The signal for growth rate control and stringent sensitivity in E. coli is not restricted to a particular sequence motif within the promoter region

Transcription

1 .n) 199 Oxford University Press Nucleic Acids Reserch, Vol. 18, No The signl for growth rte control nd stringent sensitivity in E. coli is not restricted to prticulr sequence motif within the promoter region M.Zchris, H.U.G6ringer' nd R.Wgner1 * Mx-Plnck-lnstitut for Molekulre Genetik, Abteilung Wittmnn, IhnestrBe 73, D-1 Berlin 33 nd 'Institut for Physiklische Biologie, Heinrich-Heine-Universitt DOsseldorf, UniversittsstrB3e 1, D-4 Dusseldorf 1, FRG Received July 27, 199; Revised nd Accepted October 2, 199 ABSTRACT Hybrid promoter constructs were used to determine the DNA sequence requirements for stringent nd growth rte control within promoter region. The promoters were obtined by fusing complementing sequence regions locted upstrem nd downstrem from the GCGC discrimintor motif of the growth rte regulted rrna P1 promoter nd non-regulted tc promoter vrint. The ctivities nd the regultory response of the hybrid promoters were determined in vivo using promoter test vector system with the chlormphenicol cetyltrnsferse (CAT) reporter gene. Mesurements were mde t different growth rtes nd fter strvtion for isoleucine to induce the stringent response. Neither the upstrem nor the downstrem sequence of P1 reltive to the GCGC discrimintor motif conferred comprble regultory fetures when fused to the complementing sequences of the non-regulted mutnt tc promoter. A minor response to mino cid deprivtion or chnges in the growth rte ws noted for the hybrid promoter with the rrnb P1 upstrem segment nd the tc downstrem element, pointing to slightly different importnce of the two sequence elements for regultion. The prllel effects for stringent s well s growth rte regultion of the hybrid promoters supports the view of common mechnism for both types of control. However, none of the promoter sequence elements on its own ws ble to restore the complete regultory behviour of their 'prent' promoters. INTRODUCTION The synthesis of bcteril ribosoml RNA (rrna) nd trnsfer RNA (trna) is controlled by two regultory networks: Stringent control nd growth rte dependent regultion. Stringent control denotes the rpid decline of trnscription of rrna nd trna upon deprivtion of essentil mino cids. Growth rte regultion reltes to the observtion tht the synthesis of stble RNAs in exponentilly growing bcteri is not constnt but roughly proportionl to the squre of the growth rte, nd thereby dpted to the demnd required for protein biosynthesis (1). An incresing body of evidence points to scenrio where both regultory phenomen re bsed on the sme moleculr mechnism with gunosine tetrphosphte (ppgpp) being the effector molecule (2, 3, 4). DNA sequence determinnts for both stringent response nd growth rte regultion re clerly linked to the promoter regions of the vrious regulted genes. In the cse of the rrnb P1, the leuv nd the tyrt promoters the trget sequences necessry for regultion ws found to be restricted to region between position -5 nd the trnscription strt site (5, 6, 7). A so-clled discrimintor motif with the primry sequence GCGCcNc, locted downstrem of the -1 promoter region in close proximity to the trnscription initition site ws identified by comprison of vrious stble RNA (trna nd rrna) promoter sequences (8, 9). In the cse of the tyrtpromoter, the prtil substitution of this discrimintor element by four A/T bse pirs led to the disruption of both stringent sensitivity nd growth rte regultion for this gene product (1, 11). In the cse of the tu.b operon, ltertions in the GC-rich discrimintor motif disrupted the sensitivity to ppgpp in vitro (12). Further support for the importnce of this sequence element cme from recently published experiments where the consensus motif ws introduced into the non-regulted rrnb P2 promoter by n A to G trnsition t position -6 reltive to the trnscription strt site (4). The muttion conferred both growth rte nd stringent regultion. However, the sme discrimintor sequence linked to the tc promoter sequence (tcm) did not convert this promoter to either stringency or growth rte regultion (4). This clerly demonstrted tht dditionl structurl fetures of stble RNA promoters locted either downstrem or upstrem from the GCGC-sequence re necessry for both types of regultion. To loclize these dditionl elements we constructed fusion promoter sequences between downstrem nd upstrem regions from the growth rte regulted rrnb P1 promoter nd the corresponding * To whom correspondence should be ddressed + Present ddress: Settle Biomedicl Reserch Institute, 4 Nickerson Street, Settle, WA , USA

2 6272 Nucleic Acids Reserch, Vol. 18, No. 21 elements of the non-regulted tcm promoter. In vivo nlysis of the fusion promoters clerly indicte tht neither the GCGC motif nor upstrem or downstrem sequences lone re sufficient for complete regultion comprble to the rmb P1 promoter. rrnb P1 promoter (frgment A) BmHI HinphI Scl I I l tcm promoter (frgment B) Sspi Hinphl Hindill I I I B2 METHODS Strins nd medi All bcteril strins used in this study were E. coli K12 derivtives. CP 78 (13), CF nd CF 898 hve been described (14). The different medi were derived from MOPS medium (15) nd were substituted with vrious crbon sources (succinte.2% (w/v), cette.2% (w/v), glycerol.2% (v/v) or glucose.2% (w/v)) s well s csminocid concentrtions between.5 %- nd 1 % (w/v). Medium SR ws MOPS contining.2% (w/v) glucose nd 4 mg/ml of ll mino cids except for vline nd isoleucine. Medium S ws MOPS supplemented with.2% (w/v) glucose nd.2% (w/v) csminocids. The phosphte concentrtion ws lwys 5 mm. Cell cultures of trnsformnts contining plsmids with the tc promoter derivtives PtcW, PtcM or P1TM (see next section) were supplemented with 2 mm IPTG to ensure full induction of trnscription from these promoters. Plsmids The plsmids pptcw, pptcm, ppl, pp2, pp2f re described in (4). They re derivtives of the promoter test vector pkk232-8 with multicloning site nd the CAT reporter gene (16). Corresponding to the bove order the constructs contin the tc promoter (pptcw), modified tc promoter (pptcm) with the GCGC discrimintor motif, the rrnb P1 promoter (pp1), the rrnb P2 promoter (pp2) nd the P2F promoter ( rrnb P2 promoter contining the GCGC sequence (pp2f)). Plsmids ptmp1 nd ppltm re constructs with downstrem nd upstrem sequences reltive to the discrimintor motif from rmnb P1 nd PtcM. Plsmids pp1 contining the rmb P1 promoter sequence s BmHI/ScI restriction frgment (4) nd pptcmk served s 'prent' plsmids for the construction of the fusion promoters. Plsmid pptcmk is derivtive of pptcm with the tcm promoter on 268 bp BmHI/HindlII insert insted of the 376 bp Su3A frgment in pptcm (4). The fct tht the GCGC discrimintor motif is recognized by HinpHI ws used to generte nd combine downstrem nd upstrem sequences reltive to the GCGC sequence from the rrnb P1 nd tcm promoters. Detils of the construction re given in the legend to Figure 1. The promoter with the upstrem rrnb P1 nd downstrem tcm sequences ws designted P1TM. TMP1 refers to the construct contining the upstrem tcm nd downstrem rmnb P1 regions. It should be noted tht the 16 bp spcing between the -1 nd -35 regions ws not ffected in ny of the fusion promoters. The finl bse sequences of the fusion promoters were verified by DNA sequencing of the corresponding frgments ccording to (17). Figure 2 detils ll primry sequences of the different promoter constructs tht were used in this study. Assy for chlormphenicol cetyltrnsferse (CAT) Cells were lysed ccording to Zchris nd Wgner, 1989 (18) nd the CAT-ctivity ws determined s the rte of chlormphenicol cetyltion ccording to (19) using [14C] chlormphenicol: Acetylted rection products were seprted B1 Bi A2 = pp1tm = ptmp1 Figure 1. Construction of fusion promoters. Frgment A contining the rrnb P1 promoter ws prepred by restriction of plsmid ppl with BmHI nd Sc. Frgment B contining the tcm promoter ws prepred by cutting plsmid pptcmk with SspI nd HindIl. Both DNA frgments contin single recognition sequence (GCGC) for the enzyme Hinphl corresponding to the discrimintor motif of the promoters. Frgments A nd B were subsequently digested with Hinphl resulting in frgments Al, A2 nd BI, B2. The number 1 fter A (B) refers to the fct tht the corresponding BmHI(SspI)/Hinph1 frgment contins region upstrem of the GCGC motif from rmb P1 (PtcM), wheres A2(B2) is the Hinphl/ScI(HindIl) frgment contining sequences downstrem of the GCGC element. Plsmid ppitm ws finlly generted by cloning frgments Al nd B2 into the BmHI/HindlII sites of vector pkk After elimintion of the rrnb P1 promoter sequence from the plsmid ppl which is lso pkk derivtive digested with SmI nd Scd the frgments A2 nd BI were ligted into this plsmid resulting in plsmid ptmpi. from non-rected mteril on silic gel thin-lyer pltes. The synthesis rte is given s nmoles cetylted chlormphenicol synthesized per minute nd normlized to cell density equivlent to lod6w. fl-lctmse (BLA) ctivity mesurements The ctivity of j3-lctmse ws mesured ccording to the procedure by Lupski et l., 1984 (2). 1 BLA unit is defined s the decrese in opticl density t 255 nm per minute of.1mm cephlosporine solution. Dt were finlly normlized to cell density equivlent to IOD6w. CAT nd BLA messenger RNA determintion loml cells grown to n opticl density between.3 nd.5od6w were suspended in mixture of 7.5ml ethnol, 2ml 3M NOAc nd.5ml phenol (cooled to -7 C). After centrifugtion t 12 g for 1 minutes the cells were resuspended in.5 ml lysozyme solution (5mg/ml) t C. After 2 minutes 5,ul of 1% SDS nd.5ml phenol were dded. The mixture ws heted for 2 minutes t 65 C. After centrifugtion the queous phse ws collected nd nucleic cids were precipitted with ethnol. Up to 2/Ag of the isolted nucleic cids were directly nlyzed by Northern blot nlysis (21), with either CAT or BLA gene frgments s hybridiztion probes. The probes were lbeled with [32P] by the rndom primer method ccording to (22). The mounts of CAT nd BLA mrna were ssyed by determining the rdioctivity in the CAT or BLA lbeled bnds.

3 Nucleic Acids Reserch, Vol. 18, No P1 : AAATTTCCTCTTGTCAGGCCGGAATAACTCCCTATAATGCGCACCACTGAC PtcW: AAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGA PtcM: AAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGCGGAATTGTGA P1TM : AAATTTCCTCTTGTC&GGCCGGAATAACTCCCTATAATGCGCGGAATTGTGA TMP1: AAATGAGCTGT1GA.AATTAATCATCGGCTCGTATAATGCACCACTGAC 4C J PtCW 1,5 _ l 1,2 - -., , I 44 A 1.52,2 - P , Figure 2. DNA sequences of the different promoter constructs. The -35 nd -1 nd the discrimintor motif re mrked ccordingly. Sequences from rrnb P1 in the fusion promoters re underlined.,3- === =, I= = - =,5 1, 1,5 2, p (1/h),3-- i -,-,5 1, 1,5 2, & (1/h) RESULTS Promoter ctivity of the fusion constructs t different growth rtes The trnscriptionl ctivities of the vrious promoter constructs were mesured in vivo utilizing system tht directly correltes the enzyme ctivity of the CAT gene product to the promoter sequence locted upstrem of the cistron. Enzyme determintions of the non-regulted BLA gene (23) encoded on the sme plsmid served s n internl stndrd to correct for possible differences in plsmid copy number. The growth rte dependent expression of CAT enzyme directed by the vrious promoter constructs ws mesured using E. coli strins CF (14) trnsformed with plsmids pp1, pptcw, pp1tm nd ptmp1. These bcteri re chrcterized by different muttions in the coding region of the spotgene which is necessry for the degrdtion of gunosine tetrphosphte. As consequence, the intrcellulr ppgpp level in ech strin is different nd the cells grow t defined but different rtes in the sme medium. This fct ws used to test the growth rte dependence of the fusion promoter constructs, thereby excluding possible effects due to different culture medi. CAT nd BLA ctivities were determined from bcteril cultures grown in medium S (see Mterils nd Methods) to n opticl density (OD6W) of.3 to.4. All enzyme determintions were performed with bcteri diluted severl times into fresh nd prewrmed (37 C) medi to ensure logrithmic growth. The fusion promoter plsmid ptmpi differs from the clone ppi only in the region upstrem from the trnscription strt site nd the sme holds true for pptcw nd ppitm. Since in both cses the two constructs produce identicl mrna molecules the differences in the CAT/BLA rtios directly reflect differences in the promoter ctivity. The corresponding CAT mrnas of the constructs ppltm nd ptmp1 differ by bout 5 bses t the 5'-end. Therefore, in this cse one cnnot exclude possible effects due to different mrna stbilities. However in prlell study using the sme test vector the sme growth rte dependence ws noted when enzyme ctivities or mrna levels were mesured (24). The CAT/BLA rtios of the vrious trnsformnts s function of their growth rte is shown in Figure 3. For better comprison, the rtio t the highest growth rte ws set lwys to 1. nd ctivities t lower growth rtes were normlized ccordingly. Note, t the highest growth rte the TMP1 promoter hs 2 times higher CAT/BLA ctivity thn the rrnb P1 promoter. Wheres the ctivity of P1TM (with the downstrem tcm region) is lower thn the ctivity of PtcW by fctor of 2. Promoter construct TMP1 showed no strong qulittive difference to the non-regulted PtcW promoter. Indeed, only very wek growth rte dependence of its ctivity ws found. 4c 44 V. =,3 i2 1,2- PITM,5 1, 1,5 2, & (1/h) 4- E 1,5 1,2,9 T,6,3 =-= TMP1, =- _Z_Z,5 1, 1,5 Figure 3. Growth rte dependence in spotstrins. The vrious plsmid constructs were trnsformed into the spotstrins CF s well s CF898 (spot +). CAT/BLA rtios of the different trnsformnts were determined s described in Mterils nd Methods. The trnsformed bcteri grow t different rtes in the sme medium (medium S) in the order: CF898 > CF943 > CF944 >CF945 >CF946, representing the order of the individul dt points (note: for the controls P1 nd pptcw no mesurement ws mde in CF946). Stndrd devitions were clculted from three independent mesurements. 4- S1 & (1 /h) it (1 /h) 2, * ppitm O ptmp1 Figure 4. Growth rte dependence of the promoter ctivity. The digrms represent the vrition of the CAT/BLA rtio of E.coli CP78 cells trnsformed with the different plsmids upon growth rte. The CAT/BLA rtio t the highest growth rte ws set to 1. nd the rtios t lower growth rtes were normlized ccordingly. Error brs indicte the stndrd devition from minimum of three independent determintions. The promoter P1TM clerly specified growth rte dependent vrition of the CAT/BLA rtio when compred to PtcW lthough to much lesser extend thn clone ppl. In ddition, the growth rte dependence of the fusion promoters ws mesured using E.coli CP78 trnsformnts grown in different medi. The results outlined in Figure 4 confirmed the dt obtined with the spottrnsformnts. Agin, the promoter P1TM

4 6274 Nucleic Acids Reserch, Vol. 18, No. 21 Tble 1. Promoter ctivity increse with incresing growth rte M-vlue Promoter in E.coli CP78 in spot strins PtcW -,11 -,12 PtcM,5,9 rrnb P1,73,72 rrnb P2,13,21 P2F,71,85 P1TM,4,33 TMPI,12,17 The vlues were obtined by liner lest squre fit of the dt points from Figures 3 nd 4 with M representing the slope of the regression lines. M vlues for the promoters P2, P2F nd PtcM were derived from the dt presented in Zchris et l. (4). showed slight increse in the CAT/BLA ctivity with incresing growth rte. Almost no growth rte dependence ws visible for the fusion construct TMP1. The slope of the liner regression lines (M) s shown in Figures 3 nd 4 cn be introduced s quntittive mesure of the growth rte dependent promoter ctivity. M vlues for the different promoter constructs re summrized in Tble 1. Incresing vlues of M correspond to n incresed growth rte dependence. The vlues for the promoters P2, P2F, PtcM studied in Zchris et l., 1989 (4) re given for comprison. Stringent response of the fusion promoters E. coli CP78 cells trnsformed with the plsmids ppl, pptcw, pptcmk, pp2, pp2f nd the fusion constructs were grown in medium SR to n opticl density (OD16w) of.4 nd subsequently strved for isoleucine by the ddition of vline (.5 mg/ml). Becuse mino cid strvtion bolishes trnsltion intrcellulr CAT nd BLA mrna levels nd not the enzyme ctivities were determined by Northern nlysis directly before nd 15 minutes fter onset of strvtion. The BLA expression known not to be stringent sensitive (1) ws determined to compenste for extrction efficiencies nd copy number differences. Agin, the CAT/BLA mrna rtio is corrected mesure of the reltive promoter ctivity. The constructs with the rrnb P1 nd the P2F promoters served s positive controls (known to be stringent sensitive (4)) whilst the derivtives pptcw, pptcmk nd pp2 were used s negtive controls. Figure 5 shows tht the ctivity of the fusion promoter TMP1 is clerly not under stringent control. The chnge of the CAT/BLA rtio of clone ppitm cn be interpreted s wek stringent sensitivity when compred to either promoters P1 or P2F. DISCUSSION Two results from this study support the notion tht both growth rte nd stringent control re governed by the sme moleculr mechnism. Firstly, promoter P1TM which is wekly growth rte regulted is lso wekly stringent regulted. The gretly reduced growth rte dependence of TMP1 prllels nonsensitive behviour with respect to mino cid strvtion. Secondly, s consequence of the finding tht the entire promoter structure is decisive for the regultion of stble RNA synthesis, RNA polymerse seems to be the ultimte trget molecule with ppgpp functioning s n effector substnce. This is in direct support of the RNA polymerse prtition model (25, 26) ccording to which two different interconvertible RNA.9-1,5 - e X 1, m,9-,6 -,3- m 1, T T T T T A B A B A B A B A B A B A B PtcW PtcMk P1 P2 P2F TMP1 P1TM Figure 5. Stringent response of the fusion promoters. CAT/BLA mrna rtios determined by Northern nlysis of the different promoter constructs re given (A) before nd (B) 15 minutes fter onset of mino cid strvtion. The vlues before strvtion re set to 1. nd the rtios fter strvtion re normlized ccordingly. mrna determintions were reproducible within reltive error of 15-2% s indicted by the error brs. polymerse popultions exist in the cell, one being competent for the trnscription of stble RNA genes, the other not. The effector molecule for the interconversion seems to be ppgpp. According to recent results, the X fctor my lso be involved, since it ws shown tht RNA polymerse responded to ppgpp medited ltertions of promoter selectivity in vitro only when ssocited to the X fctor (27). The two different RNA polymerse species (with or without bound ppgpp) my recognize subtly different promoter structures. In the cse of smll repressor protein s feedbck regultor molecule one would expect defined nd limited DNA sequence s trget region. The ctivity of the fusion promoter constructs P1TM nd TMP1 differs from their 'prent' promoters rrnb P1 nd PtcM both in qulittive nd quntittive mnner. The CAT/BLA ctivity of TMP1 t the higest growth rte is greter by fctor of 2 thn the corresponding rtio of promoter rrnb P1 (note tht both promoters produce the sme CAT mrna molecule). In contrst to rrnb P1, TMP1 contins cnonicl -35 sequence which could be the reson for its incresed ctivity. Similr results were obtined by Dickson et l., 1989 (28) who found tht point muttion introducing cnonicl -35 region into rrnb P1 led to n incresed promoter ctivity. In line with this result the decrese of the CAT/BLA rtio of construct P1TM s compred to PtcW (with the sme coding region) cn be ttributed to the substitution of consensus -35 region (in PtcW) by the noncnonicl sequence from rrnb P1. Stble RNA promoters re generlly chrcterized by noncnonicl -35 regions. Therefore, it is possible tht this motif in TMP1 is incomptible with stringent or growth rte regultion, which in turn would explin why construct TMP1 specifies growth rte independent ctivity. On the other hnd, fusion promoter P1TM which hs GCGC sequence nd lcks consensus -35 region, lso does not clerly confer growth rte nd stringent control. This demonstrtes tht the recognition principle must be more complex nd goes beyond these two requirements. Clerly our results indicte tht neither the GCGC discrimintor motif nor downstrem or upstrem sequences from rrnb P1 lone were sufficient to chieve growth rte or stringent regultion in comprble mnner to rrnb P1. The growth rte ws vried in two wys: either by growing trnsformed CP78 cells in

5 Nucleic Acids Reserch, Vol. 18, No different medi or by mesuring the ctivity of the plsmid constructs in different spot mutnt strins. Similr results were obtined, independent of the experimentl design of the growth rte vrition. The fct tht the fusion derivtive P1TM showed stronger growth rte dependence when compred to construct TMP1 points to slightly greter importnce for sequences upstrem of the GCGC motif for growth rte regultion thn downstrem regions. This result is in good greement with experimentl dt from Dickson et l., 1989 (28). The uthors identified severl point muttions in the spcer sequence between the -35 nd -1 regions in the rrnb P1 promoter sequence which disrupted growth rte control. We hve shown previously tht point muttion introducing the GCGC discrinrtor motif into the rrnb P2 promoter chnged the promoter to both growth rte nd stringent sensitivity (4). The rrnb P2 sequence hs much weker homology to the rrnb P1 promoter thn for exmple the fusion promoter P1TM. Despite the reduced sequence homology, the P2F promoter showed stronger functionl homology to the rrnb P1 with respect to its regultive behviour. This is suggestive of sitution where the regultory properties specified by promoter my lso be determined by the higher order structure of the entire promoter motif. 25. Ryls,J. nd Bremer,H. (1982) J. Bcteriol. 15, Little,R., Ryls,J. nd Bremer,H. (1983) J. Bcteriol. 154, Igrshi,K., Fujit,N. nd Ishihm,A. (1989) Nucleic Acids Res. 17, Dickson,R.R., Gl,T., deboer,h.a., de Hseth,P.L. nd Gourse,R.L. (1989) J. Bcteriol. 171, ACKNOWLEDGEMENTS We re grteful to Brbel Kleuvers nd Mrgot Weber for technicl help. We thnk Ctherine Prescott, Richrd Brimcombe nd Alp Subrmnin for criticl reding of the mnuscript nd helpful comments. We re gretly indebted to the lte Heinz-Gunter Wittmnn for his support. REFERENCES 1. Gusing,K. (1977) J. Mol. Biol. 115, Trvers,A.A. (1976) Mol. Gen. Genet., 147, Brchini,E. nd Bremer,B. (1988) J. Bio. Chem., 263, Zchris,M., Goringer,H.U. nd Wgner,R. (1989) EMBO J., 8, Gourse,R.L., deboer,h.a. nd Nomur,M. (1986) Cell, 44, Duester,G., Elford,R.M. nd Holmes,W.M. (1982) Cell, 3, Lmond,A.I. nd Trvers,A.A. (1985) Cell, 4, Trvers,A.A. (198) J. Bcteriol., 141, Trvers,A.A. (1984) Nucleic Acids Res., 12, Lmond,A.I. nd Trvers,A.A. (1985) Cell, 41, Trvers,A.A., Lmond,A.I. nd Weeks,J.R. (1986) J. Mol. Biol., 189, Mizushim-Sugno,J nd Kziro, Y. (1985) EMBO J. 4, Fiil,N. nd Friesen,D. (1968) J. Bcteriol., 95, Srubbi,E., Rudd,K.E. nd Cshel,M. (1988) Mol. Gen. Genet., 213, Neidhrdt,F.C., Bloch,P.L. nd Smith,D.,F. (1974) J. Bcteriol., 119, Brosius,J. (1984) Gene, 27, Snger,F., Nicklen,S. nd Coulson,A.R. (1977) Proc. Ntl. Acd. Sci. USA, 74, Zchris,M. nd Wgner,R. (1989) Mol. Microbiol., 3, Gormn,C.M., Mofft,C.F. nd Howrd,B.H. (1982) Mol. Cell. Biol., 2, Lupski,J.R., Ruize,A.A. nd Godson,G.N. (1984) Mol. Gen. Genet., 195, Mnitis,T., Fritsch,E.F. nd Smbrook,J. (1982) Moleculr Cloning. A Lbortory Mnul. Cold Spring Hrbor Lbortory Press, Cold Spring Hrbor NY. 22. Feinberg,A.P. nd Vogelstein,B. (1984) Anl. Biochem., 137, Klotzky,R.A. nd Schwrtz,I. (1987) Gene, 55, Deneer,H.G. nd Spiegelmn,G.B. (1987) J. Bcteriol. 169,