Specialized Transduction of Pseudomonas aeruginosa PAO by Bacteriophage D3
|
|
- Reynard Cameron
- 6 years ago
- Views:
Transcription
1 JOURNAL OF BACTEROLOGY, Feb. 1986, p /86/2448-5$2./ Copyright X3 1986, Americn Society for Microbiology Vol. 165, No. 2 Specilized Trnsduction of Pseudomons eruginos PAO by Bcteriophge D3 MARGARET M. CAVENAGH AND ROBERT V. MLLER* Deprtment of Biochemistry nd Biophysics nd The Progrm in Moleculr Biology, Stritch School of Medicine, Loyol University of Chicgo, Mywood, llinois 6153 Received 26 July 1985/Accepted 18 November 1985 D3, temperte bcteriophge of Pseudomons er*ginos PAO, ws found to specificlly trnsduce the lleles met-49 nd. nduction of estblished lysogens with UV light ws necessry for the production of trnsducing lystes. Trnsduced cells were immune to superinfection by phge D3 nd could give rise to high-frequency trnsducing lystes. Cotrnsduction of these two lleles could not be demonstrted. ws mpped to 26 min on the PAO genetic mp. Complementtion studies using thp generlized trnsducing phge F116L indicted tht met-49 is n llele of met-911 which mps t 55 min. The integrted D3 prophge ws shown to be coinherited with nd with met-49. Although there re mny temperte phges of Pseudomons eruginos nd the frequency of lysogeny mong P. eruginos strins is probbly close to 1%, no cses of prophge-linked specilized trnsduction in this species hve been reported (9, 1, 13). D3, first isolted in 196 by Hollowy et l. (11), is temperte bcteriophge of P. eruginos PAO which hs polyhedrl hed nd prominent til with six knoblike projections (2). t contins liner DNA molecule of moleculr weight 4.4 x 17 (2). The D3 prophge cn be induced to lytic growth with UV light (14). Genetic recombintion hs been demonstrted in mixed infections of plque morphology mutnts of D3 (3). The dt presented here suggest tht D3 cts s specilized trnsducing phge of P. eruginos nd tht the D3 prophge integrtes into the P. eruginos PAO chromosome t t lest two sites. MATERALS AND METHODS Bcteri nd bcteriophges. The strins used in this study re described in Tble 1. All re derivtives of P. eruginos PAO. Bcteriophges F116 nd D3 were obtined from B. W. Hollowy. F116L ws obtined from J. A. Shpiro. Medi. Luri broth ws purchsed from GBCO Lbortories, Mdison, Wis. Pseudomons miniml medium (PMM [18]) ws supplemented with.2% glucose nd mino cids s pproprite t 5 plg/ml. Ornston-Stnier medium ws s described (21), except nitrolocetic cid ws omitted. To mke pltes of ny of these medi, gr ws dded to 1.5%. Preprtion of trnsducing lystes. F116 nd F116L phges were prepred by the plte lyste method of Miller nd Ku (18). For use in trnsduction experiments, F116 or F116L ws pssed twice consecutively through the donor strin. D3 ws obtined by induction of the prophges from lysogenic P. eruginos strins by exposure to 3.5 J/m2 of UV light. Conjugtions. Time-of-entry experiments were performed ccording to the method of Hs nd Hollowy (6). They were crried out on miniml medium pltes, supplemented s needed with mino cids. PMM ws used when selecting for mino cid mrkers, nd Ornston-Stnier medium ws used for crbon source mrkers. Mtings were interrupted * Corresponding uthor. TABLE 1. Bcteril strins Strin Genotype Source or reference PAO1 Prototroph 9 PA25 rgf leu-1 22 PA283 his-i ys-12 met-28 trpc ese-i 18 PA33 rgb21 18 PA381 leu-38 str-2; FP2 22 PAO515 met-911 mie2 nla5 D. Hs PA881 rg-164 leu-8 pur-136 ese PAO1 trpa,b::pme319 his-31 str-i 6 PA167 leu-8 pur-136 rif-i ese-21; pmo171 B. W. Hollowy PA2375 met-92 ctal mtu-92 nr-911 B. W. Hollowy PT615 leu-1 rec-i2 stra; pme134b D. Hs RM17 leu-38 str-2 [D3]; FP2 D3 lysogen of PA381 RM34 cys-72 met-28 D. H. Clhoun RM4 lys-12 met-28 trpc6 pur-6 str RM42 trpb D. H. Clhoun RM44 trpa 1 RM45 met-49 1 RM46 1 RM48 met-16 1 RM49 met417 1 RM51 cys411 1 RM172 leu-38 [D3]; FP2 RM17 x RM512 RM23 rgf leu-1 nl-95 Nlr derivtive of PA25 RM268 met-92 ctal mtu-92 nr-911 Nlr derivtive nl-96 of PA2375 RM46 ys-12 met-28 trpc6 pur-6 Nlr derivtive nl-91 str-91 of RM4 RM512 Prototroph [D3] D3 lysogen of PAO1 RM23 ser-3; FP11 B. W. Hollowy RM262 met49 nl-93 dtr-91 D3r derivtive of RM45 RM263 nl-94 dtr-92 D3r derivtive of RM46 Nomenclture ccording to Royle et l. (24), with the ddition of dtr, which indictes D3 resistnce nd [D3] which indictes tht the strin is lysogenic for prophge D3. Nlr indictes resistnce to nlidixic cid, nd DY indictes resistnce to infection by phge D3. b ntegrted into the chromosome t 72 min. 448
2 VOL. 165, 1986 TABLE 2. D3-medited trnsduction of vrious lleles Recipient Mrker Mp MOb ductnts/ strin tested (min) PFU PA33 rgb <1-9 PA881 pur <1-9 RM x 1-7 RM42 trpb <1-9 RM44 trpa 27.4 < 1-9 PA283 met <1-9 PA167 leu <1-9 RM45 met x 1-7 PA283 his <1-9 RM34 cys-72? 1. <1-9 RM48 met-16? 2. <1-9 RM49 met <1-9 RM51 cys <1-9 Mp positions re from Royle et l. (24) except met49 nd, which were determined in this study. b MO, multiplicity of infection. by spreding the pltes with nlidixic cid to finl concentrtion of 25,ug/ml. For coinheritnce studies, uninterrupted mtings were crried out s described by Miller nd Ku (18). Trnsconju- SPECALZED TRANSDUCTON N P. AERUGNOSA 449 gnts inheriting donor prototrophic mrkers were selected on ppropritely supplemented miniml medi nd purified. Purified trnsconjugnts were scored for coinheritnce of the lysogeny/nonlysogeny phenotype by testing for spontneous relese of phge on n indictor strin (PAG1). Trnsductions. Cells to be trnsduced were grown in 1 ml of Luri broth to erly log phse. They were spun down nd resuspended in 5 ml of TNM buffer (.1 M Tris,.15 M NCl,.1 M MgSO4; ph 7.4). Cells were then mixed with phge nd incubted t 37 C for 1 min. The trnsduction mixtures were plted in duplicte on selective medi t desired dilutions. Trnsductnts ppered fter incubtion for 2 dys t 37 C. RESULTS Trnsductions of specific methionine lleles by phge D3. We tested number of genetic loci to determine whether they re trnsduced by bcteriophge D3 (Tble 2). Ech of the strins tested ws sensitive to phge D3, nd ech of the lleles tested ws trnsducible by the generlized trnsducing phge F116 (11, 18) t n equl efficiency (dt not shown). Only two methionine lleles, met49 nd, were found to be trnsduced by D3. While the frequency of trnsduction ws found to vry with the multiplicity of A 5s 4.PA381 met-28 B c 1 RM 23 l/ rpc o C O. E / ys c C E o m 2' 4b eb 4 8 Mting Time (min) Mting Time (min) FG. 1. nterrupted mtings. Plte mtings were interrupted with nlidixic cid fter vrious time intervls. Results for ech selected llele re presented s the frequency of recombinnts observed s function of mting time. The strins used re listed below, followed by the lleles selected. No recombinnts were recovered for lleles tht re listed s hving been selected but tht do not pper on the corresponding grph. (A) Mpping : PA381, n FP2 donor, ws crossed with RM262 (met49), RM263 (), nd RM46 (met-28 trpc). RM23, n FP11 donor, ws crossed with RM262 (met49), RM263 (), nd RM46 (met-28 lys-56). (B) Mpping met49: PAO1 nd PTO615 were crossed with RM262 (met49), RM263 (), RM23 (rgf), nd RM46 (met-28 trpc lys-s6).
3 45 CAVENAGH AND MLLER TABLE 3. Trnsductionl frequencies of met49 nd Experi- No. of Trns- Mrker ment Lyse MOb trns- ductnts/ no. no. ductntsc 17 PFU met , met-i , , , D3 ws induced by UV irrdition from RM512. b MO, multiplicity of infection. c Number of prototrophic colonies bove the level of spontneous revertnts. infection nd with the phge lyste used (Tble 3), only met49 nd met-i17 could be trnsduced by D3 lystes. The phge preprtions used for trnsductions were induced from D3 lysogens of strin PAO by irrdition with UV light. We found tht phge progeny collected fter induction of lysogen trnsduced t frequencies of 1- to 1-fold higher thn phge prepred from lytic infections of sensitive strins. Such enhnced production of trnsducing prticles by induction of lysogenic cells is chrcteristic of specilized trnsducing phges (16). At lest one trnsductnt colony ws chosen t rndom from ech of 26 seprte trnsductions nd tested for lysogeny by the methods of Miller et l. (19). All trnsductnts tested hd become lysogenic. n three seprte experiments, RM45 trnsductnts which hd been trnsduced to methionine prototrophy by D3 grown on PAO1 were induced J. BACTEROL. by exposure to UV light to relese phge. The D3 relesed ws then used to trnsduce RM45 to prototrophy. The trnsduction frequency in one of the three instnces ws incresed by fctor of 13, indicting tht high-frequency trnsducing (HFT) lystes of this phge cn be produced. Thus when D3 trnsduces cell, it usully converts tht cell to lysogen, nd the newly formed lysogens cn be used to produce HFT lystes by methods similr to those used to produce HFr lystes of phge lmbd (17). Clhoun nd Fery (1) found met-i 17 nd met49 to be in unlinked trnsductionl groups when phge F116 ws used s the trnsducing vector. We confirmed tht these mrkers re not cotrnsducible by F116. n ddition, we were unble to detect cotrnsduction of met49 with met-i 7 by D3. We conclude tht met49 nd re not tightly linked. Mp loction of nd met-49. Since neither D3 nor F116 will cotrnsduce nd met49, we wnted to determine the loction of these lleles on the P. eruginos PAO genetic mp (24). Through series of conjugtion experiments we were ble to mp met-i 1 7 to bout 27 min on the PAO chromosome (Fig. 1A). FP2 is chromosomemobilizing plsmid tht trnsfers clockwise from min on the Pseudomons chromosome mp (12). FP11 mobilizes counterclockwise from 26 min (23). n interrupted mtings medited by FP2, met-h17 ws trnsferred before met-28 nd trpc, while met49 ws not trnsferred t detectble levels (Fig. 1). FP11 did not trnsfer either or met49 s erly mrkers. This plces met-h17 between the FP11 origin of trnsfer nd the met-28 locus, nd met49 somewhere lter thn trpc (Fig. 2). PAO1 is n Hfr donor strin which mobilizes the chromosome clockwise from the trpa,b gene cluster (7). PAO1 did not mobilize, indicting tht lies between the FP11 origin of trnsfer nd the PAO1 origin, or t bout 26 min on the P. eruginos mp. PAO1 did not trnsfer met49. The met49 llele hs been locted in the mid-to-lte ys / 1 2 FP2 8 FP11 PA1 3 trpa,b met-28 trpc PT615 4 _7 6 * *- 5 * * mtu-9)2 Ct A rgf met-49 FG. 2. Genetic mp of P. eruginos PAO showing loctions of met49 nd reltive to previously mpped genes. Loctions of previously mpped genes re from Royle et l. (24) nd Fruh et l. (4).
4 VOL. 165, 1986 TABLE 4. Donor strin Trnsductionl complementtion of met49 nd met-911 Trnsductnts/18 PFU with recipient strinb: RM4 RM45 RM242 (met-28) (met49) (met-911) RM1 (prototrophic) RM45 (met49) 11. <.1 <.1 RM242 (met-911) 2.1 <.1 <.1 Strins on which F116L lystes were prepred. b Strins trnsduced by F116L to methionine prototrophy. region of the mp by conjugting with the donor PT615 (Fig. 1B). PT615 is n Hfr donor which ws constructed by D. Hs by the insertion of the chromosome-mobilizing plsmid pme134 in unique orienttion t 72 min (personl communiction). PT615 dontes chromosome in counterclockwise direction strting t 72 min on the PAO mp (24). n interrupted mtings between PT615 nd RM268, we observed essentilly complete trnsfer of mtu-92 nd ctal t our erliest time point (dt not shown). n other crosses (Fig. 1B), met49 ws trnsferred while rgf ws not. Therefore met49 lies between rgf (45 min) nd cta (63 min). F116L trnsductionl nlysis (Tble 4) indicted tht met49 is very tightly linked to met-911, which mps t 55 min (4), suggesting tht met49 nd met-911 re lleles of the sme gene. Site of integrtion of the D3 prophge. As the D3 prophge must be induced before significnt levels of trnsduction of specific lleles cn be observed, it seemed likely tht the D3 prophge integrtes ner the loci which it trnsduces. We tested this possibility by crrying out uninterrupted mtings between lysogenic donor strins nd recipients which were resistnt to the phge under study. The resistnce of the SPECALZED TRANSDUCTON N P. AERUGNOSA 451 recipient strin to the phge ensured tht lysogeniztion could not tke plce by dsorption of free phge which might be relesed by the lysogenic donor. Lysogeniztion ws restricted to cquisition of the phge through trnsfer of the prophge during conjugtion. Preliminry tests for zygotic induction of the D3 prophge indicted tht this phenomenon did not tke plce under the conditions used in our mting experiments (dt not shown). n FP2-medited conjugtions, the D3 prophge ws coinherited with. Donor strin RM17 ws mixed with recipient RM263, nd methionine prototrophs were selected. Of these, 317 were streked out for single colonies nd tested for cquisition of D3 prophge. Of the recipients tht hd cquired, 315 (99%) hd concurrently inherited the D3 prophge. Similr experiments were done using RM172 s donor nd selecting for vrious other genetic mrkers, including met49 (Fig. 3). The D3 prophge ws found to be coinherited with high frequency with genes in the 2- to 3-min region of the genetic mp nd with met49. DSCUSSON This is the first reported exmple of specilized trnsducing phge in P. eruginos PAO. The two genes which it trnsduces re widely seprted on the chromosome, nd the D3 prophge integrtes djcent to both these genes. Crey nd Krishnpilli (2) hve reported tht phge H9 integrtes into the P. eruginos PAO chromosome t 7 min. They were unble to demonstrte specilized trnsduction by this virus. Mny of the properties of phge D3 re similr to those of other specilized trnsducing phges (5, 16). The estblishment of lysogeny followed by the induction of estblished prophge is necessry for the production of trnsducing prticles. Like coliphge lmbd, this induction ppers to require tht the host hve Rec+ phenotype nd suggests tht protein similr to the reca gene product of Escherichi 1, pur-136 met-49 so cx - 6 C - 2^ or ys-12 trpb met -28 ilvb ttrpc Mp Position (minutes) FG. 3. Coinheritnce of selected lleles with the D3 prophge. See the text for experimentl detils.
5 452 CAVENAGH AND MLLER coli is required for UV-light-stimulted induction (15). This dependence is further emphsized by the fct tht severl muttions which reduce the recombintionl proficiency of P. eruginos lso reduce the bility of phge D3 to estblish lysogeny (8, 18, 25). The D3 prophge integrtes into the host chromosome t minimum of two sites which re closely linked to the loci which it trnsduces. Trnsductnts pper to be lysogens of prophge D3, nd HFT lystes cn be produced from trnsduced clones. These dt suggest tht trnsducing prticles contin both bcteril nd phge DNA nd tht the insertion of the bcteril frgment does not eliminte essentil phge genes (i.e., trnsducing prticles re not defective). The identifiction of specilized trnsducing phge of P. eruginos provides n opportunity to ddress myrid of questions concerning the genetics nd biochemistry of this orgnism. ACKNOWLEDGMENTS We thnk D. H. Clhoun, G. A. Jcoby, D. Hs, nd B. W. Hollowy for the kind gifts of mny of the strins used in this study. This work ws supported in prt by grnt from the Pott's Fund of the Stritch School of Medicine, Loyol University of Chicgo, nd by Public Helth Service grnt A from the Ntionl nstitute of Allergy nd nfectious Disese. LTERATURE CTED 1. Clhoun, D. H., nd T. W. Fery Trnsductionl nlysis of Pseudomons eruginos methionine uxotrophs. J. Bcteriol. 97: Crey, K. E., nd V. Krishnpilli Loction of prophge H9 on the chromosome of Pseudomons eruginos PAO. Genet. Res. 23: Egn, J. B., nd B. W. Hollowy Genetic studies on lysogeny in Pseudomons eruginos. Aust. J. Exp. Biol. 39: Fruh, R., J. M. Wtson, nd D. Hs Construction of recombintion-deficient strins of Pseudomons eruginos. Mol. Gen. Genet. 191: Gottesmn, M. E., nd R. A. Weisberg Prophge insertion nd excision, p n A. P. Hershey (ed.), The bcteriophge lmbd. Cold Spring Hrbor Lbortory, Cold Spring Hrbor, N.Y. 6. Hs, D., nd B. W. Hollowy R fctor vrints with enhnced sex fctor ctivity in Pseudomons eruginos. Mol. Gen. Genet. 144: Hs, D., J. Wtson, R. Krieg, nd T. Leisinger soltion of n Hfr donor of Pseudomons eruginos PAO by insertion of the plsmid RP1 into the tryptophn synthse gene. Mol. Gen. Genet. 182: J. BACTEROL. 8. Hollowy, B. W Mutnts of Pseudomons eruginos with reduced recombintion bility. Mutt. Res. 3: Hollowy, B. W Genetics of Pseudomons. Bcteriol. Rev. 33: Hollowy, B. W Genetic orgniztion of Pseudomons, p n P. H. Clrke nd M. H. Richmond (ed.), Genetics nd biochemistry of Pseudomons. John Wiley & Sons, Ltd., London. 11. Hollowy, B. W., J. B. Egn, nd M. Monk Lysogeny in Pseudomons eruginos. Aust. J. Exp. Biol. 38: Hollowy, B. W., nd P. A. Jennings An infectious fertility fctor for Pseudomons eruginos. Nture (London) 181: Hollowy, B. W., nd V. Krishnpilli Bcteriophges nd bcteriocins, p n P. H. Clrke nd M. H. Richmond (ed.), Genetics nd biochemistry of Pseudomons. John Wiley & Sons, Ltd., London. 14. Hollowy, B. W., nd P. vn de Putte Lysogeny nd bcteril recombintion, p n W. J. Pecock nd R. D. Brock (ed.), Repliction nd recombintion of genetic mteril. Austrlin Acdemy of Science, Cnberr. 15. Kokjohn, T. A., nd R. V. Miller Moleculr cloning nd chrcteriztion of the reca gene of Pseudomons eruginos PAO. J. Bcteriol. 163: Lewin, B Gene expression-3: plsmids nd phges. John Wiley & Sons, nc., New York. 17. Miller, J. H Experiments in moleculr genetics. Cold Spring Hrbor Lbortory, Cold Spring Hrbor, NY. 18. Miller, R. V., nd C.-M. C. Ku Chrcteriztion of Pseudomons eruginos mutnts deficient in the estblishment of lysogeny. J. Bcteriol. 134: Miller, R. V., J. M. Pemberton, nd A. J. Clrk Prophge F116: evidence for extrchromosoml loction in Pseudomons eruginos PAO. J. Virol. 22: Miller, R. V., J. M. Pemberton, nd K. E. Richrds F116, D3, nd G11: temperte bcteriophges of Pseudomons eruginos. Virology 59: Ornston, L. N., nd R. Y. Stnier The conversion of ctechol nd protoctechute to,-ketodipte by Pseudomons putid. J. Biol. Chem. 241: Pemberton, J. M., nd B. W. Hollowy Chromosome mpping in Pseudomons eruginos. Genet. Res. 19: Royle, P. L., nd B. W. Hollowy Reltionship between R nd FP plsmids in Pseudomons eruginos. Antimicrob. Agents Chemother. 17: Royle, P. L., H. Mtsumoto, nd B. W. Hollowy Genetic circulrity of the Pseudomons eruginos PAO chromosome. J. Bcteriol. 145: vn de Putte, P., nd B. W. Hollowy A thermosensitive recombintion deficient mutnt of Pseudomons eruginos. Mutt. Res. 6:
Clustering of Mutations Affecting Central Pathway Enzymes
JOURNAL OF BACTEROLOGY, Dec. 1983, p. 1123-1129 0021-9193/83/121123-07$02.00/0 Copyright X 1983, Americn Society for Microbiology Vol. 156, No. 3 Clustering of Muttions Affecting Centrl Pthwy Enzymes of
More informationrecessive lozenge-shaped-fly-eye "alleles" in trans: recessive lozenge-shaped-fly-eye "alleles" in trans:
Wht do we men (wht hve we ment) y " gene": Reding for lectures 15-17 (We F27, Fr F29, We M5) Chp 8: from 258 (Nonoverlpping...) to 261 ( Crcking) & from 285 (8.6) to 293 (end of "essentil concepts) Chp
More informationRole of the Host Cell in Bacteriophage T4 Development I. Characterization of Host Mutants That Block T4 Head Assembly
JOURNAL OF VIROLOGY, Jn. 1980, p. 366-376 0022-538X/80/01-0366/11$02.00/0 Vol. 33, No. 1 Role of the Host Cell in Bcteriophge T4 Development I. Chrcteriztion of Host Mutnts Tht Block T4 Hed Assembly HELEN
More informationFactors Influencing the Adsorption of Bacteriophage 2 to Cells of Pseudomonas aeruginosa
JOURNAL OF VIROLOGY, Jn. 1974, p. 22-27 Copyright ( 1974 Americn Society for Microbiology Vol. 13, No. 1 Printed in U.S.A. Fctors Influencing the Adsorption of Bcteriophge 2 to Cells of Pseudomons eruginos
More informationBiofilm Formation by Escherichia coli csga and fima mutants
Journl of Undergrdute Reserch t Minnesot Stte University, Mnkto Volume 14 Article 9 2014 Biofilm Formtion by Escherichi coli csga nd fima mutnts Nicole Snyder Minnesot Stte University, Mnkto Sen Willert
More informationThree-Phase Wound-Rotor Induction Machine with Rotor Resistance
Exercise 2 Three-Phse Wound-Rotor Induction Mchine with Rotor Resistnce EXERCISE OBJECTIVE When you hve completed this exercise, you will know the effects of vrying the rotor resistnce of three-phse wound-rotor
More informationTetrad analysis. Life cycle and meiosis in yeast. Fig.1. Life cycle of yeast
Tetrd nysis Tetrd nysis in genetics refers to nysis of four products formed from meiosis. In orgnisms like yest the tetrd contins four spores while in cse of Neurospor the scus in which products of meiosis
More informationBest Practices for PCR Assays in Seed Health Tests Version 3.0; June 2018
Best Prctices for PCR Assys in Seed Helth Tests Version 3.0; June 2018 Polymerse Chin Rection (PCR) is currently the most commonly utilized moleculr technique in seed helth testing. This document provides
More informationAnalysis of Transfer Genes and Gene Products within the trab-trac Region of the Escherichia coli Fertility Factor, F
JOURNAL OF BACTEROLOGY, Sept. 1987, p. 3994-4002 0021-9193/87/093994-09$02.00/0 Copyright 1987, Americn Society for Microbiology Vol. 169, No. 9 Anlysis of Trnsfer Genes nd Gene Products within the trb-trc
More informationA Little More Advanced Biotechnology Tools. Engineered plasmids. Selection for plasmid uptake. Better Plasmids. Antibiotic becomes a selecting agent
A Little More Advnced Biotechnology Tools Better Plsmids Engineered plsmids Building custom plsmids restriction enzyme sites ntibiotic resistnce genes s selectble mrker EcoRI BmHI HindIII restriction sites
More informationof the related pheromone ceases, whereas other pheromones (unrelated) continue to be produced. If a donor strain
JOURNAL OF BACTERIOLOGY, Dec. 1992, p. 8172-8177 0021-9193/92/248172-06$02.00/0 Copyright 1992, Americn Society for Microbiology Vol. 174, No. 24 Evidence tht the Hemolysin/Bcteriocin Phenotype of Enterococcus
More informationPrimer in Population Genetics
Primer in Popultion Genetics Hierrchicl Orgniztion of Genetics Diversity Primer in Popultion Genetics Defining Genetic Diversity within Popultions Polymorphism number of loci with > 1 llele Number of lleles
More informationBacteria. Bacterial genome. Transformation 2/4/2015. Bacteria review. Single circular chromosome. one-celled prokaryotes reproduce by mitosis
Bcteri Bcteri review one-celled prokryotes reproduce by mitosis binry fission rpid growth genertion every ~20 minutes 10 8 (100 million) colony overnight! incredibly diverse Bcteril genome Single circulr
More informationThree-Phase Wound-Rotor Induction Machine with a Short- Circuited Rotor
Exercise 1 Three-Phse Wound-Rotor Induction Mchine with Short- Circuited Rotor EXERCISE OBJECTIVE When you hve completed this exercise, you will know how three-phse woundrotor induction mchine cn operte
More informationInfluence of Soil Variables on In Situ Plasmid Transfer from Escherichia coli to Rhizobium fredii
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, JUlY 1989, p. 173-1734 Vol. 55, No. 7 99-224/89/7173-5$2./ Copyright X 1989, Americn Society for Microbiology Influence of Soil Vribles on In Situ Plsmid Trnsfer
More informationObserving Patterns in Inherited Traits. Chapter 10
Observing Ptterns in Inherited Trits Chpter 10 10.1 Mendel, Pe Plnts, nd Inheritnce Ptterns By experimenting with pe plnts, Mendel ws the first to gther evidence of ptterns by which prents trnsmit genes
More informationChloramphenicol Sensitivity
JOURNAL of BACTEROLOGY, Aug. 1983, p. 722-727 Vol. 155, No. 2 0021-9193/83/080722-06$02.00/0 Copyright C 1983, Americn Society for Microbiology Detiled Restriction Mp of Crown Gll-Suppressive ncw Plsmid
More informationGenetics of heredity. October 10 Lecture notes Genetics of heredity
October 10 Lecture notes Review: Meiosis, digrmmed on blckbord. Meiosis: The division of single nucleus (nd the cell tht contins it) into four dughter nuclei (nd cells tht contin them). The four dughter
More informationK. K. JHA. Department of Ge.rzetics, Australian National University. Canberra. Australia. Received June 30, 1967
GENETIC CONTROL OF LLELIC RECOMBINTION T THE HISTIDINE-3 LOCUS OF NEUROSPOR CRSS K. K. JH Deprtment of Ge.rzetics, ustrlin Ntionl University. Cnberr. ustrli Received June 30, 1967 THE histidine-3 (his-3)
More information6.1 Damage Tolerance Analysis Procedure
6. Dmge Tolernce Anlysis Procedure For intct structure the nlysis procedures for Slow Crck Growth nd Fil Sfe structure re essentilly the sme. An initil flw is ssumed nd its growth is nlyzed until filure
More informationSLASH PINE FAMILIES IDENTIFIED WITH HIGH RESISTANCE TO FUSIFORM RUST. C. H. Walkinshaw '
SLASH PINE FAMILIES IDENTIFIED WITH HIGH RESISTANCE TO FUSIFORM RUST C. H. Wlkinshw ' Abstrct.--Fusiform rust redily kills slsh pine, Pinus elliottii Engelm. vr. elliottii. When the number of rust-infected
More informationThe Presence of Tobacco Mosaic Virus in the Compost Extract of Cigar Tobacco Debris
HAYATI Journl of Biosciences, September 28, p 118122 Vol. 1, No. 3 ISSN: 1978319 The Presence of Tobcco Mosic Virus in the Compost Extrct of Cigr Tobcco Debris WIWIEK SRI WAHYUNI, MUHAMMAD HANAPI, IGNASIUS
More informationMultiple Antibiotic Resistance in Escherichia coli
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1994, p. 1773-1779 Vol. 38, No. 8 0066-4804/94/$04.OO+O Copyright 1994, Americn Society for Microbiology Genetic Reltionship between soxrs nd mr Loci in Promoting
More information[ HOCl] Chapter 16. Problem. Equilibria in Solutions of Weak Acids. Equilibria in Solutions of Weak Acids
Equilibri in Solutions of Wek Acids Chpter 16 Acid-Bse Equilibri Dr. Peter Wrburton peterw@mun.c http://www.chem.mun.c/zcourses/1011.php The dissocition of wek cid is n equilibrium sitution with n equilibrium
More informationEconomic Profitability and Sustainability of Canola Production Systems in Western Canada
Economic Profitility nd Sustinility of Cnol Production Systems in Western Cnd Elwin Smith, R. Blckshw, Agriculture nd Agri-Food Cnd (AAFC), Lethridge, AB, N. Hrker, J. O'Donovn, AAFC Lcome AB, S. Brndt,
More informationDNA-DNA Homology Between Lactic Streptococci and Their Temperate and Lytic Phages
APPLED AND ENVRONMENTAL MCROBOLOGY, My 1984, p. 131-138 99-224/84/5131-8$2./ Copyright C) 1984, Americn Society for Microiology Vol. 47, No. 5 DNA-DNA Homology Between Lctic Streptococci nd Their Temperte
More informationTree Shelters Fail to Enhance Height Growth of Northern Red Oak in the Upper Peninsula of Michigan. 1
Tree Shelters Fil to Enhnce Height Growth of Northern Red Ok in the Upper Peninsul of Michign. 1 Dougls O. Lntgne, Associte Professor, MSU Deprtment of Forestry nd Rymond Miller, Resident Forester, Upper
More informationPAPER CHEMISTRY, APPLETON, WISCONSIN IPC TECHNICAL PAPER SERIES NUMBER 163 W. J. WHITSITT OCTOBER, 1985
163 THE INSTITUTE OF PAPER CHEMISTRY, APPLETON, WISCONSIN O E G? o IPC TECHNICAL PAPER SERIES NUMBER 163 O4 o= o COMPRESSIVE STRENGTH RELATIONSHIPS AND FACTORS, C) t C= c. Md Qy W. J. WHITSITT OCTOBER,
More informationNumerical Analysis of a Reinforced Concrete Slab-Column Connection Subjected to Lateral & Vertical Loading
, Mrch 15-17, 2017, Hong Kong Numericl Anlysis of Reinforced Concrete Slb-Column Connection Subjected to Lterl & Verticl Loding Mostfiz Emtiz, A.S.M. Aluddin Al Azd, H. M. Shhin b nd Sultn Al Shfin c Abstrct
More informationSaccharomyces cerevisiae
JOURNAL OF BACTERIOLOGY, Feb. 1975, p. 562-570 Copyright 0 1975 Americn Society for Microbiology Vol. 121, No. 2 Printed in U.S.A. Positive Selection of Generl Amino Acid Permese Mutnts in Scchromyces
More informationSaccharomyces cerevisiae (aas mutants/suppressors/epistasis/molecular cloning/gene dosage)
Proc. Nti. Acd. Sci. USA Vol. 8, pp. 5374-5378, September 1983 Genetics Positive regultion in the generl nino cid control of Scchromyces cerevisie (s mutnts/suppressors/epistsis/moleculr cloning/gene dosge)
More informationMovement of yeast transposable elements by gene conversion (gene replacement/recombination/transposition/controlling elements/gene expression)
Proc. NtL Acd. Sci. USA Vol. 79, pp. 5621-5625, September 1982 Genetics Movement of yest trnsposble elements by gene conversion (gene replcement/recombintion/trnsposition/controlling elements/gene expression)
More informationESTIMATION AND UTILIZATION OF STRUCTURE ANISOTROPY IN FORMING PIECES
www.cermics-silikty.cz Cermics-Silikáty 61 (), 141-146 (17) doi: 1.13168/cs.17.9 ESTIMATION AND UTILIZATION OF STRUCTURE ANISOTROPY IN FORMING PIECES MAROS MARTINKOVIC Slovk University of Technology in
More informationInvasive Pneumococcal Disease Quarterly Report. January March 2017
Invsive Pneumococcl Disese Qurterly Report Jnury Mrch 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Ali Bormn Helen Heffernn My 2017 Acknowledgements This report could not
More informationThe ovalbumin gene: Cloning of the natural gene* (gene splicing/recombinant phage screening/ intervening sequence expression/restriction mapping)
Proc. Ntl. Acd. Sci. USA Vol. 75, No. 8, pp. 3688-3692, August 1978 Biochemistry The ovlbumin gene: Cloning of the nturl gene* (gene splicing/recombinnt phge screening/ intervening sequence expression/restriction
More informationChickpeas Respond Well To Inoculation With TagTeam
Chickpes Respond Well To Inocultion With TgTem S.M. Phelps, nd E. Hgele Philom Bios Inc., 318-111 Reserch Drive, Ssktoon, SK S7N 3R2 Abstrct Rhizobi strins were tested in TgTem pet nd grnule formultions
More informationGene Conversion Tracts Stimulated by HOTI-Promoted Transcription Are Long and Continuous
Copyright 0 1990 by the Genetics Society of Americ Gene Conversion Trcts Stimulted by HOTI-Promoted Trnscription Are Long nd Continuous Kren Voelkel-Meimn nd G. Shirleen Roeder Deprtment of Biology, Yle
More informationMUTANTS SHOWING HETEROTHALLISM FROM A HOMOTHALLIC STRAIN OF SACCHAROMYCES CEREVISIAE
MUTANTS SHOWING HETEROTHALLISM FROM A HOMOTHALLIC STRAIN OF SACCHAROMYCES CEREVISIAE TAKEHIRO OSHIMA AND ISAMU TAKANO The Centrl Resenrch Institute, Suntory Ltd.,* Wkymdi, Shimmoto-cho, Mishim-gun, Osk
More informationExperimental Organisms Used in Genetics
Experimentl Orgnisms Used in Genetics Burke H Judd, Chpel Hill, North Crolin, USA Most model genetic systems shre importnt chrcteristics tht mke them menble to growth nd nlysis in the lbortory. These include
More informationPlasmid ptic58. expressed at intermediate (virg) or very low (virb, virc, vird, and vire) levels and show under laboratory conditions
JOURNAL OF BACTERIOLOGY, Nov. 1987, p. 5101-5112 Vol. 169, No. 11 0021-9193/87/115102-12$02.00/0 Copyright C) 1987, Americn Society for Microbiology Regultion of the vir Genes of Agrobcterium tumefciens
More informationChapter 9. Quadratics
Chpter 9 Qudrtics Artificil Body Prts 9.1 Solving Qudrtic Equtions by Fctoring 9. Completing the Squre 9.3 The Qudrtic Formul 9.4 Eponentil Functions (Growth nd Decy) Chpter Review Chpter Test 147 Section
More informationCloning and Expression of a Transferrin-Binding Protein from Actinobacillus pleuropneumoniaet
INFECTION AND IMMUNITY, Mr. 1992, p. 892-898 0019-9567/92/030892-07$02.00/0 Copyright X) 1992, Americn Society for Microbiology Vol. 60, No. 3 Cloning nd Expression of Trnsferrin-Binding Protein from Actinobcillus
More informationa ATP release 4h after induction
doi:1.138/nture9413 ATP relese 4h fter induction of poptosis (nm) 5 ATP 4 3 2 1 UV UV + zvad 1μM 3μM 5μM UV + 1μM 3μM 5μM UV + 18AGA 1μM 3μM 5μM UV + FFA HeL monolyer Scrpe Dye trnsfer HeL HeL-Cx43 HeL-Cx43
More informationNonlinear Mixed Effects Model for Swine Growth
Nonliner Mixed Effects Model for Swine Growth A. P. Schinckel nd B. A. Crig Deprtment of Animl Sciences nd Deprtment of Sttistics, Purdue University Introduction Severl nonliner growth functions model
More informationSUPPLEMENTARY INFORMATION
SI Fig. PrpS is single copy gene k 3. 9... EcoRV EcoRV k 5 BmH Pst c well k HindIII HindIII HindIII.3.5 3.. Southern lots of Ppver genomic DNA from plnts with SS8 hplotypes, hyridized with PrpS proe..
More informationSupplementary Figure 1. Zhang et al.
Supplementry Figure 1. Zhng et l. T30-SurA: GGCAGTTTCATCATGAATGTGCAGGAGCTTGCAACAATTAAGGTGGAGAATCTCCC T30-SurB: GGCAGTTTCATCATGAATGTGCAGGAGCTAGCAACTATTAAGGTGGAGAATCTCCC T41-SurA: ACTGAATAATCAACACTTGGGAATGGTGGTTCAATGGGAGGATCGGTTCTAT
More informationStationary-Phase-Inducible "Gearbox" Promoters: Differential
JOURNAL OF BACTERIOLOGY, JUlY 1991, p. 4482-4492 21-9193/91/144482-11$2./ Copyright D 1991, Americn Society for Microbiology Vol. 173, No. 14 Sttionry-Phse-Inducible "Gerbox" Promoters: Differentil Effects
More informationHigh strength fine grained structural steel, thermo-mechanically rolled, for high temperature application
P420M HT High strength fine grined structurl steel, thermo-mechniclly rolled, for high temperture ppliction Specifiction DH-E52-D, edition April 2016 1 P420M HT is high strength thermomechniclly rolled
More informationCrystal Structure. Dragica Vasileska and Gerhard Klimeck
Crystl Structure Drgic Vsilesk nd Gerhrd Klimeck Crystl Structure Issues tht re ddressed in this lecture include:. Periodic rry of toms. Fundmentl types of lttices 3. Index system for crystl plnes 4. Simple
More informationBacteriophage T4 DNA Replication: Purification of the Complex Specified by T4 Genes 44 and 62 (gene products/mutants/cell lysates)
Proc. Nt. Acd. Sci. USA Vol. 69, No. 9, pp. 2717-2721, September 1972 In Vitro Complementtion s n Assy for New Proteins Required for Bcteriophge T4 DNA Repliction: Purifiction of the Complex Specified
More informationProperties of the Nonlethal Recombinational Repair x and y Mutants of Bacteriophage T4 II. DNA Synthesis
JOURNAL OF VIROLOGY, Oct. 1977, p. 28-4 Copyright 1977 Americn Society for Microbiology Vol. 24, No. 1 Printed in U.S.A. Properties of the Nonlethl Recombintionl Repir x nd y Mutnts of Bcteriophge T4 II.
More informationEffect of Sodium Nitrite on Toxin Production by Clostridium botulinum in bacon
APPLIED MICROBIOLOGY, Apr. 1974, p. 733-737 Copyright i 1974 Americn Society for Microbiology Vol. 27, No. 4 Printed in U.S.A. Effect of Sodium Nitrite on Toxin Production by Clostridium botulinum in bcon
More informationGrowth Kinetics of Coliform Bacteria under Conditions Relevant to Drinking Water Distribution Systems
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 1991, p. 2233-2239 0099-2240/91/082233-07$02.00/0 Copyright C 1991, Americn Society for Microbiology Vol. 57, No. 8 Growth Kinetics of Coliform Bcteri under
More informationFluorescence Intensities of. GFP-PAC-1 Strains
DOI: 10.1038/ncb3168 Arbitrry Fluorescence Units 2500 2000 1500 1000 500 0 full length (1-4) Fluorescence Intensities of GFP-PAC-1 Strins ΔPH 392-838 575-4 GFP-PAC-1 Strins 2-610 1-574 b control c pc-1(3
More informationCaulobacter crescentus
JOURNAL OF BACTRIOLOGY, Oct. 1976, p. 456-462 Copyright 1976 Americn Society for Microbiology Vol. 128, No. 1 Printed in U.S.A. Requirement of Cell Division Step for Stlk Formtion in Culobcter crescentus
More information(b) Is already deposited in a waste disposal site without methane recovery.
TYPE III - OTHER PROJECT ACTIVITIES Project prticipnts must tke into ccount the generl guidnce to the methodologies, informtion on dditionlity, bbrevitions nd generl guidnce on lekge provided t http://cdm.unfccc.int/methodologies/sscmethodologies/pproved.html.
More informationSpecies-Specific Signals for the Splicing of a Short Drosophila Intron In Vitro
MOLECULAR AND CELLULAR BIOLOGY, Feb. 1993, P. 114-1118 27-736/93/2114-15$2./ Copyright 1993, Americn Society for Microbiology Vol. 13, No. 2 Species-Specific Signls for the Splicing of Short Drosophil
More informationDetection of amplified Y chromosome-specific sequence by capillary electrophoresis with laser-induced fluorescence*
FERTILITY AND STERILITY Copyright @ 1995 Americn Society for Reproductive Medicine Vol. 64, No., August 1995 Printed on cid free pper in U. S. A. Detection of mplified Y chromosome-specific sequence by
More informationConstruction of a Kit of Reference Strains for Rapid Genetic
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Apr. 1977, p. 989-993 Copyright 1977 Americn Society for Microbiology Vol. 33, No. 4 Printed in U.S.A. Construction of Kit of Reference Strins for Rpid Genetic Mpping
More informationThe signal for growth rate control and stringent sensitivity in E. coli is not restricted to a particular sequence motif within the promoter region
.n) 199 Oxford University Press Nucleic Acids Reserch, Vol. 18, No. 21 6271 The signl for growth rte control nd stringent sensitivity in E. coli is not restricted to prticulr sequence motif within the
More informationIsolation and Characterization of Nisin-Resistant Leuconostoc mesenteroides for Use in Cabbage Fermentations
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 1993, P. 3778-3783 99-224/93/113778-6$2./ Vol. 59, No. 11 Isoltion nd Chrcteriztion of Nisin-Resistnt Leuconostoc mesenteroides for Use in Cbbge Fermenttions
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture10970 I. GN directly grown on the h-bn relese lyer Figure S1 shows X-ry diffrction with the 2θ/ω configurtion nd n opticl microscopy imge for the GN directly grown on the h-bn relese lyer.
More informationA Nontoxic Pseudomonas Exotoxin A Induces Active Immunity and Passive Protective Antibody against Pseudomonas Exotoxin A Intoxication
Originl Pper J Biomed Sci 1999;6:357 363 Received: Februry 5, 1999 Accepted: Mrch 30, 1999 A Nontoxic Pseudomons Exotoxin A Induces Active Immunity nd Pssive Protective Antibody ginst Pseudomons Exotoxin
More informationChapter 9. Mapping and characterizing whole genomes. Structural Genomics Functional genomics
Chpter 9 Mpping nd chrcterizing whole genomes Structurl Genomics Functionl genomics How mny genes hs humn? 5,500 27,000 Interprettion of genomic informtion: high throughput technologies re used to get
More informationTHERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING
Journl of Mining nd Metllurgy, 38 (1 2) B (2002) 93-102 THERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING N.Mitevsk* nd @.D.@ivkovi}** *RTB BOR, Copper Institute, 19210 Bor, Yugoslvi
More informationAccumulation of Copper and Other Metals by Copper-Resistant Plant-Pathogenic and Saprophytic Pseudomonads
APPLID AND NVIRONMNTAL MICROBIOLOGY, Jn. 199, p. 7-78 Vol. 58, No. 1 99-/9/17-5$./ Copyright C) 199, Americn Society for Microbiology Accumultion of Copper nd Other Metls by Copper-Resistnt Plnt-Pthogenic
More informationPurification and Properties of Int-h, a Variant Protein Involved in Site-specific Recombination of Bacteriophage X*
THE JOURNAL OF BlOLOGtCAL CHEMSTRY Vl. 259, No. 20, ssue of October 25, pp. 1272412732,1984 Printed in U.S.A. Purifiction nd Properties of nth, Vrint Protein nvolved in Sitespecific Recombintion of Bcteriophge
More informationSupplementary information. Contents
Supplementry informtion Title: The Multiple QS DSF-fmily Signls re Synthesized from Crohydrte nd Brnched-chin Amino Acids vi the FAS Elongtion Cycle Lin Zhou 1, Yonghong Yu 2,Xiping Chen 3, Adelgder Adeen
More informationCharacterization of Pseudomonas aeruginosa Mutants
JOUJRNAL OF BACTERIOLOGY, June 1978, p. 875-883 21-9193/78/134-875$2./ Copyright 1978 American Society for Microbiology Vol. 134, No. 3 Printed in U.S.A. Characterization of Pseudomonas aeruginosa Mutants
More informationGenetic and Biochemical Analysis of Dimer and Oligomer Interactions of the S Holin
JOURNAL OF BACTERIOLOGY, Nov. 2000, p. 6082 6090 Vol. 182, No. 21 0021-9193/00/$04.00 0 Copyright 2000, Americn Society for Microbiology. All Rights Reserved. Genetic nd Biochemicl Anlysis of Dimer nd
More informationCrop Performance and Plant Microbe-Interactions are Affected by the Sequence and Frequency of Pulse Crops in the Canadian Prairie
Crop Performnce nd Plnt Microbe-Interctions re Affected by the Sequence nd Frequency of Pulse Crops in the Cndin Pririe Nvrro-Borrell A 1,2 ; Di M 2 ; Hmel C 1,2 ; Fernndez MR 2 ; Gn Y 2 ; Germid J 1.
More informationContribution of Phenazine Antibiotic Biosynthesis to the Ecological Competence of Fluorescent Pseudomonads in Soil Habitats
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 1992, p. 2616-2624 99-224/92/82616-9$2./ Copyright X 1992, Americn Society for Microbiology Vol. 58, No. 8 Contribution of Phenzine Antibiotic Biosynthesis
More information3-Galactosidase: Immunological Activity of Ribosome-Bound,
Proc., Nt. Acd. Sci. USA Vol. 69, No. 2, pp. 412-416, Februry 1972 3-Glctosidse: Immunologicl Activity of Ribosome-Bound, Growing Polypeptide Chins (immune hemolysis inhibition/ntiserum/puromycin/protein
More informationFibre-reinforced plastic composites Declaration of raw material characteristics Part 4: Additional requirements for fabrics
CEN/TC 249 N493 Dte: 2010-02 pren xxxx-4:2010 CEN/TC 249 Secretrit: NBN Fibre-reinforced plstic composites Declrtion of rw mteril chrcteristics Prt 4: Additionl requirements for fbrics Einführendes Element
More informationLactococcus lactis subsp. lactis C2
JOURNAL OF BACTERIOLOGY, Oct. 1991, p. 6095-6100 0021-9193/91/196095-06$02.00/0 Copyright X) 1991, Americn Society for Microbiology Vol. 173, No. 19 A Membrne Protein Is Required for Bcteriophge c2 Infection
More informationh 4 t i Table of Contents Advantages of Fundraising Events Steps to Planning a Fundraising Event
tiv e i t i d In n ts e l h You t ou gh Eve 4 g is in $ $ $ th r r d Fu n is in g R s: A Toolkit for Grssroots Y outh-led Inititives For Yo uth Inititiv CORE e, Orgniz(Centre for ti o n Resilie nce) l
More informationGENETICS - CLUTCH CH.5 GENETICS OF BACTERIA AND VIRUSES.
!! www.clutchprep.com CONCEPT: WORKING WITH MICROORGANISMS Bacteria are easy to with in a laboratory setting They are fast dividing, take up little space, and are easily grown in a lab - Plating is when
More informationWe engineer your success. All over the world. Semi Automatic
We engineer your success. All over the world. Semi Automtic Viscon Hydroponics Mnul System The demnd for food sfe products re worldwide incresing. In Chin Food Sfety is in the governments top priority
More informationhuman genome 3.2 billion bases Biotechnology A Brave New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT
Biotechnology 2007-2008 A Brve New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT humn genome CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA
More informationSEEDING CLOVERS OR GRASSES INTO OLDER ALFALFA BENEFITS AND HAZARDS ABSTRACT INTRODUCTION
SEEDING CLOVERS OR GRASSES INTO OLDER ALFALFA BENEFITS AND HAZARDS STANDS- Mick Cnevri1, Dn Putnm2, Brbr Reed3, Rchel Long4, Steve Orlo~, Tom Lnini6, nd Lrry Godfrey7 ABSTRACT Deciding wht to do with n
More informationEffect of Tantalum Additions to a Cobalt-Chromium-Nickel
Effect of Tntlum Additions to Coblt-Chromium-Nickel Bse Alloy A. P. ROWE, W. C. BIGELOW, nd K. ASGAR University of Michign, School of Dentistry, Ann Arbor, Michign 48104, USA An investigtion by electron
More informationRegulation of /8-Glucuronidase Synthesis in Escherichia coli
JOURNAL OF BACTERIOLOGY, JUlY 1976, p. 406-417 Copyright 1976 Americn Society for Microbiology Vol. 127, No. 1 Printed in U.S.A. Regultion of /8-Glucuronidse Synthesis in Escherichi coli K-12: Constitutive
More informationMicrobial Coagulation of Alfalfa Green Juice
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 1987, p. 226-2211 99-224/87/9226-6$2./ Copyright 1987, Americn Society for Microbiology Vol. 53, No. 9 Microbil Cogultion of Alflf Green Juice N. GODESSART,
More informationMicrobial Coagulation of Alfalfa Green Juice
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 1987, p. 226-2211 99-224/87/9226-6$2./ Copyright 1987, Americn Society for Microbiology Vol. 53, No. 9 Microbil Cogultion of Alflf Green Juice N. GODESSART,
More informationBroth-Dilution Method for Determining the Antibiotic Susceptibility of Anaerobic Bacteria
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Jn. 1975, p. 15-21 Copyright 0 1975 Americn Society for Microbiology Vol. 7, No. 1 Printed in U.S.A. Broth-Dilution Method for Determining the Antibiotic Susceptibility
More informationTopic 7. Acids, Bases, Buffers, Titrations, Polyprotic acids
Topic 7 cids, Bses, Buffers, Titrtions, Polyprotic cids Conjugte cids & bses Strengths of cids & bses strong cid or strong bse is completely dissocited in queous solution. Wek cids nd Wek Bses Crboxylic
More informationSpecificity of the Antiviral Agent Calcium Elenolate
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Oct. 1975, p. 421-425 Copyright i 1975 Americn Society for Microbiology Vol. 8, No. 4 Printed in U.S.A. Specificity of the Antivirl Agent Clcium Elenolte JOHN E.
More informationISO 6947 INTERNATIONAL STANDARD. Welding and allied processes Welding positions. Soudage et techniques connexes Positions de soudage
Provläsningsexemplr / Preview INTERNATIONAL STANDARD ISO 6947 Third edition 2011-05-15 Welding nd llied processes Welding positions Soudge et techniques connexes Positions de soudge Reference number ISO
More information3-PG transport was measured as follows; an aliquot (25,ul) of cell suspension prepared as described above was incubated
JOURNAL OF BACTERIOLOGY, Sept. 1988, p. 4304-4308 0021-9193/88/094304-05$02.00/0 Copyright C 1988, Americn Society for Microbiology Vol. 170, No. 9 Genetic Evidence for Modultion of the Activtor by Two
More informationDevelopment of Patient-specific AAV Vectors After Neutralizing Antibody Selection for Enhanced Muscle Gene Transfer
The Americn Society of Gene & Cell Therpy originl rticle Development of Ptient-specific AAV Vectors After Neutrlizing Antibody Selection for Enhnced Muscle Gene Trnsfer Chengwen Li,2, Shuqing Wu,3, Blke
More informationMcbio 316 Exam 2 Page 1. putp
Mcbio 316 Exam 2 Page 1 (5) 1. A new putp mutation was mapped against a set of putp deletion mutations. The region removed by the deletion mutations are indicated by the area between the brackets below
More informationElectronic supplementary information: High specific detection and near-infrared photothermal. therapy of lung cancer cells with high SERS active
Electronic supplementry informtion: High specific detection nd ner-infrred phototherml therpy of lung cncer cells with high SERS ctive ptmer-silver-gold shell-core nnostructures Ping Wu, Yng Go, Yimei
More informationMechanisms of Specific Immunological Unresponsiveness to Bacterial Lipopolysaccharides
INFECTION AND IMMUNITY, Dec. 1987, P. 3093-3102 0019-9567/87/123093-10$02.00/0 Copyright C) 1987, Americn Society for Microbiology Vol. 55, No. 12 Mechnisms of Specific Immunologicl Unresponsiveness to
More informationWestern Illinois University- School of Agriculture Organic Research Program 2013 Dry Humate/Fertility Studies Dr. Joel Gruver and Andy Clayton
Western Illinois University- School of Agriculture Orgnic Reserch Progrm 0 Dry Humte/Fertility Studies Dr. Joel Gruver nd Andy Clyton Introduction Orgnic grin frmers generlly use less purchsed inputs thn
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2307 c No Jsplkinolide Jsplkinolide MDCK AP2-GFP Trnsferrin Merge BSC1 Trnsferrin fluorescence (.u.) MDCK - Jsplkinolide Jsplkinolide AP2-GFP fluorescence (.u.) Trnsferrin fluorescence (.u.)
More informationThe Effect of Nitrogen Fertilizers (Urea, Sulfur Coated Urea) with Manure on the Saffron Yield
The Effect of Nitrogen Fertilizers (Ure, Sulfur Coted Ure) with Mnure on the Sffron Yield Seed Rezin nd Mjid Forouhr Soil nd Wter Deprtment griculturl Reserch Center of Khorsn Mshhd, Torough Sttion, 91735
More information1 Information, Persuasion, and Signalling
ECON 312: Advertising 1 We will now exmine nother strtegic vrible vilble to firms, tht of dvertising. Industril Orgniztion Advertising 1 Informtion, Persusion, nd Signlling 1.1 Persusion versus Informtion
More informationBethesda, Maryland the adenovirus ElA protein (9). Typical zinc finger motifs. are not present within the AlL and G8R ORFs, although the
JORNL OF VIROLOGY, Ot. 1993, p. 5749-5753 0022-538X/93/105749-05$02.00/0 opyright ) 1993, mericn Society for Microbiology Vol. 67, No. 10 Muttionl nlysis of Predicted Zinc-inding Motif in the 26-Kilodlton
More informationProduction of Ovotransferrin from Egg White for Antimicrobial Application. Introduction
Production of Ovotrnsferrin from Egg White for Antimicrobil Appliction D. U. Ahn 1, E. J. Lee 1 nd Aubrey Mendonc 2 1 Animl Science Deprtment, Iow Stte University, Ames, Iow 50011-3150 Ph: 515-294-6595,
More informationDNA polymerase I. In addition, the proteins encoded by dnab, dnac, dnag, dnap, polc (DNA polymerase III), dnaz, and
Proc. Nti. Acd. Sci. USA Vol. 76, No. 2, pp. 736-740, Februry 1979 Biochemistry Origin nd direction of DNA repliction of plsmid RSF1030 (in vitro repliction/dideoxy NTPs/electron microscopy/restriction
More information