Cloning and Expression of a Haloacid Dehalogenase Enzyme. By: Skyler Van Senior Research Advisor: Dr. Anne Roberts

Size: px
Start display at page:

Download "Cloning and Expression of a Haloacid Dehalogenase Enzyme. By: Skyler Van Senior Research Advisor: Dr. Anne Roberts"

Transcription

1 Cloning and Expression of a Haloacid Dehalogenase Enzyme By: Skyler Van Senior Research Advisor: Dr. Anne Roberts

2 utline The gene being cloned is JHP1130 from Helicobacter pylori (H. pylori) JHP1130 is a member of the Haloacid Dehalogenase (HAD) superfamily The gene was cloned into a pet21b vector for subsequent expression The plasmid was transformed into BL21 E. coli cells for protein expression The expected molecular weight of the desired protein was roughly 25 kda and a band at this molecular weight confirmed the presence of the correct protein.

3 H. Pylori bacterium

4 Members of the Haloacid dehalogenase (HAD) superfamily have diverse functions Cl Cl - - H Cl intermediate R Cl intermediate C C P R P R Dehalogenases RH RH intermediate intermediate H H R H C C Phosphatases P H P H Mannose-6-Phosphate intermediate Mannose-1-Phosphate Mannose-6-Phosphate intermediate Mannose-1-Phosphate Phosphomutases - P - P - NH 2 N N N N ADP H H H H H H P intermediate - P-type ATPases (Ion pumps) + P i

5 JHP 1130 Putative member of the HAD phosphatase superfamily, members of which are found in many metabolic pathways R P - R P H 2 Pi - Phosphorylated Enzyme intermediate

6 Had members can be identified by the presence of specific sequence motifs MTIF I DXDX[T/V][L/V] (P-type ATPases) DKTGTL first aspartate becomes phosphorylated second aspartate involved in binding Mg 2+ required for activity MTIF II [S/T]XX involved in phosphoryl oxygen binding MTIF III K-[G/S][D/S]XXX[D/N] (HAD) SSXXXD involved in phosphoryl oxygen binding and binding of Mg 2+

7 PCR of JHP1130 Insert w/ histag Insert w/ histag Insert w/ histag Insert w/ histag Insert w/o histag Insert w/o histag Insert w/o histag Insert w/o histag DNA ladder Requirements for PCR: dntp s genomic DNA primers polymerase Mg 2+ small amount of ddntp Forward primer (Nde1): 5 GCT GAC CAT ATG GCG CTT GAA GTG GTT TTA TGG 3 Reverse primer (Ecor1 w/o histag): 5 GCA GTC GAA TTC TTA CTC TTT TGC GAA GTT TTG TAA ATC 3 Reverse primer (Xho1 w/ histag): 5 ACA TCG CTC GAG CTC TTT TGC GAA GTT TTG TAA ATC 3

8 pet 21 b (+)

9 General cloning strategy pet21b Plasmid Cleaved pet21b Plasmid JHP1130 gene insert Plasmid w/ insert integrated Plasmid --CA --GTAT + CATATG GTAT AC Insert TATG AC-- DNA LIGASE

10 Cleaved Gene Insert and Plasmid nde1/xho1 insert w/ histag nde1/ecor1 insert w/o histag nde1/ecor1 plasmid digest w/o histag nde1/xho1 plasmid digest w/ histag Ran gels containing insert and plasmid cleaved with each of the restriction endonucleases Cut out the portion of gel with the bands corresponding to each product Extracted the DNA from the gel for each product. This ensured that the products were free of impurities before ligation reaction was performed.

11 Transformation of JHP1130 plasmid into DH5α cells Luria Bertani broth w/ ampicillin Ampicillin/agar plate DH5α cells : The plasmid with the insert incorporated is grown with DH5α cells Specially designed to allow passage of plasmid through cell membrane This permeability makes the cells very fragile

12 Testing for JHP1130 insert in Plasmid DNA ladder #1 T7 promoter/terminator PCR reaction #2 T7 promoter/terminator PCR reaction Plasmid control

13 Plasmid containing JHP1130 transformed into BL21 cells 75 kda 50 kda 25 kda From left to right: Protein standard, BL21 Transformation #1, BL21 Transformation #2, w/ IPTG #1, w/ IPTG #2 Isopropyl β-d-1- thiogalactopyranoside(iptg): IPTG is used for protein expression It mimics allolactose, but not as easily degraded Binds to lac repressor allowing transcription (JHP1130)

14 Purification via Ion Exchange JHP1130 facts: pi = 5.67 M.W. = Da Number of Amino Acids = 222 Increasing [NaCl] 75 kda 50 kda 25 kda Ion exchange chromatography setup: ph =8 (protein is negatively charged) Q sepharose anion exchange column to elute protein increase the salt concentration

15 Ammonium Sulfate Fractionation 75 kda 50 kda 25 kda Saturated Ammonium Sulfate facts: Different proteins will precipitate at different percentages JHP1130 has a molecular weight of ~25 kda The first lane with a band at ~25 kda is 55% saturation From right to left: protein ladder, 20%, 40%, 55%, 65%, 80%, protein ladder

16 Future research Purify protein to homogeneity Begin testing various small molecule phosphorylated substrates to narrow down in vivo substrate

17 Questions

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer

More information

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

Table S1. Bacterial strains (Related to Results and Experimental Procedures) Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)

More information

MacBlunt PCR Cloning Kit Manual

MacBlunt PCR Cloning Kit Manual MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).

More information

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010 Engineering D66N mutant using quick change site directed mutagenesis Harkewal Singh 09/01/2010 1 1- What is quick change site directed mutagenesis? 2- An overview of the kit contents. 3- A brief information

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic

More information

Gene synthesis by circular assembly amplification

Gene synthesis by circular assembly amplification Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary

More information

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known

More information

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is

More information

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table

More information

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were 1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon

More information

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below). Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very

More information

An engineered tryptophan zipper-type peptide as a molecular recognition scaffold

An engineered tryptophan zipper-type peptide as a molecular recognition scaffold SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening

More information

Supplemental material

Supplemental material Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,

More information

Supplementary Information

Supplementary Information Supplementary Information Load-dependent modulation of non-muscle myosin-2a function by tropomyosin 4.2 Nikolas Hundt 1, Walter Steffen 2, Salma Pathan-Chhatbar 1, Manuel H. Taft 1, Dietmar J. Manstein

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

More information

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G

More information

High-throughput cloning and expression in recalcitrant bacteria

High-throughput cloning and expression in recalcitrant bacteria High-throughput cloning and expression in recalcitrant bacteria Eric R Geertsma & Bert Poolman Supplementary text and figures: Supplementary Figure 1 Frequency of SfiI sites yielding identical 3 extensions

More information

Disease and selection in the human genome 3

Disease and selection in the human genome 3 Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression

More information

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification. RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C

More information

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain

More information

Supporting Online Information

Supporting Online Information Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical

More information

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis 1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons

More information

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

More information

Expression of Recombinant Proteins

Expression of Recombinant Proteins Expression of Recombinant Proteins Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression Vector Features

More information

Hes6. PPARα. PPARγ HNF4 CD36

Hes6. PPARα. PPARγ HNF4 CD36 SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa

More information

Dierks Supplementary Fig. S1

Dierks Supplementary Fig. S1 Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F

More information

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short

More information

Legends for supplementary figures 1-3

Legends for supplementary figures 1-3 High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik

More information

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

More information

Supplementary Information

Supplementary Information Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials

More information

CHE-3H84: Protein Engineering Past Exam Papers

CHE-3H84: Protein Engineering Past Exam Papers CHE-3H84: Protein Engineering Past Exam Papers Sorted by Topic then Year Knowledge-Based Engineering of Proteins, Large Scale Production of Recombinant Proteins, and Protein Purification Dr. Hemmings 2006/7

More information

Preparative Protein Chemistry

Preparative Protein Chemistry Biochemistry 412 Preparative Protein Chemistry 19 February 2008 The Three Eras of Protein Purification 1. The Classical (Pre-Recombinant DNA) Era (pre-1978) - Proteins purified from natural sources only

More information

I. Things to keep in mind before you start this protocol

I. Things to keep in mind before you start this protocol Inverse PCR and Sequencing Protocol on 5 Fly Preps For recovery of sequences flanking piggybac elements This protocol is an adaptation of "Inverse PCR and Cycle Sequencing Protocols" by E. Jay Rehm Berkeley

More information

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Supplementary Information. Construction of Lasso Peptide Fusion Proteins Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and

More information

Supporting Information

Supporting Information Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the

More information

PCR analysis was performed to show the presence and the integrity of the var1csa and var-

PCR analysis was performed to show the presence and the integrity of the var1csa and var- Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc

More information

Amgen Laboratory Series. Tabs C and E

Amgen Laboratory Series. Tabs C and E Amgen Laboratory Series Tabs C and E Chapter 2A Goals Describe the characteristics of plasmids Explain how plasmids are used in cloning a gene Describe the function of restriction enzymes Explain how to

More information

Det matematisk-naturvitenskapelige fakultet

Det matematisk-naturvitenskapelige fakultet UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday

More information

BioInformatics and Computational Molecular Biology. Course Website

BioInformatics and Computational Molecular Biology. Course Website BioInformatics and Computational Molecular Biology Course Website http://bioinformatics.uchc.edu What is Bioinformatics Bioinformatics upgrades the information content of biological measurements. Discovery

More information

Supplementary Figure 1A A404 Cells +/- Retinoic Acid

Supplementary Figure 1A A404 Cells +/- Retinoic Acid Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure

More information

Y-chromosomal haplogroup typing Using SBE reaction

Y-chromosomal haplogroup typing Using SBE reaction Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G

More information

Supporting Information

Supporting Information Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting

More information

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC

More information

Lecture 22: Molecular techniques DNA cloning and DNA libraries

Lecture 22: Molecular techniques DNA cloning and DNA libraries Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived

More information

Supporting Information

Supporting Information upporting Information hiota et al..73/pnas.159218 I Materials and Methods Yeast trains. Yeast strains used in this study are described in Table 1. TOM22FLAG, a yeast haploid strain for expression of C-terminally

More information

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)

More information

evaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the

evaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure

More information

2

2 1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene

More information

Multiplexing Genome-scale Engineering

Multiplexing Genome-scale Engineering Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt

More information

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3 Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts

More information

Chapter 4. Recombinant DNA Technology

Chapter 4. Recombinant DNA Technology Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon

More information

Problem Set 4

Problem Set 4 2006 7.012 Problem Set 4 Due before 5 PM on FRIDAY, October 27, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying a specific gene in yeast,

More information

The final aim was the construction of the blue light emission devise with the blue

The final aim was the construction of the blue light emission devise with the blue Objectives The final aim was the construction of the blue light emission devise with the blue light emitting bacterial luciferase from Vibrio fischeri coded by luxa and luxb genes. The structure of the

More information

CHAPTER 4 Cloning, expression, purification and preparation of site-directed mutants of NDUFS3 and NDUFS7

CHAPTER 4 Cloning, expression, purification and preparation of site-directed mutants of NDUFS3 and NDUFS7 CHAPTER 4 Cloning, expression, purification and preparation of site-directed mutants of NDUFS3 and NDUFS7 subunits of human mitochondrial Complex-I Q module N DUFS2, 3, 7 and 8 form the core subunits of

More information

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography Green Fluorescent Protein (GFP) Purification Hydrophobic Interaction Chromatography What is the GFP gene? GFP is a green fluorescent protein that is normally found in jellyfish. It has been engineered

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp

More information

ORFs and genes. Please sit in row K or forward

ORFs and genes. Please sit in row K or forward ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

Table S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes

Table S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes Supplementary Table and Figures for Structural Basis for the Enantiospecificities of R- and S-Specific Phenoxypropionate/α-Ketoglutarate Dioxygenases by Tina A. Müller, Maria I. Zavodszky, Michael Feig,

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum

More information

FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE

FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Uppsala 2001-04-01 REPORT FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Laboratory assistants: Maria Jönsson Amera Gibreel Students: Contents ASSIGNMENT:... 3 INTRODUCTION:... 3 MATERIAL AND

More information

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013 Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

SUPPLEMENTAL DATA SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL DATA SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL DATA SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE S1. Identification of BmCREC. (A) Amino acid sequences of BmCREC show the peptides identified in LC-MS/MS analysis (marked by red letters

More information

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB

More information

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%) SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian

More information

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

MCB 102 University of California, Berkeley August 11 13, Problem Set 8

MCB 102 University of California, Berkeley August 11 13, Problem Set 8 MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without

More information

Journal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC

Journal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC Preparing Plasmid Constructs to Investigate the Characteristics of Thiol Reductase and Flavin Reductase With Regard to Solubilizing Insoluble Proteinase Inhibitor 2 in Bacterial Protein Overexpression

More information

Glutathione (GSH)-Decorated Magnetic Nanoparticles for Binding Glutathione-S-transferase (GST) Fusion Protein and Manipulating Live Cells

Glutathione (GSH)-Decorated Magnetic Nanoparticles for Binding Glutathione-S-transferase (GST) Fusion Protein and Manipulating Live Cells Glutathione (GSH)-Decorated Magnetic Nanoparticles for Binding Glutathione-S-transferase (GST) Fusion Protein and Manipulating Live Cells Yue Pan, Marcus J. C. Long, Xinming Li, Junfeng Shi, Lizbeth Hedstrom,

More information

Lab Book igem Stockholm Lysostaphin. Week 8

Lab Book igem Stockholm Lysostaphin. Week 8 Lysostaphin Week 8 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

Solutions to 7.02 Quiz II 10/27/05

Solutions to 7.02 Quiz II 10/27/05 Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover

More information

Sequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps

Sequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps Supporting information Sequencing of DNA lesions facilitated by site-specific excision via base excision repair DNA glycosylases yielding ligatable gaps Jan Riedl, Aaron M. Fleming, and Cynthia J. Burrows*

More information

MOLECULAR BIOLOGY GREATEST HITS. Marketplace. Essentials Tour molecular biology. thermofisher.com/marketplace

MOLECULAR BIOLOGY GREATEST HITS. Marketplace. Essentials Tour molecular biology. thermofisher.com/marketplace molecular biology Marketplace MOLECULAR BIOLOGY GREATEST HITS Special offers on Thermo Scientific products: Cloning kits Restriction and modifying enzymes IPTG and X-Gal DNA ladders Agarose tablets Nucleic

More information

Table S2. Oligonucleotide primers used to amplify pile and tcpa genes. Restriction endonuclease sites are underlined. Oligonucleotide Gene/ Sequence

Table S2. Oligonucleotide primers used to amplify pile and tcpa genes. Restriction endonuclease sites are underlined. Oligonucleotide Gene/ Sequence The metal binding site Even though metals were not added to the crystallization mixture, a strong positive peak (56 sigma) in the fo fc electron density map clearly shows the tetrahedral coordination of

More information

NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN

NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer

More information

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA

More information

A transcription blocker isolated from a designed repeat protein combinatorial library. Shicong Xie 1,$, and Lan Guan 1*

A transcription blocker isolated from a designed repeat protein combinatorial library. Shicong Xie 1,$, and Lan Guan 1* A transcription blocker isolated from a designed repeat protein combinatorial library by in vivo functional screen Elena B. Tikhonova, Abdul S Ethayathulla,#, Yue Su,#, Parameswaran Hariharan, Shicong

More information

Q2 (1 point). How many carbon atoms does a glucose molecule contain?

Q2 (1 point). How many carbon atoms does a glucose molecule contain? Q1 (1 point). Name three amino acids that are typically found at the surface of integrated membrane proteins.. Q2 (1 point). How many carbon atoms does a glucose molecule contain? Q3 (1 point). What do

More information

BACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34.

BACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34. BACTERIAL PRODUCTION PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT 2015-XXXX XXXX pet-32a 50.9 kda (full-length) 34.0 kda (cleaved) EXPRESSION METHOD OVERVIEW: Plasmid DNA was transformed into BL21

More information

Supporting Information

Supporting Information Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT

More information

Gateway pentr Dual Selection Vectors

Gateway pentr Dual Selection Vectors Gateway pentr Dual Selection Vectors Catalog nos. A10462, A10463, A10464, A10465, A10467 Version A 6 Jun 2008 A10609 A Limited Label License covers this product (see Purchaser Notification). By use of

More information

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells

More information

Supplemental Table 1. Primers used for PCR.

Supplemental Table 1. Primers used for PCR. Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT

More information

PCR-based Markers and Cut Flower Longevity in Carnation

PCR-based Markers and Cut Flower Longevity in Carnation PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso

More information

Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC

Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC

More information

The B1 Protein Guides the Biosynthesis of a Lasso Peptide

The B1 Protein Guides the Biosynthesis of a Lasso Peptide The B1 Protein Guides the Biosynthesis of a Lasso Peptide Shaozhou Zhu 1,2, Christopher D. Fage 1, Julian D. Hegemann 1, Andreas Mielcarek 1, Dushan Yan 1, Uwe Linne 1 & Mohamed A. Marahiel*,1 1 Department

More information

7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key

7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 Spring 2005 RDM Exam Study Questions 7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key

More information

Promoter 1. Promoter 2. Enhancer 2

Promoter 1. Promoter 2. Enhancer 2 Essays 1. An animal normally has two copies of the Xan gene. The protein made by this gene helps the animal clear petroleum-based pollutants from its body. Tine Xan What we know about the Xan gene is shown

More information

Biotechnology Project VI lesson. 1 - Subcloning NRG1-III-β3 from pcr-blunt II-TOPO into the expression vector pegfp-c3

Biotechnology Project VI lesson. 1 - Subcloning NRG1-III-β3 from pcr-blunt II-TOPO into the expression vector pegfp-c3 26-11-2018 - Biotechnology Project VI lesson 1 - Subcloning NRG1-III-β3 from pcr-blunt II-TOPO into the expression vector pegfp-c3 2 - Subcloning NRG1-III-β3 from pcr-blunt II-TOPO or pegfp-c3 into the

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Chapter 13 Chromatin Structure and its Effects on Transcription

Chapter 13 Chromatin Structure and its Effects on Transcription Chapter 13 Chromatin Structure and its Effects on Transcription Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.

More information