DNA & Protein Synthesis. The source and the process!
|
|
|
- Annabel Hill
- 5 years ago
- Views:
Transcription
1 DNA & Protein Synthesis The source and the process!
2 Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code
3 I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information what IS that information? Instructions for building all structures for all living things where in the molecule is it stored? the information is IN the sequence of base pairs Why are we different from a fly or a flower or bacteria?
4 I. DNA & Genes: What is a gene? A specific sequence of DNA that codes for a specific protein Alternate versions of a gene for the same trait are called alleles ex: trait is eye color; alleles are green or blue ex: trait is blood type; alleles are A, B or O
5 I. DNA & Genes: Not all DNA codes for protein Introns There are non-coding regions occur both between and within genes called introns In humans, genes make up only 5% of all DNA (!!)
6 I. DNA & Genes: The Human Genome Project Chromosome Genes Total base pairs Sequenced base pairs Cumulative (%) 1 2, ,199, ,999, , ,751, ,712, , ,446, ,704, , ,263, ,297, ,837, ,702, , ,896, ,273, ,821, ,952, ,274, ,612, ,442, ,312, ,374, ,624, , ,452, ,130, , ,289, ,303, ,127,980 95,559, ,360,585 88,290, ,338,915 81,341, ,822,254 78,884, ,200 78,654,742 77,800, ,117,153 74,656, ,500 63,806,651 55,785, ,435,965 59,505, ,944,323 34,171, ,528,953 34,893, X (sex chromosome) ,913, ,058, Y (sex chromosome) 50 57,741,652 25,121, Total 20,000 to 25,000 3,079,843,747 2,857,698, The Human Genome Project (HGP) was the international, collaborative research program whose goal was the complete mapping and understanding of all the genes of human beings. All our genes together are known as our "genome." Upon publication of the majority of the genome in February 2001, Francis Collins, the director of NHGRI, noted that the genome could be thought of in terms of a book with multiple uses: "It's a history book - a narrative of the journey of our species through time. It's a shop manual, with an incredibly detailed blueprint for building every human cell. And it's a transformative textbook of medicine, with insights that will give health care providers immense new powers to treat, prevent and cure disease."
7 I. DNA & Genes: How does DNA determine the way living things look? Inherited DNA specifies traits by directing synthesis of proteins these proteins then form or direct the formation of structures which then relate to an organisms physical appearance In other words: proteins are the link between our genetic make up (genotype) and our physical appearance (phenotype)
8 II. Protein Synthesis: DNA directed protein synthesis Transcription making RNA from DNA takes place in the nucleus Translation making protein from RNA takes place outside of the nucleus on ribosomes these may be in the cytoplasm freely, or attached to the cells endoplasmic reticulum
9 II. Protein Synthesis: Transcription the details Initiation an enzyme (RNA polymerase) attaches to the promoter, a start here site on DNA indicating the start of a gene Elongation RNA polymerase builds a copy of the gene (the transcript) which gets longer and longer this gene copy is called messenger RNA or just mrna Termination enzyme reaches the terminator ( stop here ) at the end of a gene and detaches from the DNA the mrna is a free-floating single stranded copy of a gene Capping & editing (mrna processing) ends of mrna are protected (cap and tail) & non-coding parts are removed (splicing) now the mrna can leave the nucleus
10 II. Protein Synthesis: Transcription of a gene
11 II. Protein Synthesis: The Basics Transcription making RNA from DNA takes place in the nucleus Translation making protein from RNA takes place outside of the nucleus on ribosomes these may be in the cytoplasm freely, or attached to the cells endoplasmic reticulum
12 II. Protein Synthesis: Translation the basics 1. mrna and trna come together at the ribosome = initiation 2. trna brings the an amino acid based on the mrna codon (the 3 mrna bases that code for a specific amino acid) = elongation 3. The amino acids attach together to form a protein, and according to the directions will be released = termination
13 II. Protein Synthesis: Translation the details Step 1: Initiation 1 st - the small ribosomal unit binds to the mrna 2 nd - a special trna recognizes start codon on mrna & binds to it with amino acid 3rd the large ribosomal unit binds to the group, forming the initiation complex
14 II. Protein Synthesis: Translation the details Step 2: Elongation the next codon specifies which amino acid-carrying trna (if it is carrying a trna it is called charged ) will bind to it ribosome facilitates the binding between the amino acids, the shifting of the mrna and release of the discharged trna.
15 II. Protein Synthesis: Translation the details Step 3: Termination 1 st the ribosome complex reaches a stop codon & a release factor binds to the stop codon 2 nd this releases the polypeptide and the trna 3 rd all units dissociate for reuse, including the mrna
16 II. Protein Synthesis: What happens next (to the polypeptide)? The finished polypeptide chain is modified = posttranslational modification 1. the chain of polypeptides = Primary Protein Structure 2. the chain then forms folds and helices = Secondary Protein Structure 3. then the folds & helices fold on and around each other = Tertiary Protein Structure 4. multiple tertiary proteins can join = Quaternary Protein Structure
17 III. The genetic code The link between the codons in RNA & the amino acids of proteins Redundancy without ambiguity This language is shared by all living things bacteria can transcribe human DNA & human cells can translate bacterial mrna
18 A Quick Big Picture Review
19
Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
DNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
I. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
Protein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
Chapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
Lecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
Key Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
Review of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
Biology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
Which Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<<
Which Process Is The First Step In Making A Protein From Dna Instructions How do the instructions in DNA reach the ribosomes in the cytoplasm? RNA is needed for Then it helps build the protein. RNA is
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
Protein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
The Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
Section 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
CHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
The Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
The Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation
How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A
Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
PROTEIN SYNTHESIS. Higher Level
PROTEIN SYNTHESIS Higher Level Lesson Objectives At the end of this lesson you should be able to 1. Outline the steps in protein synthesis 2. Understand DNA contains the code for protein 3. Understand
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
Gene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
Biology A: Chapter 9 Annotating Notes Protein Synthesis
Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side
Chapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
Protein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
Fermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
Make the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
RNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
Protein Synthesis 101
Protein Synthesis 101 What is DNA? - Blueprint of Life (has the instructions for making ) - Gene = a segment of DNA which determines a ( ) - - is wrapped around protein to form - Structure was discovered
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
Quick Review of Protein Synthesis
Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help
What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
From DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
Chapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
Chapter 7: Genetics Lesson 7.1: From DNA to Proteins
Chapter 7: Genetics Lesson 7.1: From DNA to Proteins The spiral structure in the picture is a large organic molecule. Can you guess what it is? Here s a hint: molecules like this one determine who you
From DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis
Bio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
Big Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
Ch. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
Protein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
Chapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis
The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis For example, protein synthesis in human mitochondria relies on a genetic code that Leder and Nirenberg were able
Gene Expression: From Genes to Proteins
The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing
Sections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
Transcription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
DNA Model Stations. For the following activity, you will use the following DNA sequence.
Name: DNA Model Stations DNA Replication In this lesson, you will learn how a copy of DNA is replicated for each cell. You will model a 2D representation of DNA replication using the foam nucleotide pieces.
DNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016
Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red
DNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
Chapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
DNA: STRUCTURE AND REPLICATION
DNA: STRUCTURE AND REPLICATION DNA was known to be a chemical in cells by the end of the nineteenth century, has the capacity to store genetic information, and can be copied and passed from generation
Module 6 Microbial Genetics. Chapter 8
Module 6 Microbial Genetics Chapter 8 Structure and function of the genetic material Genetics science of o Study of what genes are, how they determine the characteristics of an organism, how they carry
Chapter 17: From Gene to Protein
Name Period Chapter 17: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to
BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
Chapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
Section 3: DNA Replication
Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication
Protein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
BIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
Key Concepts. Ø DNA Replication Ø Protein Synthesis Ø Transcription: Ø Translation: Ø messenger RNA (mrna)
Heredity B-4.3 Explain how DNA functions as the code of life and the blueprint for proteins. (Focus on DNA replication) B-4.4: Summarize the basic process involved in protein synthesis (including transcription
3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari
Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...
BEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
Chapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
Read and take notes on pages
Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have
DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
Thr Gly Tyr. Gly Lys Asn
Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human
DNA. Essential Question: How does the structure of the DNA molecule allow it to carry information?
DNA Essential Question: How does the structure of the DNA molecule allow it to carry information? Fun Website to Explore! http://learn.genetics.utah.edu/content/molecules/ DNA History Griffith Experimented
molecular genetics notes 2013_14 filled in.notebook February 10, 2014
Feb 3 8:11 AM 1 Chapters 12 & 13: Molecular Genetics (pg. 338 389) Section 12.1: The Role of DNA I. The Main Functions of DNA A. Figure 12 4 (p. 342) B. DNA must be capable of: 1. Information 2. Information
Lesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
Chapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
Protein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
Click here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
DNA, Genes & Biotechnology. Chapter 5
DNA, Genes & Biotechnology Chapter 5 What is DNA? (remember?!) DNA = deoxyribose nucleic acid Macromolecule that stores information Contains instructions for building all structures for all living things
Transcription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
Videos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS
AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION
Protein Synthesis Foldable
Ameoba Sisters Protein Synthesis Foldable Transcription What? How? What are the steps? Location? Why? Draw a picture to represent this. Translation What? How? What are the steps? Location? Why? Draw a
Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
DNA, RNA and protein synthesis
DNA, RNA and protein synthesis DNA is deoxyribonucleic acid DNA contains all the genetic instructions for making proteins within the cell. Each DNA molecule is made of repeating subunits called nucleotides.
A. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix