ONLINE BIOINFORMATICS RESOURCES
|
|
- Alannah Martin
- 6 years ago
- Views:
Transcription
1 Dedan Githae BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014
2 The larger picture.. Lower cost, Improved efficiency and modern technology: The sequencers, computers, and rate at which data is being produced have all increased in speed - huge amounts of biological data produced at a FASTER rate than interpreted. Storage and Exchange of data: Need to improve database design, develop better software for database access / manipulation, harmonize data-entry procedures to compensate for the varied computer procedures and systems used in different laboratories Computing power, access to information (data) and right software (tools) has enabled scientists increase rate at answering research questions and new discoveries
3 Online Bioinformatics resources INFORMATION Journals / publications, biological research data. TOOLS Programs to analyse data
4 Information Journal Website: Almost every major journal has a web access to abstracts is usually free, even when the content is subscription. E-journals: Some electronic journals are online-only journals; some are online versions of printed journals, and some consist of the online equivalent of a printed journal, but with additional online-only (sometimes video and interactive media) material.
5 Information Servers (eg NCBI Pubmed; Google scholar; SCOPUS) A search engine to search references and abstracts on life sciences and biomedical topics in multiple databases
6 Sequence Databases Primary Databases: International Nucleotide Sequence Database Collaboration comprises of GenBank (USA), European Nucleotide Archive (Europe) and DNA DataBase of Japan. They cooperate to make all publicly available sequences available.
7 Sequence Databases Secondary Databases UniProt: It is a database of protein sequence and functional information. Information about the biological function of proteins derived from the research literature Available under Uniprot SWISS PROT: Manually annotated and reviewed TrEMBL: Automatically annotated and not reviewed. Uniprot:
8 Other Databases Multigenome: ensembl: genome databases for vertebrates and other eukaryotic species, Genome specific databases: eg Wormbase; Saccharomyces database; Vectorbase; Flu DB; Zebrafish Model Organisms, Flybase etc. NB: You can also access to these genomes from the public databases Biochemical pathway databases: Biological activities are orchestrated by various molecules These include KEGG; ExPASY; MetaCyc; BioPath Gene expression Data: DNA Microarrays: array of probe molecules that can bind specific DNA / mrna. Fluorolabelling enables viewing level of expression of genes; eg NCBI Geo (Gene experssion omnibus) Expression Atlas (EBI) 2D PAGE: allows quantitative study of protein concentration in the cell. Eg SWISS-2D PAGE KEGG:
9 Protein Structure Databases Protein Databank (PDB) (experimentally validated) Secondary & Others: ModBase: A database of annotated comparative protein structure models Modelled proteins) SCOP: Structural classification of Proteins Depending on α ; β ; α+β ; membrane & cell surface proteins; small proteins; coiled coil proteins, etc CATH: hierarchical domain classification of protein structures in the Protein Data Bank (Class Architecture Topology Homologous superfamilies)
10 Softwares / Tools Sources of (informative) tools: Journals eg Bioinformatics, Nucleic Acids Research, Journal of Molecular Biology, Protein science publish papers on cutting edge developments and innovations in computational biology methods Most biological databases have software resource listings- eg Sequence searching, visualisation resources (genome / alignment / genome level). Web servers: Simple web implementation of the softwares. Clear inputs, outputs, parameters, graphical data representation and downloadable results.
11 Basic tasks Task Objective Tool Sequence similarity Sequence alignment Gene finding DNA Translation Local pairwise alignment Global pairwise alignment Identify homologous sequences to gain information Identify conserved regions, domains, motifs Identify coding regions in gdna sequences Convert DNA Sequence to protein Detect short regions of homology in longer sequences Find the best full length alignment in 2 sequences BLAST; SSEARCH; FASTA, ENA search CLUSTAL; Muscle; GENSCAN; ORFinder; GRAIL Various servers and tools eg ExPasy, Transeq, EBI, and ORFinders BLAST; FASTA ALIGN
12
13
14 Protein Domains A protein domain is a conserved part of a given protein sequence and structure that can evolve, function, and exist independently of the rest of the protein chain. Molecular evolution uses domains as building blocks and these may be recombined in different arrangements to create proteins with different functions. Databases include: SMART; PROSITE; NCBI; CATH GLYCINAMIDE RIBONUCLEOTIDE SYNTHETASE (GAR-SYN) FROM E. COLI.
15 Motifs A motif is a locally, conserved region / short sequence pattern shared by set of sequence; (Multiple sequence analysis) Thus can be indicative of function / structural similarities. Can be displayed via Sequence logos, or as patterns of amino acids. Patterns of amino acids [PROSITE]: For example N-glycosylation site motif takes the form: N{P}[ST]{P} To mean: Asn, followed by anything but Pro, followed by either Ser or Thr, followed by anything but Pro
16 DSSP: Wolfgang Kabsch and Chris Sander EXPASY: seconadary structure prediction JPRED 3: from university of Dundee PDB: DSSP prediction
17 Honorable mention About PredictProtein PredictProtein integrates feature prediction for secondary structure, solvent accessibility, transmembrane helices, globular regions, coiled-coil regions, structural switch regions, B-values, disorder regions, intraresidue contacts, protein-protein and protein-dna binding sites, sub-cellular localization, domain boundaries, beta-barrels, cysteine bonds, metal binding sites and disulphide bridges. Listed below is a comprehensive list of methods and databases currently incorporated into the server.
18 Integrated Methods Method Name Description Reference Web Server Download PROFphd Prediction of secondary structure and solvent accessibility - - ftp://rostlab.org/profphd PHDhtm Prediction of transmembrane helices - - ftp://rostlab.org/profphd PROFtmb Prediction of transmembrane beta-barrels - - ftp://rostlab.org/proftmb NORSp Predictor of non-regular secondary structure - - ftp://rostlab.org/norsp NCOILS Calculates the probability that the sequence will adopt a coiled-coil conformation SEG Identifies low complexity regions DISULFIND Prediction of disulfide bridges - - ftp://rostlab.org/profbval PROFBval Prediction of residue mobility - - ftp://rostlab.org/profbval NorsNet Prediction protein disordered sites - - ftp://rostlab.org/norsnet UCON Contact based prediction of disordered sites - - METADISORDER Consensus based prediction of protein disorder - - ISIS Prediction of protein-protein interaction sites - - LocTree2 Prediction of sub-cellular localization for all domains of life MetaStudent Prediction of GO terms for Molecular Function and Biological Process - - ftp://rostlab.org/metastudent SNAP2 Prediction of functional changes due to single nucleotide polymorphism ConSurf Prediction of functional changes due to single nucleotide polymorphism Supporting Databases Database Name Description Reference Download UniRef Used for sequence homology searches by PSI-BLAST abstract PDB The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwpdb, the RCSB PDB curates and annotates PDB data according to agreed upon standards. abstract Pfam A collection of protein families abstract ftp://ftp.sanger.ac.uk/pub/databases/pfam/releases/ PROSITE Database of biologically significant sites, patterns and profiles abstract ftp://ftp.expasy.org/databases/prosite/
19 In a Nutshell There is vast amount of available out there. There is a vast number of tools out there.. Select best that is applicable for your project..
20 Thank you Dedan Githae Bioinformatician BecA-ILRI Hub Online Bioinformatics resources
Protein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationProtein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More informationWeb-based Bioinformatics Applications in Proteomics
Web-based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu January 30, 2009 NCBI (National Center for Biotechnology Information) http://www.ncbi.nlm.nih.gov/ 1 Pubmed
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationThis practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.
PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationI nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationKlinisk kemisk diagnostik BIOINFORMATICS
Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationProtein structure. Wednesday, October 4, 2006
Protein structure Wednesday, October 4, 2006 Introduction to Bioinformatics Johns Hopkins School of Public Health 260.602.01 J. Pevsner pevsner@jhmi.edu Copyright notice Many of the images in this powerpoint
More informationBiological databases an introduction
Biological databases an introduction By Dr. Erik Bongcam-Rudloff SLU 2017 Biological Databases Sequence Databases Genome Databases Structure Databases Sequence Databases The sequence databases are the
More informationProtein Structure Databases, cont. 11/09/05
11/9/05 Protein Structure Databases (continued) Prediction & Modeling Bioinformatics Seminars Nov 10 Thurs 3:40 Com S Seminar in 223 Atanasoff Computational Epidemiology Armin R. Mikler, Univ. North Texas
More informationBioinformatics & Protein Structural Analysis. Bioinformatics & Protein Structural Analysis. Learning Objective. Proteomics
The molecular structures of proteins are complex and can be defined at various levels. These structures can also be predicted from their amino-acid sequences. Protein structure prediction is one of the
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationWeb based Bioinformatics Applications in Proteomics. Genbank
Web based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu February 9, 2010 Genbank Primary nucleic acid sequence database Maintained by NCBI National Center for Biotechnology
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationBiological databases an introduction
Biological databases an introduction By Dr. Erik Bongcam-Rudloff SGBC-SLU 2016 VALIDATION Experimental Literature Manual or semi-automatic computational analysis EXPERIMENTAL Costs Needs skilled manpower
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationSince 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL
Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationFACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE
FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)
More informationGenome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita
Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: January 16, 2013 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationBIOLOGY 200 Molecular Biology Students registered for the 9:30AM lecture should NOT attend the 4:30PM lecture.
BIOLOGY 200 Molecular Biology Students registered for the 9:30AM lecture should NOT attend the 4:30PM lecture. Midterm date change! The midterm will be held on October 19th (likely 6-8PM). Contact Kathy
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationB I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
More informationAccess to Information from Molecular Biology and Genome Research
Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationMOL204 Exam Fall 2015
MOL204 Exam Fall 2015 Exercise 1 15 pts 1. 1A. Define primary and secondary bioinformatical databases and mention two examples of primary bioinformatical databases and one example of a secondary bioinformatical
More informationIntroduction to EMBL-EBI.
Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,
More informationLecture 7 Motif Databases and Gene Finding
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC
More informationBioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases
Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence
More informationDina El-Khishin (Ph.D.) Bioinformatics Research Facility. Deputy Director of AGERI & Head of the Genomics, Proteomics &
Dina El-Khishin (Ph.D.) Deputy Director of AGERI & Head of the Genomics, Proteomics & Bioinformatics Research Facility Agricultural Genetic Engineering Research Institute (AGERI) Giza EGYPT Bioinformatics
More informationG4120: Introduction to Computational Biology
ICB Fall 2004 G4120: Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Copyright 2004 Oliver Jovanovic, All Rights Reserved. Analysis of Protein Sequences Coding
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More information1-D Predictions. Prediction of local features: Secondary structure & surface exposure
Programme 8.00-8.30 Last week s quiz results 8.30-9.00 Prediction of secondary structure & surface exposure 9.00-9.20 Protein disorder prediction 9.20-9.30 Break get computers upstairs 9.30-11.00 Ex.:
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationRESEARCH METHODOLOGY, BIOSTATISTICS AND IPR
MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
More informationAn insilico Approach: Homology Modelling and Characterization of HSP90 alpha Sangeeta Supehia
259 Journal of Pharmaceutical, Chemical and Biological Sciences ISSN: 2348-7658 Impact Factor (SJIF): 2.092 December 2014-February 2015; 2(4):259-264 Available online at http://www.jpcbs.info Online published
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationOutline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
More informationVALLIAMMAI ENGINEERING COLLEGE
VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year 2018-19 Prepared
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationG4120: Introduction to Computational Biology
ICB Fall 2009 G4120: Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology & Immunology Copyright 2009 Oliver Jovanovic, All Rights Reserved. Analysis of Protein
More informationComputational methods in bioinformatics: Lecture 1
Computational methods in bioinformatics: Lecture 1 Graham J.L. Kemp 2 November 2015 What is biology? Ecosystem Rain forest, desert, fresh water lake, digestive tract of an animal Community All species
More information!"#$!"#$%&'&()#*'+*,-*%#".+/&0+("%&1)#.+*%,+#')%)#.
Bioinformatics Contents Examples of biological databases " Nucleic sequences: Genbank, EMBL, and DDBJ " Protein sequences: UniProt " The Gene Ontology (GO) project Issues and perspectives for biological
More informationCMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS
CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS (Computational Structural Biology) OUTLINE Review: Molecular biology Proteins: structure, conformation and function(5 lectures) Generalized coordinates,
More informationWill discuss proteins in view of Sequence (I,II) Structure (III) Function (IV) proteins in practice
Will discuss proteins in view of Sequence (I,II) Structure (III) Function (IV) proteins in practice integration - web system (V) 1 Touring the Protein Space (outline) 1. Protein Sequence - how rich? How
More informationCompiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology
Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four
More informationFunctional analysis using EBI Metagenomics
Functional analysis using EBI Metagenomics Contents Tutorial information... 2 Tutorial learning objectives... 2 An introduction to functional analysis using EMG... 3 What are protein signatures?... 3 Assigning
More informationComputational Biology and Bioinformatics
Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management
More informationProtein Bioinformatics PH Final Exam
Name (please print) Protein Bioinformatics PH260.655 Final Exam => take-home questions => open-note => please use either * the Word-file to type your answers or * print out the PDF and hand-write your
More informationBGGN 213: Foundations of Bioinformatics (Fall 2017)
BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on
More informationFunction Prediction of Proteins from their Sequences with BAR 3.0
Open Access Annals of Proteomics and Bioinformatics Short Communication Function Prediction of Proteins from their Sequences with BAR 3.0 Giuseppe Profiti 1,2, Pier Luigi Martelli 2 and Rita Casadio 2
More informationG4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
More informationBioinformatics. Biomolecular databases
Bioinformatics Biomolecular databases Jacques van HeldenFORMER ADDRESS (1999-2011) Université Libre de Bruxelles, Belgique Bioinformatique des Génomes et des Réseaux (BiGRe lab) http://www.bigre.ulb.ac.be/
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationNiceProt View of Swiss-Prot: P18907
Hosted by NCSC US ExPASy Home page Site Map Search ExPASy Contact us Swiss-Prot Mirror sites: Australia Bolivia Canada China Korea Switzerland Taiwan Search Swiss-Prot/TrEMBL for horse alpha Go Clear NiceProt
More informationThe Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro
Comparative and Functional Genomics Comp Funct Genom 2003; 4: 71 74. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.235 Conference Review The Gene Ontology Annotation
More informationCommunity-assisted genome annotation: The Pseudomonas example. Geoff Winsor, Simon Fraser University Burnaby (greater Vancouver), Canada
Community-assisted genome annotation: The Pseudomonas example Geoff Winsor, Simon Fraser University Burnaby (greater Vancouver), Canada Overview Pseudomonas Community Annotation Project (PseudoCAP) Past
More informationGenome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
More informationCS273: Algorithms for Structure Handout # 5 and Motion in Biology Stanford University Tuesday, 13 April 2004
CS273: Algorithms for Structure Handout # 5 and Motion in Biology Stanford University Tuesday, 13 April 2004 Lecture #5: 13 April 2004 Topics: Sequence motif identification Scribe: Samantha Chui 1 Introduction
More informationCFSSP: Chou and Fasman Secondary Structure Prediction server
Wide Spectrum, Vol. 1, No. 9, (2013) pp 15-19 CFSSP: Chou and Fasman Secondary Structure Prediction server T. Ashok Kumar Department of Bioinformatics, Noorul Islam College of Arts and Science, Kumaracoil
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationCHEM 436 / 630. Molecular modelling of proteins. Winter 2018 Term. Instructor: Guillaume Lamoureux Concordia University, Montréal, Canada
CHEM 436 / 630 Molecular modelling of proteins Winter 2018 Term Instructor: Guillaume Lamoureux Concordia University, Montréal, Canada Syllabus: http://faculty.concordia.ca/glamoure/pdfs/chem436_630_syllabus_2018.pdf
More informationBrowsing Genomes with Ensembl Genomes
Browsing Genomes with Ensembl Genomes www.ensemblgenomes.org Coursebook http://www.ebi.ac.uk/~blaise/beca BECA- ILRI 16 th October 2013 Chat room: http://tinyurl.com/ensembl-nairobi TABLE OF CONTENTS Introduction
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationEE550 Computational Biology
EE550 Computational Biology Week 1 Course Notes Instructor: Bilge Karaçalı, PhD Syllabus Schedule : Thursday 13:30, 14:30, 15:30 Text : Paul G. Higgs, Teresa K. Attwood, Bioinformatics and Molecular Evolution,
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationThe RNA tools registry
university of copenhagen f a c u lt y o f h e a lt h a n d m e d i c a l s c i e n c e s The RNA tools registry A community effort to catalog RNA bioinformatics resources and their relationships Anne Wenzel
More informationHow to use Variant Effects Report
How to use Variant Effects Report A. Introduction to Ensembl Variant Effect Predictor B. Using RefSeq_v1 C. Using TGACv1 A. Introduction The Ensembl Variant Effect Predictor is a toolset for the analysis,
More informationTranslating Biological Data Sets Into Linked Data
Translating Biological Data Sets Into Linked Data Mark Tomko Simmons College, Boston MA The Broad Institute of MIT and Harvard, Cambridge MA September 28, 2011 Overview Why study biological data? UniProt
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationSequence Analysis. Introduction to Bioinformatics BIMMS December 2015
Sequence Analysis Introduction to Bioinformatics BIMMS December 2015 abriel Teku Department of Experimental Medical Science Faculty of Medicine Lund University Sequence analysis Part 1 Sequence analysis:
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationMetabolism and metabolic networks. Metabolism is the means by which cells acquire energy and building blocks for cellular material
Metabolism and metabolic networks Metabolism is the means by which cells acquire energy and building blocks for cellular material Metabolism is organized into sequences of biochemical reactions, metabolic
More informationSequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases
Chapter 2 Paul Rangel Abstract DNA and Protein sequence databases are the cornerstone of bioinformatics research. DNA databases such as GenBank and EMBL accept genome data from sequencing projects around
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationBrowsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Emily Perry Ensembl Outreach Project Leader EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
More informationSTRUCTURAL BIOLOGY. α/β structures Closed barrels Open twisted sheets Horseshoe folds
STRUCTURAL BIOLOGY α/β structures Closed barrels Open twisted sheets Horseshoe folds The α/β domains Most frequent domain structures are α/β domains: A central parallel or mixed β sheet Surrounded by α
More informationIntroduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?
More informationDatabases in genomics
Databases in genomics Search in biological databases: The most common task of molecular biologist researcher, to answer to the following ques7ons:! Are they new sequences deposited in biological databases
More informationIntroduc)on to Databases and Resources Biological Databases and Resources
Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs
More informationThe Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools
CAP 5510: Introduction to Bioinformatics : Bioinformatics Tools ECS 254A / EC 2474; Phone x3748; Email: giri@cis.fiu.edu My Homepage: http://www.cs.fiu.edu/~giri http://www.cs.fiu.edu/~giri/teach/bioinfs15.html
More informationBIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM)
BIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM) Note: This material is adapted from Web-based Bioinformatics Tutorials: Exploring Genomes by
More informationHomology Modelling. Thomas Holberg Blicher NNF Center for Protein Research University of Copenhagen
Homology Modelling Thomas Holberg Blicher NNF Center for Protein Research University of Copenhagen Why are Protein Structures so Interesting? They provide a detailed picture of interesting biological features,
More informationStructure & Function. Ulf Leser
Proteins: Structure & Function Ulf Leser This Lecture Introduction Structure Function Databases Predicting Protein Secondary Structure Many figures from Zvelebil, M. and Baum, J. O. (2008). "Understanding
More informationab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More information