FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE

Size: px
Start display at page:

Download "FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE"

Transcription

1 FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin Assistant: Leila Tajedin (leila.tajedin@oulu.fi) Course responsible person: Dr. Tuomo Glumoff (tuomo.glumoff@oulu.fi) CONTENTS Biochemistry Practical Schedules PAGE ORGANISATION 1 Computing Practical ORGANISATION 1 Students will work as individuals. Failure to attend a practical will result in a mark of zero being awarded unless there is a good reason for absence which must be notified to Tuomo Glumoff. 2 To achieve good results from these practicals it is important that students should: (i) understand the basic principles underlying each experiment; and (ii) should be able to discern which operations are critical and which are not. It is therefore important that every student READ THE PRACTICAL SHEETS before the class. If you do not understand any point please consult one of the demonstrators - that is what they are primarily there for! 1

2 3 Reports must be sent within one week of the practical class to Leila Tajedin ( address above). The maximum length allowed for the report is 6 sides of A4 paper and the acceptable format for report is PDF. Late work will not be marked unless there is due reason for the lateness. 4 Note: Try to present answers, which are concise and logical. No need to mention irrelevant points. If irrelevant or false sentences are mentioned which dilutes the real answer then they will be marked negatively. In addition, choice of words is important; do consult dictionary and scientific literature to clarify the actual meaning of words so that you are sure it correctly corresponds to the meaning, which you want to convey in the answers. In this practice, you will work on three human proteins with following SwissProt ID: 1) P ) Q8IVL5 3) Q76MJ5 The write-up for this report is free-format but at a minimum must include the following information: 1) SwissProt ID and FASTA (canonical) format of sequences 2) For transmembrane proteins the possible orientation of the protein in the membrane 3) The signal sequence or transmembrane region for the protein which targets it to the ER. 4) The molecular weight, pi and extinction coefficient of the mature protein 5) Determine the concentration of the protein in mg/ml of a solution with A280 of 1.0 in a 1 cm path length cuvette. 6) Find any putative post-translational modifications 7) Mention the expression pattern for the protein. 8) The SwissProt ID of mouse homologue of the human protein and the % identity between the full-length mouse and human proteins. 9) Find the possible domains and motifs of the proteins 10) Explore the 3D structure of the proteins For a normal protein if you get the answers to all 8 point correct you will get 70% of the marks. To get the remaining marks (30%), you are supposed to find out which bioinformatic analysis software and links are useful for point 9 and 10 and make a short handbook, which can be up to two pages of total report. There are lots of links of the Uniprot page for the protein and there are several analysis software available, some of which can be found at: 2

3 COMPUTING PRACTICAL 1 BASIC BIOINFORMATICS Analysis of gene or protein sequences by computer can reveal many significant pieces of information regarding function, expression, cellular localization, structure, post-translational modifications etc. The number and types of methodologies is continuously growing and this practical will cover only the very basics of analysis in a couple of simple cases. As increasing amounts of information are obtained from genome sequencing projects, transcriptional analysis etc, it is increasingly easy to find some information about your protein of interest. However, as the databases get larger and ever more complex it is also becoming increasingly more difficult to find the relevant data. In addition, it must always be remembered that computer-based predictions are only predictions, they are not fact until supporting experimental evidence is found. In this practical you will use a few of the services available directly or indirectly from the ExPASy (Expert Protein Analysis System) server ( along with other commonly used bioinformatic analysis software to: 1) Find a specific human protein sequence 2) To find the signal sequence or transmembrane region for the protein which targets it to the ER. 3) To look for transmembrane regions and the possible orientation in the membrane 4) Use this information to find out the molecular weight and pi of the mature protein 5) To look for post-translational modifications 6) To look for information on the expression pattern for the protein. 7) To find the mouse homologue of the human protein and to calculate the % identity between the mouse and human proteins. (by completing these seven activities you will receive 70% of the mark) 8) To look for domains and 3D structure of the proteins (30% of the mark). One of the problems associated with bioinformatics is the large number of identifiers used, each protein may have multiple entries in multiple databases each with a unique ID code, with mrna sequences, genomic sequences etc for the same protein showing an equal diversity of ID codes. In this practical, your starting point will be the SwissProt ID for each 3

4 of the human proteins. Some of these proteins are in some way associated with the endoplasmic reticulum (ER) either by being having a transmembrane (membrane spanning) region (and appropriate signals) or for soluble proteins by being targeted to the ER by a N- terminal signal sequence at the N-terminus of the protein. These signal sequences, which are typically amino acids long but which may be longer, may either be cleaved by an enzyme called signal peptidase which will then release a mature protein into the ER or can be non-cleavable in which case they act as transmembrane region. Transmembrane regions are usually helical and around 20 amino acids long and a single protein may have multiple transmembrane regions, each spanning the membrane. Proteins containing such regions are always orientated in one specific direction i.e. for a given ER-protein which has a single transmembrane region may be orientated with its N-terminus either in the cytoplasm or in the ER; it will not form a mixed population with some molecules orientated with the N-terminal in the ER and some in the cytoplasm. An ER-protein which has an even number of transmembrane regions will have both the N-terminus and C-terminus on the same side of the membrane i.e. both in the cytoplasm or both in the ER. In this practical course, we will study several proteins that are all well studied and so even on the first data page you open there will be a significant amount of information towards answering the questions posed. Please do not take a short cut and return this information, do the full analysis. In some cases the answers obtained from the bioinformatics analysis and that listed in the SwissProt entry for the protein are very significantly different. In this manual a weblink will be underlined e.g. while a menu link will have the menu name in italics and subheadings referred to with -> e.g. Tools -> word count You will quickly collect a LOT of information about the protein and it may be worthwhile having Microsoft Word open and copying and pasting information into this as you go along. You MUST edit this information into a readable, presentable format that answers all of the questions asked (and shows the evidence). Open internet explorer and go to the UniProt homepage Enter the SwissProt ID in the query box and press search (care must be taken to distinguish between the number 0 and the letter O). This should take you to a unique UniProtKB entry; make sure that it is your protein before going further (remember ALL of the examples are human proteins). This entry contains a lot of information about the protein, links to references, 4

5 other databases, mrna and genomic DNA sequences, structures (PDB files) etc. You are actively encouraged to explore these links during the practical to see what information can be found in databases about any particular protein. Whenever possible, all the protein products encoded by one gene in a given species are described in a single UniProtKB/Swiss-Prot entry, including isoforms generated by alternative splicing, alternative promoter usage, and alternative translation initiation. Canonical sequences alone or canonical and isoform sequences can be downloaded in FASTA format using the FORMAT tab on top of the page. Click on FASTA (canonical); this will take you to the other page containing the amino acid sequence for the protein which you will need for other analysis programmes. Copy this sequence in your Microsoft word file. Make sure this is your sequence and you have copied all the amino acids by double checking the number of copied amino acids with UniProt. Notice that the heading in FASTA format starts with > and contains gene/protein information and the amino acid sequence, you will need the amino acid sequence for analysis (amino acids are marked in red box in the picture). All of the proteins in this exercise are either transmembrane or have a cleavable N-terminal signal sequence which directs them to the endoplasmic reticulum. To find out which your protein has you will analyse the sequence in a number of programmes. First select your sequence in word and copy it (right mouse click -> copy). Then go back to a series of websites and systematically check your sequence in a number of analysis programmes. Include at least: PSORT (Use the PSORT II sub-programme) SignalP TMpred 5

6 In each case follow the instructions in the programme, pasting your sequence in the query box edit->paste. Carefully note the results (different programmes may give different results) and use the consensus result for future analysis. For signal sequences you need to note the signal sequence and whether it is cleavable. For transmembrane proteins you need to note the transmembrane region(s) and the probable orientation in the membrane. PSORT will also give you other information, think about what might be relevant to note down. Note: If you do not get a consensus result for TM regions from these three programmes then you will have to try others until you get a consensus. Suggested other programmes include: Then calculate the pi (isoelectric point) and Mw of the mature protein. For proteins with a cleavable signal sequence this will be the full length protein with the signal sequence removed. For transmembrane proteins it will be the full length protein. Go to ProtPram and paste in the sequence to be analysed (remember the signal sequence issue). Note down the results for pi, Mw and extinction coefficient). If you had a solution of the mature protein with an absorbance at 280nm of 1.0 in a 1cm pathlength cuvette, what would the concentration of the protein be in mg/ml? Next examine possible post-translational modifications of the protein. Include at least: NetNGly NetPhos Sulfinator In each case follow the instructions in the programme, pasting your full length sequence in the query box edit->paste. Carefully note the results. N-glycosylation and tyrosine sulfation occur in the ER and hence for transmembrane proteins only those regions in the ER can be modified. Hence for transmembrane proteins use the topology you worked out earlier to decide if any potential N-glycosylation sites or tyrosine sulfation sites are ER-lumen accessible. Other PTM analysis software is available (easily found using google). Next find information on the specific expression pattern of your protein. Again there are numerous databases (and numerous access points) but for this practical use GeneCard. Return 6

7 to the UniProt entry page for your protein and under Organism-specific databases left click on the GenCards link. This should take you through to the GeneCard page for that protein. If it does not, then go to the gencard home page and search using keyword typing in your SwissProt ID. This may give multiple hits, but it should be very clear which is the link to your protein. On the GeneCard page for your protein there is a subheading Transcripts. Click on the link for the Unigene Cluster for your protein (the format for the link will be something like Hs ) and note down the expression sources for the protein based on cdna sources. Back in the Genecards entry look under the subheading Expression in human tissues to see in which tissue types the protein is most highly expressed; note these down. There may be other useful information and useful links on the rest of the GenCard page. Finally find the mouse homologue of the human protein and calculate the % identity between the mouse and human proteins.. There are various programmes for searching databases but for this practical use There are then several types of search possible: Blastp searches with a protein sequence for other protein sequences Blastn searches with a nucleotide sequence for other nucleotide sequences Tblastn searches with a protein sequence for a translated sequence from a nucleotide sequence i.e. you search with a protein sequence for a nucleotide sequence. You MUST select the appropriate type of database to search i.e. for blastp which you will use in this practical you must select a protein database. Paste your full length sequence in the box. Select blastp; protein databases ->UniProt (SwissProt/TrEMBL) and use the default settings for the alignment matrix, filters and graphics. Then click Run blast. Once the search is complete, scroll down the list of similar sequences until you find the mouse sequence (mus musculus) with the highest identity with your human sequence. Note down the SwissProt ID and the percentage identity. If this covers the whole protein (check the number of amino acids that the alignment is shown for the second number under identities or positives with the number of amino acids in your protein) and has no X then you need not do the alignment suggested below to get the % identity for the protein. 7

8 To work out % identity for the whole protein you must get the mouse protein sequence. Left click on the link to go to the Swiss-Prot entry for the mouse protein and then get the sequence without spaces, digits etc in same way you got the original human sequence i.e. via Word. Then go to LALIGN Paste the human sequence as 1 st Query and the mouse sequence as the 2 nd Query and run LALIGN using the default settings. Record the % identity between the proteins and whether this is over the whole protein or not. 8

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical

More information

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing

More information

Sequence Databases and database scanning

Sequence Databases and database scanning Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.

More information

Finding Genes, Building Search Strategies and Visiting a Gene Page

Finding Genes, Building Search Strategies and Visiting a Gene Page Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use

More information

Finding Genes, Building Search Strategies and Visiting a Gene Page

Finding Genes, Building Search Strategies and Visiting a Gene Page Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use

More information

Why Use BLAST? David Form - August 15,

Why Use BLAST? David Form - August 15, Wolbachia Workshop 2017 Bioinformatics BLAST Basic Local Alignment Search Tool Finding Model Organisms for Study of Disease Can yeast be used as a model organism to study cystic fibrosis? BLAST Why Use

More information

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1

BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1 BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1 Bioinformatics Databases http://bioboot.github.io/bioinf525_w17/module1/#1.1 Dr. Barry Grant Jan 2017 Overview: The purpose of this lab session is

More information

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1)

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) 1.1 Finding a gene using text search. Note: For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium.

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact

More information

2. The dropdown box has a number of databases that are searchable. Select the gene option and search for dihydrofolate reductase.

2. The dropdown box has a number of databases that are searchable. Select the gene option and search for dihydrofolate reductase. Bioinformatics Introduction Worksheet The first part of this exercise is aimed at walking you through some of the key tools used by scientists to explore the relationship between genes and proteins throughout

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

FUNCTIONAL BIOINFORMATICS

FUNCTIONAL BIOINFORMATICS Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.

More information

Exercises (Multiple sequence alignment, profile search)

Exercises (Multiple sequence alignment, profile search) Exercises (Multiple sequence alignment, profile search) 8. Using Clustal Omega program, available among the tools at the EBI website (http://www.ebi.ac.uk/tools/msa/clustalo/), calculate a multiple alignment

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

Retrieval of gene information at NCBI

Retrieval of gene information at NCBI Retrieval of gene information at NCBI Some notes 1. http://www.cs.ucf.edu/~xiaoman/fall/ 2. Slides are for presenting the main paper, should minimize the copy and paste from the paper, should write in

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology

More information

Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html

More information

From AP investigative Laboratory Manual 1

From AP investigative Laboratory Manual 1 Comparing DNA Sequences to Understand Evolutionary Relationships. How can bioinformatics be used as a tool to determine evolutionary relationships and to better understand genetic diseases? BACKGROUND

More information

Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University

Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,

More information

This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.

This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries. PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,

More information

Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G

Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

Hands-On Four Investigating Inherited Diseases

Hands-On Four Investigating Inherited Diseases Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.

More information

ONLINE BIOINFORMATICS RESOURCES

ONLINE BIOINFORMATICS RESOURCES Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower

More information

Exercise I, Sequence Analysis

Exercise I, Sequence Analysis Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt

More information

Tutorial for Stop codon reassignment in the wild

Tutorial for Stop codon reassignment in the wild Tutorial for Stop codon reassignment in the wild Learning Objectives This tutorial has two learning objectives: 1. Finding evidence of stop codon reassignment on DNA fragments. 2. Detecting and confirming

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Chimp Sequence Annotation: Region 2_3

Chimp Sequence Annotation: Region 2_3 Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker

More information

DNA & Protein Synthesis. The source and the process!

DNA & Protein Synthesis. The source and the process! DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information

More information

BLAST. Subject: The result from another organism that your query was matched to.

BLAST. Subject: The result from another organism that your query was matched to. BLAST (Basic Local Alignment Search Tool) Note: This is a complete transcript to the powerpoint. It is good to read through this once to understand everything. If you ever need help and just need a quick

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

Pre-Lab Questions. 1. Use the following data to construct a cladogram of the major plant groups.

Pre-Lab Questions. 1. Use the following data to construct a cladogram of the major plant groups. Pre-Lab Questions Name: 1. Use the following data to construct a cladogram of the major plant groups. Table 1: Characteristics of Major Plant Groups Organism Vascular Flowers Seeds Tissue Mosses 0 0 0

More information

Web-based Bioinformatics Applications in Proteomics

Web-based Bioinformatics Applications in Proteomics Web-based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu January 30, 2009 NCBI (National Center for Biotechnology Information) http://www.ncbi.nlm.nih.gov/ 1 Pubmed

More information

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality

More information

Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST

Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background

More information

HC70AL Spring An Introduction to Bioinformatics -- Part I. Brandon Le. April 6, What is a Gene? An ordered sequence of nucleotides

HC70AL Spring An Introduction to Bioinformatics -- Part I. Brandon Le. April 6, What is a Gene? An ordered sequence of nucleotides APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) HC70AL Spring 2004 An Introduction to Bioinformatics -- Part I By Brandon Le April 6, 2004 What is a Gene? An ordered sequence of nucleotides What are the 4

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the database of nucleotide sequences at the National Center for Biotechnology

More information

ipep User s Guide Proteomics

ipep User s Guide Proteomics Proteomics ipep User s Guide ipep has been designed to aid in designing sample preparation techniques around the detection of specific sites or motifs in proteins and proteomes. The first application,

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual

More information

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will

More information

Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm

Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm Exam description: The purpose of this exam is for you to demonstrate your ability to use the different biomolecular

More information

Homework 4. Due in class, Wednesday, November 10, 2004

Homework 4. Due in class, Wednesday, November 10, 2004 1 GCB 535 / CIS 535 Fall 2004 Homework 4 Due in class, Wednesday, November 10, 2004 Comparative genomics 1. (6 pts) In Loots s paper (http://www.seas.upenn.edu/~cis535/lab/sciences-loots.pdf), the authors

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information

Download the Lectin sequence output from

Download the Lectin sequence output from Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).

More information

UNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics

UNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics UNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, 2010 SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics DURATION: 3 HOURS TOTAL MARKS: 125 Internal Examiner: Dr. Ché Pillay External Examiner: Prof. Nicola

More information

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017 Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l

More information

AP BIOLOGY. Investigation #3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST. Slide 1 / 32. Slide 2 / 32.

AP BIOLOGY. Investigation #3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST. Slide 1 / 32. Slide 2 / 32. New Jersey Center for Teaching and Learning Slide 1 / 32 Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and

More information

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018 Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l

More information

SignalP Plugin USER MANUAL

SignalP Plugin USER MANUAL SignalP Plugin USER MANUAL User manual for SignalP 2.3 Windows, Mac OS X and Linux November 7, 2017 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark

More information

What is a Gene? HC70AL Spring An Introduction to Bioinformatics -- Part I. What are the 4 Nucleotides By in DNA?

What is a Gene? HC70AL Spring An Introduction to Bioinformatics -- Part I. What are the 4 Nucleotides By in DNA? APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) What is a Gene? HC70AL Spring 2004 An ordered sequence of nucleotides An Introduction to Bioinformatics -- Part I What are the 4 Nucleotides By in DNA? Brandon

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology

BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get

More information

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417. SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop

More information

Project Manual Bio3055. Lung Cancer: Cytochrome P450 1A1

Project Manual Bio3055. Lung Cancer: Cytochrome P450 1A1 Project Manual Bio3055 Lung Cancer: Cytochrome P450 1A1 Bednarski 2003 Funded by HHMI Lung Cancer: Cytochrome P450 1A1 Introduction: It is well known that smoking leads to an increased risk for lung cancer,

More information

Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009)

Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009) Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009) Prerequisites: BLAST Exercise: An In-Depth Introduction to NCBI BLAST Familiarity

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

Lecture 7 Motif Databases and Gene Finding

Lecture 7 Motif Databases and Gene Finding Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC

More information

Question 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences.

Question 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences. Bio4342 Exercise 1 Answers: Detecting and Interpreting Genetic Homology (Answers prepared by Wilson Leung) Question 1: Low complexity DNA can be described as sequences that consist primarily of one or

More information

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Data mining in Ensembl with BioMart Worked Example The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Which other genes related to human

More information

Investigating Inherited Diseases

Investigating Inherited Diseases Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise to inherited diseases.

More information

Textbook Reading Guidelines

Textbook Reading Guidelines Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science

More information

Functional analysis using EBI Metagenomics

Functional analysis using EBI Metagenomics Functional analysis using EBI Metagenomics Contents Tutorial information... 2 Tutorial learning objectives... 2 An introduction to functional analysis using EMG... 3 What are protein signatures?... 3 Assigning

More information

Bioinformatics of the Green Fluorescent Proteins

Bioinformatics of the Green Fluorescent Proteins Tested Studies for Laboratory Teaching Proceedings of the Association for Biology Laboratory Education Volume 39, Article 66, 2018 Bioinformatics of the Green Fluorescent Proteins Alma E. Rodriguez Estrada

More information

BME 110 Midterm Examination

BME 110 Midterm Examination BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Sequence Analysis. Introduction to Bioinformatics BIMMS December 2015

Sequence Analysis. Introduction to Bioinformatics BIMMS December 2015 Sequence Analysis Introduction to Bioinformatics BIMMS December 2015 abriel Teku Department of Experimental Medical Science Faculty of Medicine Lund University Sequence analysis Part 1 Sequence analysis:

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

An Introduction to Bioinformatics

An Introduction to Bioinformatics Tested Studies for Laboratory Teaching Proceedings of the Association for Biology Laboratory Education Vol. 37, Article 9, 2016 An Introduction to Bioinformatics Robert J. Kosinski Department of Biological

More information

Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources

Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources Navreet Kaur M.Tech Student Department of Computer Engineering. University College of Engineering, Punjabi

More information

NCBI Molecular Biology Resources

NCBI Molecular Biology Resources NCBI Molecular Biology Resources Part 2: Using NCBI BLAST December 2009 Using BLAST Basics of using NCBI BLAST Using the new Interface Improved organism and filter options New Services Primer BLAST Align

More information

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz] BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web

More information

Exploring the Genetic Basis for Behavior. Instructor s Notes

Exploring the Genetic Basis for Behavior. Instructor s Notes Exploring the Genetic Basis for Behavior Instructor s Notes Introduction This lab was designed for our 300-level Advanced Genetics course taken by juniors and seniors majoring in Biology or Biochemistry.

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

SAMPLE LITERATURE Please refer to included weblink for correct version.

SAMPLE LITERATURE Please refer to included weblink for correct version. Edvo-Kit #340 DNA Informatics Experiment Objective: In this experiment, students will explore the popular bioninformatics tool BLAST. First they will read sequences from autoradiographs of automated gel

More information

MOL204 Exam Fall 2015

MOL204 Exam Fall 2015 MOL204 Exam Fall 2015 Exercise 1 15 pts 1. 1A. Define primary and secondary bioinformatical databases and mention two examples of primary bioinformatical databases and one example of a secondary bioinformatical

More information

Project Manual Bio3055. Lung Cancer: K-Ras 2

Project Manual Bio3055. Lung Cancer: K-Ras 2 Project Manual Bio3055 Lung Cancer: K-Ras 2 Bednarski 2003 Funded by HHMI Lung Cancer: K-Ras2 Introduction: It is well known that smoking leads to an increased risk for lung cancer, but how does genetics

More information

Textbook Reading Guidelines

Textbook Reading Guidelines Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: January 16, 2013 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science

More information

Evolutionary Genetics. LV Lecture with exercises 6KP

Evolutionary Genetics. LV Lecture with exercises 6KP Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP HS2017 >What_is_it? AATGATACGGCGACCACCGAGATCTACACNNNTC GTCGGCAGCGTC 2 NCBI MegaBlast search (09/14) 3 NCBI MegaBlast search (09/14) 4 Submitted

More information

Basic protein and peptide science for proteomics. Henrik Johansson

Basic protein and peptide science for proteomics. Henrik Johansson Basic protein and peptide science for proteomics Henrik Johansson Proteins are the main actors in the cell Membranes Transport and storage Chemical factories DNA Building proteins Structure Proteins mediate

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Computational Biology and Bioinformatics

Computational Biology and Bioinformatics Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management

More information

An insilico Approach: Homology Modelling and Characterization of HSP90 alpha Sangeeta Supehia

An insilico Approach: Homology Modelling and Characterization of HSP90 alpha Sangeeta Supehia 259 Journal of Pharmaceutical, Chemical and Biological Sciences ISSN: 2348-7658 Impact Factor (SJIF): 2.092 December 2014-February 2015; 2(4):259-264 Available online at http://www.jpcbs.info Online published

More information

Biology A: Chapter 9 Annotating Notes Protein Synthesis

Biology A: Chapter 9 Annotating Notes Protein Synthesis Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side

More information

The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis

The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis For example, protein synthesis in human mitochondria relies on a genetic code that Leder and Nirenberg were able

More information

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Laboratory 3: Detecting selection

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Laboratory 3: Detecting selection Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Laboratory 3: Detecting selection Handed out: November 28 Due: December 14 Introduction In this laboratory we

More information

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5 Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate

More information

CS313 Exercise 1 Cover Page Fall 2017

CS313 Exercise 1 Cover Page Fall 2017 CS313 Exercise 1 Cover Page Fall 2017 Due by the start of class on Monday, September 18, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try

More information

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417. SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop

More information

Why study sequence similarity?

Why study sequence similarity? Sequence Similarity Why study sequence similarity? Possible indication of common ancestry Similarity of structure implies similar biological function even among apparently distant organisms Example context:

More information

DNA, RNA & Proteins Chapter 13

DNA, RNA & Proteins Chapter 13 DNA, RNA & Proteins Chapter 13 DNA stands for. What is DNA? - The genetic information that controls the activity of a cell. - Located in the of every one of your cells. What is the structure of DNA like?

More information