Efficient dual sirna and drug delivery using engineered lipoproteoplexes
|
|
- Charity Griffin
- 5 years ago
- Views:
Transcription
1 Supporting Information Efficient dual sirna and drug delivery using engineered lipoproteoplexes Che Fu Liu, Raymond Chen, Joseph A. Frezzo, Priya Katyal, Lindsay K. Hill, Liming Yin, Nikita Srivastava, Haresh T. More, P. Douglas Renfrew, ^ Richard Bonneau ^ and Jin Kim Montclare a Department of Chemical and Biomolecular Engineering, NYU Tandon School of Engineering, Brooklyn, New York 11201, United States Department of Biomedical Engineering, State University of New York Downstate Medical Center, Brooklyn, New York 11203, United States Department of Radiology, New York University School of Medicine, New York, New York 10016, United States Department of Chemistry, New York University, New York, New York 10003, United States a Department of Biochemistry, SUNY Downstate Medical Center, Brooklyn, New York 11203, United States Center for Genomics and Systems Biology, New York University, New York Courant Institute of Mathematical Sciences, Computer Science Department, New York University, New York, NY 10009, United States ^Center for Computational Biology, Flatiron Institute, Simons Foundation, th Avenue New York, NY 10010, United States These authors contributed equally Doxorubicin docking in CSP. In the ligand conformer generating protocols, a total of 552 doxorubicin conformers passed the filtering criteria and were used in the docking simulations (Figure S1a). Low energy docked models tended to cluster near the N-terminus of the CSP helical bundle. The lowest energy docking conformation is shown in Figure S1. It has a binding energy of Rosetta Energy Units indicating that the energy of the system is lower when the ligand is present and binding is favorable. Doxorubicin can form hydrogen bonds with THR40. The CSP backbone requires little movement to accommodate the ligand and the CA RMSD between the model and the experimentally determined structure is 0.1 Angstroms. 1
2 Figure S1. a) Predicted docked conformation of doxorubicin in the central channel of CSP pentamer. b) Low energy surface charge of CSP pentamer. 2
3 1 2 3 Figure S2. Expression of CSP on 12% SDS-PAGE. Lanes 1, Ladder, lane 2 preexpression and lane 3 post expression. Figure S3. Purification profiles on 12% SDS-PAGE. Lane 1: Ladder, lane 2: Flow through, lane 3: wash, lane 4: 100mM Imidazole elution, lane 5-6: 200mM imidazole Elution, lane 7-9: 500mM Imidazole elution and lane 10: 1M imidazole elution fractions. 3
4 Figure S4. Confocal microscopy of MCF-7 cells treated with (a, b) Dox CSP and (c,d) Dox L2000 4
5 Figure S5. Histograms plots depict original flow cytometry analysis of Dox Cy5-siRNA CSP L2000. The percent of cells containing Cy5-siRNA was calculated from (a), and within sirna bearing cells, percent of cells bearing dox was calculated from (b). Similarly, percent of cells containing Dox was calculated from (c), and within dox bearing cells, percent of cells containing Cy5-siRNA was calculated from (d). Note: the cells were treated with Dox and Cy5-siRNA in the presence of CSP and L
6 Table S1. Values for Cell Viability Study CSP & Dox Treatment Equivalent Dox Conc. Actual Dox Conc. Actual CSP Conc. Neg Ctrl CSP CSP CSP CSP CSP CSP Dox Dox Dox Dox Dox Dox Dox CSP Dox CSP Dox CSP Dox CSP Dox CSP Dox CSP
7 Table S2. Values for Cell Viability Study -L2000 & sirna Treatment Equivalent Dox Conc. Actual Dox Conc. Actual CSP Conc. L2000:CSP:siRNA (wt/wt) Neg Ctrl (Opti) L2000 Dox :8:1 L2000 Dox :8:1 L2000 Dox CSP :8:1 L2000 Dox CSP :8:1 L2000 sirna :8:1 L2000 sirna :8:1 L2000 sirna CSP :8:1 L2000 sirna CSP :8:1 L2000 sirna Dox CSP 0.4 L2000 sirna Dox CSP :8: :8:1 7
8 Table S3. Values for Cell Viability Study -L2000 & sirna Treatment Equivalent CSP Mass (µg) Actual CSP Mass (µg) Actual L2000 Mass (µg) Actual sirna Mass (µg) Neg Ctrl (Opti) L2000 Dox L2000 Dox L2000 Dox CSP L2000 Dox CSP L2000 sirna L2000 sirna L2000 sirna CSP L2000 sirna CSP L2000 sirna Dox CSP L2000 sirna Dox CSP
9 Figure S6. Relative cell viability of MCF-7 cells after 48 hours treatment with L2000 transfection reagent controls based on MTT assay, normalized to the negative control which consists only of EMEM, Opti-MEM, and 50 mm Tris-HCl, 0.5 M NaCl ph 8 buffer. Data represented is one trial. Error bars represent standard deviation across four replicates. 9
Protein Engineered Nanomaterials
Protein Engineered Nanomaterials The Webinar Will Begin at 1 PM Eastern Time Brought to you by: This Webinar Is Hosted By ATE Central acts as an information Hub for the National Science Foundation ATE
More informationSupporting Information
Supporting Information Wiley-VCH 2009 69451 Weinheim, Germany Reversible Cell-Specific Delivery of Chemotherapy Drugs Using Aptamer- Functionalized Liposomes Zehui Cao, 1 Rong Tong, 2 Abhijit Mishra, 2
More informationSUPPLEMENTARY MATERIALS
Anti-SSTR2 peptide based targeted delivery of potent PLGA encapsulated 3,3 -diindolylmethane nanoparticles through blood brain barrier prevents glioma progression SUPPLEMENTARY MATERIALS Supplementary
More informationSupporting Information
Supporting Information Deng et al. 10.1073/pnas.1515692112 SI Materials and Methods FPLC. All fusion proteins were expressed and purified through a three-step FPLC purification protocol, as described (20),
More informationSUPPORTING INFORMATION
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2015 Terbium-Based Time-Gated Förster Resonance Energy Transfer Imaging for Evaluating Protein-Protein
More informationProtein Purification using His-tag
igem TU/e 2017 Biomedical Engineering Eindhoven University of Technology Den Dolech 2, 5612 AZ Eindhoven The Netherlands 2017.igem.org/Team:TU-Eindhoven Protein Purification using His-tag Table of contents
More informationDNA Analysis - Basic Tools and Techniques
DNA Analysis - Basic Tools and Techniques Zlatko Liber University of Zagreb, Faculty of Science, Zagreb, Croatia Centre of Excellence for Biodiversity and Molecular Plant Breeding, Zagreb, Croatia E-mail:
More informationSupporting Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2017 Supporting Information Ball-in-ball ZrO 2 Nanostructure for Simultaneous CT Imaging and Highly
More informationAnalysis of repetitive DNA in chromosomes by flow cytometry
Nature Methods Analysis of repetitive DNA in chromosomes by flow cytometry Julie Brind Amour & Peter Lansdorp Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4
More informationStreptavidin HP SpinTrap Streptavidin HP MultiTrap Streptavidin HP SpinTrap Buffer Kit
GE Healthcare Data File 28-9067-91 AB Protein Sample Preparation Streptavidin HP SpinTrap Streptavidin HP MultiTrap Streptavidin HP SpinTrap Buffer Kit Streptavidin HP SpinTrap and Streptavidin HP MultiTrap
More informationRNA-based, transient modulation of gene expression in human haematopoietic stem
Supplementary Information RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells Yvonne Diener 1, Marion Jurk 1, Britta Kandil 1, Yeong-Hoon Choi 2, Stefan
More informationphab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation
phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:
More informationSupporting Information
Supporting Information Polyserotonin Nanoparticles as Multifunctional Materials for Biomedical Applications Nako Nakatsuka, 1,2 Mohammad Mahdi Hasani-Sadrabadi, 1,2,3,4 Kevin M. Cheung, 1,2 Thomas D. Young,
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationProtein G HP SpinTrap Protein G HP MultiTrap Protein A/G SpinTrap Buffer Kit
GE Healthcare Data File 28-9067-90 AB Protein Sample Preparation Protein G HP SpinTrap Protein A/G SpinTrap Buffer Kit Protein G HP SpinTrap and (Fig 1) are designed for the enrichment of proteins of interest,
More informationPhyNexus. Technical Note
PhyNexus Technical Note Optimization Strategies for High Performance Purification and Analysis of Recombinant Proteins with Micro Volume PhyTip Columns and Caliper Life Sciences Automation Introduction
More informationPhenotypic lentivirus screens to identify functional single domain antibodies
ARTICLE NUMBER: 16080 DOI: 10.1038/NMICROBIOL.2016.80 Phenotypic lentivirus screens to identify functional single domain antibodies Florian I. Schmidt, Leo Hanke, Benjamin Morin, Rebeccah Brewer, Vesna
More informationSupplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means
More information4/10/2011. Rosetta software package. Rosetta.. Conformational sampling and scoring of models in Rosetta.
Rosetta.. Ph.D. Thomas M. Frimurer Novo Nordisk Foundation Center for Potein Reseach Center for Basic Metabilic Research Breif introduction to Rosetta Rosetta docking example Rosetta software package Breif
More informationFor Research Use Only. Not for use in diagnostic procedures.
Printed December 13, 2011 Version 1.0 For Research Use Only. Not for use in diagnostic procedures. DDDDK-tagged Protein PURIFICATION GEL with Elution Peptide (MoAb. clone FLA-1) CODE No. 3326 / 3327 PURIFICATION
More informationA fluorescent probe for cysteine depalmitoylation reveals dynamic APT signaling
SUPPLEMENTARY INFRMATIN A fluorescent probe for cysteine depalmitoylation reveals dynamic APT signaling Rahul S. Kathayat 1, Pablo D. Elvira 1, Bryan C. Dickinson 1 * 1 Department of Chemistry, The University
More informationStreptavidin Mag Sepharose
GE Healthcare Life Sciences Data file 28-9921-05 AB Protein sample preparation Streptavidin Mag Sepharose Streptavidin Mag Sepharose (Fig 1) is a magnetic bead for simple and efficient enrichment of target
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2579 Figure S1 Incorporation of heavy isotope-labeled amino acids and enrichment of di-glycine modified peptides. The incorporation of isotopelabeled amino acids in peptides was calculated
More informationJan 25, 05 His Bind Kit (Novagen)
Jan 25, 05 His Bind Kit (Novagen) (1) Prepare 5ml of 1X Charge buffer (stock is 8X= 400mM NiSO4): 0.625ml of the stock + 4.375ml DH2O. (2) Prepare 13ml of 1X Binding buffer (stock is 8X = 40mM imidazole,
More informationA Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)
More informationDetecting individual extracellular vesicles using a multicolor in situ proximity
Supplementary data Detecting individual extracellular vesicles using a multicolor in situ proximity ligation assay with flow cytometric readout Liza Löf a, Tonge Ebai a, Louise Dubois b, Lotta Wik a, K.
More informationSolutions to 7.02 Quiz II 10/27/05
Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover
More informationSupporting Information. A general chemiluminescence strategy. for measuring aptamer-target binding and target concentration
Supporting Information A general chemiluminescence strategy for measuring aptamer-target binding and target concentration Shiyuan Li, Duyu Chen, Qingtong Zhou, Wei Wang, Lingfeng Gao, Jie Jiang, Haojun
More informationHis Buffer Kit is intended for research use only, and should not be used in any clinical or in vitro procedures for diagnostic purposes.
GE Healthcare Instructions 28-4010-39 AC His Buffer Kit Intended use His Buffer Kit is intended for research use only, and should not be used in any clinical or in vitro procedures for diagnostic purposes.
More informationDifferent Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,
More informationConvenient Purification of Monoclonal Antibodies using HiTrap rprotein A FF
GE Healthcare Convenient Purification of Monoclonal Antibodies using HiTrap rprotein A FF M. Carlsson, A. Heijbel, and A-C. Häggqvist GE Healthcare AB, Björkgatan 3, SE-751 84 Uppsala, Sweden Abstract
More information5.2 Protein purification
Purification of a His 6 -tagged Green Fluorescent Protein (GFP). Protein purification.. Purification of a His 6 -tagged Green Fluorescent Protein (GFP) Principle You can add either a N- or C-terminal His
More informationResampling improves the efficiency of a fast-switch. equilibrium sampling protocol
Resampling improves the efficiency of a fast-switch equilibrium sampling protocol Edward Lyman * and Daniel M. Zuckerman * Center for Biophysical Modeling and Simulation, University of Utah, 315 S 1400
More informationKazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach
Cancer Cell, Volume 16 Supplemental Data Tissue-Penetrating Delivery of Compounds and Nanoparticles into Tumors Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach
More informationProtein G HP SpinTrap Protein G HP MultiTrap
GE Healthcare Data File 28-9067-90 AA Protein enrichment Protein G HP SpinTrap Protein G HP SpinTrap and toolkits (Fig 1) are prepacked, single-use spin columns and 96-well filter plates for the preparation
More informationAnalysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng
Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng Department of Molecular Genetics, Biochemistry and Microbiology,
More informationpdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
More informationSERVA Ni-NTA Magnetic Beads
INSTRUCTION MANUAL SERVA Ni-NTA Magnetic Beads Magnetic beads for Affinity Purification of His-Tag Fusion Proteins (Cat. No. 42179) SERVA Electrophoresis GmbH - Carl-Benz-Str. 7-69115 Heidelberg Phone
More informationSi Silencing Duplex. Advanced molecule designed for next-generation applications of RNAi.
SM Now improved with: Si 2 Purfect TRANSFECTION REAGENT PROTOCOL: 2 Si Silencing Duplex Advanced molecule designed for next-generation applications of RNAi. Greater Specificity of Suppression Reliable
More informationSupplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells
Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,
More informationSUPPLEMENTARY INFORMATION
VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin
More informationTECHNICAL BULLETIN. HIS-Select HF Nickel Affinity Gel. Catalog Number H0537 Storage Temperature 2 8 C
HIS-Select HF Nickel Affinity Gel Catalog Number H0537 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description HIS-Select High Flow (HF) is an immobilized metal-ion affinity chromatography (IMAC)
More informationWhite Paper. Ion Exchange with PureSpeed Tips A Powerful Chromatography Tool
Ion Exchange with PureSpeed Tips A Powerful Chromatography Tool Ion exchange chromatography separates molecules by exploiting differences in their overall charge characteristics. Its simplicity makes this
More informationAdenovirus upstream and downstream processing. Dr. Mats Lundgren GE Healthcare Life Sciences
Adenovirus upstream and downstream processing Dr. Mats Lundgren GE Healthcare Life Sciences Introduction Viral Vectors Number of 2016 active trials clinical phases globally 170 Clinical trials by main
More informationSingle-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition
SUPPLEMENTARY INFORMATION Single-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition Mari-Liis Visnapuu 1 and Eric C. Greene 1 1 Department of Biochemistry &
More informationSupplementary information for Small molecule inhibitors block Gas6-inducible TAM activation and tumorigenicity
Supplementary information for Small molecule inhibitors block Gas6-inducible TAM activation and tumorigenicity Stanley G. Kimani 1 *, Sushil Kumar 1 *, Nitu Bansal 2 *, Kamalendra Singh 3, Vladyslav Kholodovych
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationTranscriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
More informationSupplementary Information for
Supplementary Information for Conformational landscapes of DNA polymerase I and mutator derivatives establish fidelity checkpoints for nucleotide insertion Hohlbein et al. 1 Supplementary Figure S1. Wt
More informationSupporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez
Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez DNA sequences Strand Sequence 1- GGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGG
More informationAvalanche -Everyday Transfection Reagent
The Transfection & Gene Expression Experts Avalanche -Everyday Transfection Reagent Cat. No. EZT-EVDY-1 Description Size: 0.75 ml 1.5 ml Store at 4 C As the simplified version of our most popular and powerful
More informationLow Background D-A-D Type Fluorescent Probe for Imaging of Biothiols
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Electronic supplementary information Low Background D-A-D Type Fluorescent
More informationUsing a BioCel System and AssayMap Technology in Phage Display and Antibody Screening. Jason Graves September 20, 2011 AAS User Group Meeting
Using a BioCel System and AssayMap Technology in Phage Display and Antibody Screening Jason Graves September 20, 2011 AAS User Group Meeting My Background 15 Years of Automation and Related Experience
More informationSupporting Information
Supporting Information Se/Ru-decorated Porous Metal-Organic Framework Nanoparticles for The Delivery of Pooled sirnas to Reversing Multidrug Resistance in Taxol-resistant Breast Cancer Cells Qingchang
More informationWhat is an Aptamer? smallest unit of repeating structure
What is an Aptamer? apto: mer: to fit smallest unit of repeating structure Aptamers are single stranded folded oligonucleotides that bind to molecular (protein) targets with high affinity and specificity
More informationMBP Excellose handbook - Purification of MBP fusion proteins -
Introduction MBP Excellose handbook - Purification of MBP fusion proteins - MBP Excellose is a affinity chromatography medium used for simple and rapid purification of MBP (maltose binding protein) fusion
More informationSuppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid
Supplementary Figures Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid sequence of Drosophila RCC1. Same colors are for Figure 1 with sequence of β-wedge that interacts with Ran in
More informationNature Methods Optimal enzymes for amplifying sequencing libraries
Nature Methods Optimal enzymes for amplifying sequencing libraries Michael A Quail, Thomas D Otto, Yong Gu, Simon R Harris, Thomas F Skelly, Jacqueline A McQuillan, Harold P Swerdlow & Samuel O Oyola Supplementary
More informationSupplementary Information. Single-molecule analysis reveals multi-state folding of a guanine. riboswitch
Supplementary Information Single-molecule analysis reveals multi-state folding of a guanine riboswitch Vishnu Chandra 1,4,#, Zain Hannan 1,5,#, Huizhong Xu 2,# and Maumita Mandal 1,2,3,6* Department of
More informationSupplementary Figure 1. Electron microscopy of gb-698glyco/1g2 Fab complex. a)
Supplementary Figure 1. Electron microscopy of gb-698glyco/1g2 Fab complex. a) Representative images of 2D class averages of gb-698glyc bound to 1G2 Fab. Top views of the complex were underrepresented
More informationAntimicrobial Susceptibility Testing by Using Virulent
Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2018 Supporting Information for Antimicrobial Susceptibility Testing by Using Virulent Phages
More informationSupplementary methods
Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into
More informationsirna Transfection Reagent
Description RiboJuice 0.3 ml 71115-3 1.0 ml 71115-4 Description RiboJuice efficiently delivers small interfering RNA (sirna) into a wide range of mammalian cell lines for targeted gene suppression (1).
More informationImproved Chemistry for NGS Library Cleanup and Size Selection Speakers: Charles Cowles, PhD & Curtis Knox
Improved Chemistry for NGS Library Cleanup and Size Selection Speakers: Charles Cowles, PhD & Curtis Knox Promega Corporation Agenda What is size-selective purification and how is it used? Why is there
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationDeep sequencing reveals global patterns of mrna recruitment
Supplementary information for: Deep sequencing reveals global patterns of mrna recruitment during translation initiation Rong Gao 1#*, Kai Yu 1#, Ju-Kui Nie 1,Teng-Fei Lian 1, Jian-Shi Jin 1, Anders Liljas
More informationSupporting Information. Self-constructing G-quadruplex From AGG Trinucleotide Repeats
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Supporting Information A Novel Nucleic Acid Aptamer Tag: A Rapid Fluorescent Strategy Using A Self-constructing
More informationApplication Note 18 RNA/DNA/Protein Sample Preparation METHODS AND MATERIALS INTRODUCTION
Application Note 18 /DNA/Protein Sample Preparation Sequential Purification of, DNA and Protein from a Single Sample using 's /DNA/Protein Purification Kit and Comparison to a Market B. Lam, PhD 1, C.
More informationStructure determination and activity manipulation of the turfgrass ABA receptor FePYR1
Supplemental information for: Structure determination and activity manipulation of the turfgrass AA receptor FePYR1 Zhizhong Ren 1, 2,#, Zhen Wang 1, 2,#, X Edward Zhou 3, Huazhong Shi 4, Yechun Hong 1,
More informationUse of ScreenExpert RoboColumns u
Application Note USD 99 Use of ScreenExpert RoboColumns u for High Throughput Study of Loading Conditions on HyperCel STAR AX and MEP HyperCel Sorbents for MAb Purification in Flow-Through Mode Summary
More informationAutomated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter)
Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter) HIS-Select HF Nickel Affinity Gel Catalog Number H0537 Automation Guide 2 I. Description 2
More informationProtein Structure Prediction
Homology Modeling Protein Structure Prediction Ingo Ruczinski M T S K G G G Y F F Y D E L Y G V V V V L I V L S D E S Department of Biostatistics, Johns Hopkins University Fold Recognition b Initio Structure
More informationSUPPLEMENTARY INFORMATION. Design and Characterization of Bivalent BET Inhibitors
SUPPLEMENTARY INFORMATION Design and Characterization of Bivalent BET Inhibitors Minoru Tanaka 1,2,#, Justin M. Roberts 1,#, Hyuk-Soo Seo 3, Amanda Souza 1, Joshiawa Paulk 1, Thomas G. Scott 1, Stephen
More informationTitration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells
Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Ruud Hulspas 1 UNIT 6.29 1 Cytonome/ST, Boston, Massachusetts ABSTRACT Nonspecific antibody binding is best
More informationApoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium
Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended
More informationNonspecific binding of 10 nm Cy5-labeled DinB on nine different surfaces, measured by the number of DinB spots over an imaging area of 2,500 µm 2.
Supplementary Figure 1 Nonspecific binding of 10 nm Cy5-labeled DinB on nine different surfaces, measured by the number of DinB spots over an imaging area of 2,500 µm 2. Free DinB was washed out using
More informationSupplementary Infomation
Supplementary Infomation Mycobacterium avium MAV2054 protein induces macrophage apoptosis through targeting to mitochondria and reduces intracellular growth of the bacteria. Kang-In Lee 1,2, Jake Whang
More informationTECHNICAL BULLETIN. Ni-CAM HC Resin High Capacity Nickel Chelate Affinity Matrix. Product No. N 3158 Storage Temperature 2 8 C
Ni-CAM HC Resin High Capacity Nickel Chelate Affinity Matrix Product No. N 3158 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description Ni-CAM affinity resin (Ni-CAM) is an immobilized metal-ion
More informationFigure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9
Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,
More informationIt s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue
It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue Douglas Horejsh January 2015 Discussion Outline Non-coding RNA General Overview mirna What is it? The Future
More informationTools and solutions for separation of charged mab variants
GE Healthcare Tools and solutions for separation of charged mab variants A biosimilar is an almost identical version of an originator product, but to attain regulatory approval, a comparable quality to
More informationMagExtactor -His-tag-
Instruction manual MagExtractor-His-tag-0905 F0987K MagExtactor -His-tag- Contents NPK-701 100 preparations Store at Store at 4 C [1] Introduction [2] Components [3] Materials required [4] Protocol3 1.
More informationNickel Chelating Resin Spin Columns
326PR-02 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Nickel Chelating Resin Spin Columns A Ni-IDA IMAC resin for 6X-His Tagged Protein
More informationSupporting Information
Supporting Information Ni/NiO Core/shell Nanoparticles for Selective Binding and Magnetic Separation of Histidine-Tagged Proteins In Su Lee,, No Hyun Lee,, Jongnam Park,, Byung Hyo Kim,, Yong-Weon Yi,
More informationPAPER PRESENTATION BY KAMALESH
PAPER PRESENTATION BY KAMALESH DATE 3 AUGUST, 2009 Gold, Poly(β-amino ester) Nanoparticles for Small Interfering RNA Delivery Nano Lett., Vol. 9, No. 6, 2009, 2402 2406 Jae Seung Lee, Jordan J. Green,
More informationNature Methods: doi: /nmeth.4396
Supplementary Figure 1 Comparison of technical replicate consistency between and across the standard ATAC-seq method, DNase-seq, and Omni-ATAC. (a) Heatmap-based representation of ATAC-seq quality control
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationImmobilized Streptavidin Resin
438PR-01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Immobilized Streptavidin Resin (Cat. # 786-390, 786-590, 786-591, 786-592) think
More informationA sensitive direct human telomerase activity assay Scott B Cohen & Roger R Reddel
A sensitive direct human telomerase activity assay Scott B Cohen & Roger R Reddel Supplementary figure and text: Supplementary Figure 1 Titration of the sheep polyclonal htert antibody. Supplementary Methods
More informationPHF20 is an effector protein of p53 double lysine methylation
SUPPLEMENTARY INFORMATION PHF20 is an effector protein of p53 double lysine methylation that stabilizes and activates p53 Gaofeng Cui 1, Sungman Park 2, Aimee I Badeaux 3, Donghwa Kim 2, Joseph Lee 1,
More information(Supplementary Methods online)
(Supplementary Methods online) Production and purification of either LC-antisense or control molecules Recombinant phagemids and the phagemid vector were transformed into XL-1 Blue competent bacterial
More informationX-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction
X-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction Tomohisa Shimasaki 1, Hiromi Yoshida 2, Shigehiro Kamitori 2 & Koji
More informationProtein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra
GE Healthcare Data file 28-9768-1 AA Protein sample preparation Protein A Mag Sepharose Xtra Xtra products are magnetic beads designed for efficient, high capacity small-scale purification/screening of
More informationEfficient Multi-Well Protein Purification Strategies
Application Note PN 33576 Efficient Multi-Well Protein Purification Strategies Introduction Many tools and techniques are available today for protein purification. Development of a purification process
More informationProduct. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin
Novagen offers a large variety of affinity supports and kits for the purification of recombinant proteins containing popular peptide fusion tags, including His Tag, GST Tag, S Tag and T7 Tag sequences.
More informationAims: -Purification of a specific protein. -Study of protein-protein interactions
Aims: -Purification of a specific protein -Study of protein-protein interactions This is a reliable method for purifying total IgG from crude protein mixtures such as serum. Protein A (linked to resin
More informationCURRICULUM VITAE Natalya Voloshchuk, Ph.D.
CURRICULUM VITAE Natalya Voloshchuk, Ph.D. CONTACT INFORMATION Address: Department of Biochemistry and Microbiology School of Environmental and Biological Sciences Rutgers, The State University of New
More informationAvalanche -Everyday Transfection Reagent
The Transfection & Gene Expression Experts Avalanche -Everyday Transfection Reagent Cat. No. EZT-EVDY-1 Description Size: 0.75 ml 1.5 ml Store at 4 C As the simplified version of our most popular and powerful
More informationFigure 1: E. Coli lysate transfer using liquid handling automation
Figure 1: E. Coli lysate transfer using liquid handling automation Figure 1 - E. coli lysate transfer using liquid handling automation. Following the manufacturer s procedures, a 96-well plate miniprep
More information