HC70AL Spring An Introduction to Bioinformatics -- Part I. Brandon Le. April 6, What is a Gene? An ordered sequence of nucleotides

Gene Identification in silico

Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

DNA is normally found in pairs, held together by hydrogen bonds between the bases

Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

BLAST. Subject: The result from another organism that your query was matched to.

BLAST (Basic Local Alignment Search Tool) Note: This is a complete transcript to the powerpoint. It is good to read through this once to understand everything. If you ever need help and just need a quick

SAMPLE LITERATURE Please refer to included weblink for correct version.

Edvo-Kit #340 DNA Informatics Experiment Objective: In this experiment, students will explore the popular bioninformatics tool BLAST. First they will read sequences from autoradiographs of automated gel

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1)

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) 1.1 Finding a gene using text search. Note: For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium.

Aaditya Khatri. Abstract

Abstract In this project, Chimp-chunk 2-7 was annotated. Chimp-chunk 2-7 is an 80 kb region on chromosome 5 of the chimpanzee genome. Analysis with the Mapviewer function using the NCBI non-redundant database

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases

Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing

Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources

Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources Navreet Kaur M.Tech Student Department of Computer Engineering. University College of Engineering, Punjabi

DNA - The Double Helix

DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

What Are the Chemical Structures and Functions of Nucleic Acids?

THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

Finding Genes, Building Search Strategies and Visiting a Gene Page

Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use

Finding Genes, Building Search Strategies and Visiting a Gene Page

Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use

GENETICS and the DNA code NOTES

GENETICS and the DNA code NOTES BACKGROUND DNA is the hereditary material of most organisms. It is an organic compound made of two strands, twisted around one another to form a double helix. Each strand

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

DNA, Genes and Chromosomes. Vocabulary

Vocabulary Big Ideas Heredity and Reproduction Understand and explain that every organism requires a set of instructions that specifies its traits, that this hereditary information (DNA) contains genes

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

DNA Function: Information Transmission

DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

Gene Expression. Student:

Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the

Chapter 13. From DNA to Protein

Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

Ch 10.4 Protein Synthesis

Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains

DNA - The Double Helix

DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,

BIOB111 - Tutorial activity for Session 13

BIOB111 - Tutorial activity for Session 13 General topics for week 7 Session 13: Types of nucleic acids, DNA replication Useful links: 1. Visit this website and use its menu to locate information and practice

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

DNA - The Double Helix

Name Date Period DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including

DNA - The Double Helix

DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,

Review of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein

Section 1.8 Question of the Day: Name: Review of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein New Information: One of the most important

Developmental Biology BY1101 P. Murphy

Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision

Name: Date: Pd: Nucleic acids

Name: Date: Pd: DNA - The Double Helix Nucleic acids Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of

BLAST. Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences.

BLAST Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences. An example could be aligning an mrna sequence to genomic DNA. Proteins are frequently composed of

Algorithms in Bioinformatics

Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University

Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)

Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA

Bundle 5 Test Review

Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

Transcription. DNA to RNA

Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

Nucleic acids. What important polymer is located in the nucleus? is the instructions for making a cell's.

Nucleic acids DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)

Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence

Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012

Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

Hands-On Four Investigating Inherited Diseases

Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018

Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

Protein Synthesis

HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

AGENDA for 10/10/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES: Due Fri, 10-11

AGENDA for 10/10/13 AGENDA: 1. 1.2.3 DNA Analysis Analyzing DNA Samples Using Current Forensic Methods OBJECTIVES: 1. Demonstrate the steps of gel electrophoresis 2. Analyze restriction fragment length

Nucleic acids and protein synthesis

THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate

1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).

1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

DNA Structure & the Genome. Bio160 General Biology

DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:

Big Idea 3C Basic Review

Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

Components of DNA. Components of DNA. Aim: What is the structure of DNA? February 15, DNA_Structure_2011.notebook. Do Now.

Aim: What is the structure of DNA? Do Now: Explain the Hershey Chase experiment and what was its conclusion? Homework Read pp. 298 299 P.299 3,4,6.7 Do Now Paperclip Combos Material: 8 paperclips, 2 each

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

Chimp Sequence Annotation: Region 2_3

Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

AGENDA for 10/11/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES:

AGENDA for 10/11/13 AGENDA: 1. Finish 1.2.3 DNA Analysis Analyzing DNA Samples Using Current Forensic Methods OBJECTIVES: 1. Demonstrate the steps of gel electrophoresis 2. Analyze restriction fragment

Some types of Mutagenesis

Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence

Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader

O C. 5 th C. 3 rd C. the national health museum

Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,

Transcription and Translation

Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:

BLASTing through the kingdom of life

Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology

The structure, type and functions of a cell are all determined by chromosomes:

DNA Basics The structure, type and functions of a cell are all determined by chromosomes: They are found in the nucleus of a cell. These chromosomes are composed of DNA, the acronym for deoxyribonucleic

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]

BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base

DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

Ch Molecular Biology of the Gene

Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

Agenda. Annotation of Drosophila. Muller element nomenclature. Annotation: Adding labels to a sequence. GEP Drosophila annotation projects 01/03/2018

Agenda Annotation of Drosophila January 2018 Overview of the GEP annotation project GEP annotation strategy Types of evidence Analysis tools Web databases Annotation of a single isoform (walkthrough) Wilson

Wednesday, November 22, 17. Exons and Introns

Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed

Student Learning Outcomes (SLOS)

Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression

Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia

Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

DNA - DEOXYRIBONUCLEIC ACID

DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating

The common structure of a DNA nucleotide. Hewitt

GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC

Data Retrieval from GenBank

Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13

http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino