMENTARY INFORMATION. Design and Characterization of Bivalent BET Inhibitors SUPPLEMENTARY INFORMATION Design and Characterization of Bivalent BET Inhibitors Minoru Tanaka 1,2,#, Justin M. Roberts 1,#, Hyuk-Soo Seo 3, Amanda Souza 1, Joshiawa Paulk 1, Thomas G. Scott 1, Stephen

More information

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Ruud Hulspas 1 UNIT 6.29 1 Cytonome/ST, Boston, Massachusetts ABSTRACT Nonspecific antibody binding is best

More information

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended

More information

Nonspecific binding of 10 nm Cy5-labeled DinB on nine different surfaces, measured by the number of DinB spots over an imaging area of 2,500 µm 2.

Nonspecific binding of 10 nm Cy5-labeled DinB on nine different surfaces, measured by the number of DinB spots over an imaging area of 2,500 µm 2. Supplementary Figure 1 Nonspecific binding of 10 nm Cy5-labeled DinB on nine different surfaces, measured by the number of DinB spots over an imaging area of 2,500 µm 2. Free DinB was washed out using

More information

Supplementary Infomation

Supplementary Infomation Supplementary Infomation Mycobacterium avium MAV2054 protein induces macrophage apoptosis through targeting to mitochondria and reduces intracellular growth of the bacteria. Kang-In Lee 1,2, Jake Whang

More information

TECHNICAL BULLETIN. Ni-CAM HC Resin High Capacity Nickel Chelate Affinity Matrix. Product No. N 3158 Storage Temperature 2 8 C

TECHNICAL BULLETIN. Ni-CAM HC Resin High Capacity Nickel Chelate Affinity Matrix. Product No. N 3158 Storage Temperature 2 8 C Ni-CAM HC Resin High Capacity Nickel Chelate Affinity Matrix Product No. N 3158 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description Ni-CAM affinity resin (Ni-CAM) is an immobilized metal-ion

More information

Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9

Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9 Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,

More information

It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue

It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue Douglas Horejsh January 2015 Discussion Outline Non-coding RNA General Overview mirna What is it? The Future

More information

Tools and solutions for separation of charged mab variants

Tools and solutions for separation of charged mab variants GE Healthcare Tools and solutions for separation of charged mab variants A biosimilar is an almost identical version of an originator product, but to attain regulatory approval, a comparable quality to

More information

MagExtactor -His-tag-

MagExtactor -His-tag- Instruction manual MagExtractor-His-tag-0905 F0987K MagExtactor -His-tag- Contents NPK-701 100 preparations Store at Store at 4 C [1] Introduction [2] Components [3] Materials required [4] Protocol3 1.

More information

Nickel Chelating Resin Spin Columns

Nickel Chelating Resin Spin Columns 326PR-02 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Nickel Chelating Resin Spin Columns A Ni-IDA IMAC resin for 6X-His Tagged Protein

More information

Supporting Information

Supporting Information Supporting Information Ni/NiO Core/shell Nanoparticles for Selective Binding and Magnetic Separation of Histidine-Tagged Proteins In Su Lee,, No Hyun Lee,, Jongnam Park,, Byung Hyo Kim,, Yong-Weon Yi,

More information

PAPER PRESENTATION BY KAMALESH

PAPER PRESENTATION BY KAMALESH PAPER PRESENTATION BY KAMALESH DATE 3 AUGUST, 2009 Gold, Poly(β-amino ester) Nanoparticles for Small Interfering RNA Delivery Nano Lett., Vol. 9, No. 6, 2009, 2402 2406 Jae Seung Lee, Jordan J. Green,

More information

Nature Methods: doi: /nmeth.4396

Nature Methods: doi: /nmeth.4396 Supplementary Figure 1 Comparison of technical replicate consistency between and across the standard ATAC-seq method, DNase-seq, and Omni-ATAC. (a) Heatmap-based representation of ATAC-seq quality control

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

Immobilized Streptavidin Resin

Immobilized Streptavidin Resin 438PR-01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Immobilized Streptavidin Resin (Cat. # 786-390, 786-590, 786-591, 786-592) think

More information

A sensitive direct human telomerase activity assay Scott B Cohen & Roger R Reddel

A sensitive direct human telomerase activity assay Scott B Cohen & Roger R Reddel A sensitive direct human telomerase activity assay Scott B Cohen & Roger R Reddel Supplementary figure and text: Supplementary Figure 1 Titration of the sheep polyclonal htert antibody. Supplementary Methods

More information

PHF20 is an effector protein of p53 double lysine methylation

PHF20 is an effector protein of p53 double lysine methylation SUPPLEMENTARY INFORMATION PHF20 is an effector protein of p53 double lysine methylation that stabilizes and activates p53 Gaofeng Cui 1, Sungman Park 2, Aimee I Badeaux 3, Donghwa Kim 2, Joseph Lee 1,

More information

(Supplementary Methods online)

(Supplementary Methods online) (Supplementary Methods online) Production and purification of either LC-antisense or control molecules Recombinant phagemids and the phagemid vector were transformed into XL-1 Blue competent bacterial

More information

X-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction

X-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction X-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction Tomohisa Shimasaki 1, Hiromi Yoshida 2, Shigehiro Kamitori 2 & Koji

More information

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra GE Healthcare Data file 28-9768-1 AA Protein sample preparation Protein A Mag Sepharose Xtra Xtra products are magnetic beads designed for efficient, high capacity small-scale purification/screening of

More information

Efficient Multi-Well Protein Purification Strategies

Efficient Multi-Well Protein Purification Strategies Application Note PN 33576 Efficient Multi-Well Protein Purification Strategies Introduction Many tools and techniques are available today for protein purification. Development of a purification process

More information

Product. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin

Product. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin Novagen offers a large variety of affinity supports and kits for the purification of recombinant proteins containing popular peptide fusion tags, including His Tag, GST Tag, S Tag and T7 Tag sequences.

More information

Aims: -Purification of a specific protein. -Study of protein-protein interactions

Aims: -Purification of a specific protein. -Study of protein-protein interactions Aims: -Purification of a specific protein -Study of protein-protein interactions This is a reliable method for purifying total IgG from crude protein mixtures such as serum. Protein A (linked to resin

More information

CURRICULUM VITAE Natalya Voloshchuk, Ph.D.

CURRICULUM VITAE Natalya Voloshchuk, Ph.D. CURRICULUM VITAE Natalya Voloshchuk, Ph.D. CONTACT INFORMATION Address: Department of Biochemistry and Microbiology School of Environmental and Biological Sciences Rutgers, The State University of New

More information

Avalanche -Everyday Transfection Reagent

Avalanche -Everyday Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Everyday Transfection Reagent Cat. No. EZT-EVDY-1 Description Size: 0.75 ml 1.5 ml Store at 4 C As the simplified version of our most popular and powerful

More information

Figure 1: E. Coli lysate transfer using liquid handling automation

Figure 1: E. Coli lysate transfer using liquid handling automation Figure 1: E. Coli lysate transfer using liquid handling automation Figure 1 - E. coli lysate transfer using liquid handling automation. Following the manufacturer s procedures, a 96-well plate miniprep

More information