The signal for growth rate control and stringent sensitivity in E. coli is not restricted to a particular sequence motif within the promoter region
|
|
- Lauren Montgomery
- 6 years ago
- Views:
Transcription
1 .n) 199 Oxford University Press Nucleic Acids Reserch, Vol. 18, No The signl for growth rte control nd stringent sensitivity in E. coli is not restricted to prticulr sequence motif within the promoter region M.Zchris, H.U.G6ringer' nd R.Wgner1 * Mx-Plnck-lnstitut for Molekulre Genetik, Abteilung Wittmnn, IhnestrBe 73, D-1 Berlin 33 nd 'Institut for Physiklische Biologie, Heinrich-Heine-Universitt DOsseldorf, UniversittsstrB3e 1, D-4 Dusseldorf 1, FRG Received July 27, 199; Revised nd Accepted October 2, 199 ABSTRACT Hybrid promoter constructs were used to determine the DNA sequence requirements for stringent nd growth rte control within promoter region. The promoters were obtined by fusing complementing sequence regions locted upstrem nd downstrem from the GCGC discrimintor motif of the growth rte regulted rrna P1 promoter nd non-regulted tc promoter vrint. The ctivities nd the regultory response of the hybrid promoters were determined in vivo using promoter test vector system with the chlormphenicol cetyltrnsferse (CAT) reporter gene. Mesurements were mde t different growth rtes nd fter strvtion for isoleucine to induce the stringent response. Neither the upstrem nor the downstrem sequence of P1 reltive to the GCGC discrimintor motif conferred comprble regultory fetures when fused to the complementing sequences of the non-regulted mutnt tc promoter. A minor response to mino cid deprivtion or chnges in the growth rte ws noted for the hybrid promoter with the rrnb P1 upstrem segment nd the tc downstrem element, pointing to slightly different importnce of the two sequence elements for regultion. The prllel effects for stringent s well s growth rte regultion of the hybrid promoters supports the view of common mechnism for both types of control. However, none of the promoter sequence elements on its own ws ble to restore the complete regultory behviour of their 'prent' promoters. INTRODUCTION The synthesis of bcteril ribosoml RNA (rrna) nd trnsfer RNA (trna) is controlled by two regultory networks: Stringent control nd growth rte dependent regultion. Stringent control denotes the rpid decline of trnscription of rrna nd trna upon deprivtion of essentil mino cids. Growth rte regultion reltes to the observtion tht the synthesis of stble RNAs in exponentilly growing bcteri is not constnt but roughly proportionl to the squre of the growth rte, nd thereby dpted to the demnd required for protein biosynthesis (1). An incresing body of evidence points to scenrio where both regultory phenomen re bsed on the sme moleculr mechnism with gunosine tetrphosphte (ppgpp) being the effector molecule (2, 3, 4). DNA sequence determinnts for both stringent response nd growth rte regultion re clerly linked to the promoter regions of the vrious regulted genes. In the cse of the rrnb P1, the leuv nd the tyrt promoters the trget sequences necessry for regultion ws found to be restricted to region between position -5 nd the trnscription strt site (5, 6, 7). A so-clled discrimintor motif with the primry sequence GCGCcNc, locted downstrem of the -1 promoter region in close proximity to the trnscription initition site ws identified by comprison of vrious stble RNA (trna nd rrna) promoter sequences (8, 9). In the cse of the tyrtpromoter, the prtil substitution of this discrimintor element by four A/T bse pirs led to the disruption of both stringent sensitivity nd growth rte regultion for this gene product (1, 11). In the cse of the tu.b operon, ltertions in the GC-rich discrimintor motif disrupted the sensitivity to ppgpp in vitro (12). Further support for the importnce of this sequence element cme from recently published experiments where the consensus motif ws introduced into the non-regulted rrnb P2 promoter by n A to G trnsition t position -6 reltive to the trnscription strt site (4). The muttion conferred both growth rte nd stringent regultion. However, the sme discrimintor sequence linked to the tc promoter sequence (tcm) did not convert this promoter to either stringency or growth rte regultion (4). This clerly demonstrted tht dditionl structurl fetures of stble RNA promoters locted either downstrem or upstrem from the GCGC-sequence re necessry for both types of regultion. To loclize these dditionl elements we constructed fusion promoter sequences between downstrem nd upstrem regions from the growth rte regulted rrnb P1 promoter nd the corresponding * To whom correspondence should be ddressed + Present ddress: Settle Biomedicl Reserch Institute, 4 Nickerson Street, Settle, WA , USA
2 6272 Nucleic Acids Reserch, Vol. 18, No. 21 elements of the non-regulted tcm promoter. In vivo nlysis of the fusion promoters clerly indicte tht neither the GCGC motif nor upstrem or downstrem sequences lone re sufficient for complete regultion comprble to the rmb P1 promoter. rrnb P1 promoter (frgment A) BmHI HinphI Scl I I l tcm promoter (frgment B) Sspi Hinphl Hindill I I I B2 METHODS Strins nd medi All bcteril strins used in this study were E. coli K12 derivtives. CP 78 (13), CF nd CF 898 hve been described (14). The different medi were derived from MOPS medium (15) nd were substituted with vrious crbon sources (succinte.2% (w/v), cette.2% (w/v), glycerol.2% (v/v) or glucose.2% (w/v)) s well s csminocid concentrtions between.5 %- nd 1 % (w/v). Medium SR ws MOPS contining.2% (w/v) glucose nd 4 mg/ml of ll mino cids except for vline nd isoleucine. Medium S ws MOPS supplemented with.2% (w/v) glucose nd.2% (w/v) csminocids. The phosphte concentrtion ws lwys 5 mm. Cell cultures of trnsformnts contining plsmids with the tc promoter derivtives PtcW, PtcM or P1TM (see next section) were supplemented with 2 mm IPTG to ensure full induction of trnscription from these promoters. Plsmids The plsmids pptcw, pptcm, ppl, pp2, pp2f re described in (4). They re derivtives of the promoter test vector pkk232-8 with multicloning site nd the CAT reporter gene (16). Corresponding to the bove order the constructs contin the tc promoter (pptcw), modified tc promoter (pptcm) with the GCGC discrimintor motif, the rrnb P1 promoter (pp1), the rrnb P2 promoter (pp2) nd the P2F promoter ( rrnb P2 promoter contining the GCGC sequence (pp2f)). Plsmids ptmp1 nd ppltm re constructs with downstrem nd upstrem sequences reltive to the discrimintor motif from rmnb P1 nd PtcM. Plsmids pp1 contining the rmb P1 promoter sequence s BmHI/ScI restriction frgment (4) nd pptcmk served s 'prent' plsmids for the construction of the fusion promoters. Plsmid pptcmk is derivtive of pptcm with the tcm promoter on 268 bp BmHI/HindlII insert insted of the 376 bp Su3A frgment in pptcm (4). The fct tht the GCGC discrimintor motif is recognized by HinpHI ws used to generte nd combine downstrem nd upstrem sequences reltive to the GCGC sequence from the rrnb P1 nd tcm promoters. Detils of the construction re given in the legend to Figure 1. The promoter with the upstrem rrnb P1 nd downstrem tcm sequences ws designted P1TM. TMP1 refers to the construct contining the upstrem tcm nd downstrem rmnb P1 regions. It should be noted tht the 16 bp spcing between the -1 nd -35 regions ws not ffected in ny of the fusion promoters. The finl bse sequences of the fusion promoters were verified by DNA sequencing of the corresponding frgments ccording to (17). Figure 2 detils ll primry sequences of the different promoter constructs tht were used in this study. Assy for chlormphenicol cetyltrnsferse (CAT) Cells were lysed ccording to Zchris nd Wgner, 1989 (18) nd the CAT-ctivity ws determined s the rte of chlormphenicol cetyltion ccording to (19) using [14C] chlormphenicol: Acetylted rection products were seprted B1 Bi A2 = pp1tm = ptmp1 Figure 1. Construction of fusion promoters. Frgment A contining the rrnb P1 promoter ws prepred by restriction of plsmid ppl with BmHI nd Sc. Frgment B contining the tcm promoter ws prepred by cutting plsmid pptcmk with SspI nd HindIl. Both DNA frgments contin single recognition sequence (GCGC) for the enzyme Hinphl corresponding to the discrimintor motif of the promoters. Frgments A nd B were subsequently digested with Hinphl resulting in frgments Al, A2 nd BI, B2. The number 1 fter A (B) refers to the fct tht the corresponding BmHI(SspI)/Hinph1 frgment contins region upstrem of the GCGC motif from rmb P1 (PtcM), wheres A2(B2) is the Hinphl/ScI(HindIl) frgment contining sequences downstrem of the GCGC element. Plsmid ppitm ws finlly generted by cloning frgments Al nd B2 into the BmHI/HindlII sites of vector pkk After elimintion of the rrnb P1 promoter sequence from the plsmid ppl which is lso pkk derivtive digested with SmI nd Scd the frgments A2 nd BI were ligted into this plsmid resulting in plsmid ptmpi. from non-rected mteril on silic gel thin-lyer pltes. The synthesis rte is given s nmoles cetylted chlormphenicol synthesized per minute nd normlized to cell density equivlent to lod6w. fl-lctmse (BLA) ctivity mesurements The ctivity of j3-lctmse ws mesured ccording to the procedure by Lupski et l., 1984 (2). 1 BLA unit is defined s the decrese in opticl density t 255 nm per minute of.1mm cephlosporine solution. Dt were finlly normlized to cell density equivlent to IOD6w. CAT nd BLA messenger RNA determintion loml cells grown to n opticl density between.3 nd.5od6w were suspended in mixture of 7.5ml ethnol, 2ml 3M NOAc nd.5ml phenol (cooled to -7 C). After centrifugtion t 12 g for 1 minutes the cells were resuspended in.5 ml lysozyme solution (5mg/ml) t C. After 2 minutes 5,ul of 1% SDS nd.5ml phenol were dded. The mixture ws heted for 2 minutes t 65 C. After centrifugtion the queous phse ws collected nd nucleic cids were precipitted with ethnol. Up to 2/Ag of the isolted nucleic cids were directly nlyzed by Northern blot nlysis (21), with either CAT or BLA gene frgments s hybridiztion probes. The probes were lbeled with [32P] by the rndom primer method ccording to (22). The mounts of CAT nd BLA mrna were ssyed by determining the rdioctivity in the CAT or BLA lbeled bnds.
3 Nucleic Acids Reserch, Vol. 18, No P1 : AAATTTCCTCTTGTCAGGCCGGAATAACTCCCTATAATGCGCACCACTGAC PtcW: AAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGA PtcM: AAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGCGGAATTGTGA P1TM : AAATTTCCTCTTGTC&GGCCGGAATAACTCCCTATAATGCGCGGAATTGTGA TMP1: AAATGAGCTGT1GA.AATTAATCATCGGCTCGTATAATGCACCACTGAC 4C J PtCW 1,5 _ l 1,2 - -., , I 44 A 1.52,2 - P , Figure 2. DNA sequences of the different promoter constructs. The -35 nd -1 nd the discrimintor motif re mrked ccordingly. Sequences from rrnb P1 in the fusion promoters re underlined.,3- === =, I= = - =,5 1, 1,5 2, p (1/h),3-- i -,-,5 1, 1,5 2, & (1/h) RESULTS Promoter ctivity of the fusion constructs t different growth rtes The trnscriptionl ctivities of the vrious promoter constructs were mesured in vivo utilizing system tht directly correltes the enzyme ctivity of the CAT gene product to the promoter sequence locted upstrem of the cistron. Enzyme determintions of the non-regulted BLA gene (23) encoded on the sme plsmid served s n internl stndrd to correct for possible differences in plsmid copy number. The growth rte dependent expression of CAT enzyme directed by the vrious promoter constructs ws mesured using E. coli strins CF (14) trnsformed with plsmids pp1, pptcw, pp1tm nd ptmp1. These bcteri re chrcterized by different muttions in the coding region of the spotgene which is necessry for the degrdtion of gunosine tetrphosphte. As consequence, the intrcellulr ppgpp level in ech strin is different nd the cells grow t defined but different rtes in the sme medium. This fct ws used to test the growth rte dependence of the fusion promoter constructs, thereby excluding possible effects due to different culture medi. CAT nd BLA ctivities were determined from bcteril cultures grown in medium S (see Mterils nd Methods) to n opticl density (OD6W) of.3 to.4. All enzyme determintions were performed with bcteri diluted severl times into fresh nd prewrmed (37 C) medi to ensure logrithmic growth. The fusion promoter plsmid ptmpi differs from the clone ppi only in the region upstrem from the trnscription strt site nd the sme holds true for pptcw nd ppitm. Since in both cses the two constructs produce identicl mrna molecules the differences in the CAT/BLA rtios directly reflect differences in the promoter ctivity. The corresponding CAT mrnas of the constructs ppltm nd ptmp1 differ by bout 5 bses t the 5'-end. Therefore, in this cse one cnnot exclude possible effects due to different mrna stbilities. However in prlell study using the sme test vector the sme growth rte dependence ws noted when enzyme ctivities or mrna levels were mesured (24). The CAT/BLA rtios of the vrious trnsformnts s function of their growth rte is shown in Figure 3. For better comprison, the rtio t the highest growth rte ws set lwys to 1. nd ctivities t lower growth rtes were normlized ccordingly. Note, t the highest growth rte the TMP1 promoter hs 2 times higher CAT/BLA ctivity thn the rrnb P1 promoter. Wheres the ctivity of P1TM (with the downstrem tcm region) is lower thn the ctivity of PtcW by fctor of 2. Promoter construct TMP1 showed no strong qulittive difference to the non-regulted PtcW promoter. Indeed, only very wek growth rte dependence of its ctivity ws found. 4c 44 V. =,3 i2 1,2- PITM,5 1, 1,5 2, & (1/h) 4- E 1,5 1,2,9 T,6,3 =-= TMP1, =- _Z_Z,5 1, 1,5 Figure 3. Growth rte dependence in spotstrins. The vrious plsmid constructs were trnsformed into the spotstrins CF s well s CF898 (spot +). CAT/BLA rtios of the different trnsformnts were determined s described in Mterils nd Methods. The trnsformed bcteri grow t different rtes in the sme medium (medium S) in the order: CF898 > CF943 > CF944 >CF945 >CF946, representing the order of the individul dt points (note: for the controls P1 nd pptcw no mesurement ws mde in CF946). Stndrd devitions were clculted from three independent mesurements. 4- S1 & (1 /h) it (1 /h) 2, * ppitm O ptmp1 Figure 4. Growth rte dependence of the promoter ctivity. The digrms represent the vrition of the CAT/BLA rtio of E.coli CP78 cells trnsformed with the different plsmids upon growth rte. The CAT/BLA rtio t the highest growth rte ws set to 1. nd the rtios t lower growth rtes were normlized ccordingly. Error brs indicte the stndrd devition from minimum of three independent determintions. The promoter P1TM clerly specified growth rte dependent vrition of the CAT/BLA rtio when compred to PtcW lthough to much lesser extend thn clone ppl. In ddition, the growth rte dependence of the fusion promoters ws mesured using E.coli CP78 trnsformnts grown in different medi. The results outlined in Figure 4 confirmed the dt obtined with the spottrnsformnts. Agin, the promoter P1TM
4 6274 Nucleic Acids Reserch, Vol. 18, No. 21 Tble 1. Promoter ctivity increse with incresing growth rte M-vlue Promoter in E.coli CP78 in spot strins PtcW -,11 -,12 PtcM,5,9 rrnb P1,73,72 rrnb P2,13,21 P2F,71,85 P1TM,4,33 TMPI,12,17 The vlues were obtined by liner lest squre fit of the dt points from Figures 3 nd 4 with M representing the slope of the regression lines. M vlues for the promoters P2, P2F nd PtcM were derived from the dt presented in Zchris et l. (4). showed slight increse in the CAT/BLA ctivity with incresing growth rte. Almost no growth rte dependence ws visible for the fusion construct TMP1. The slope of the liner regression lines (M) s shown in Figures 3 nd 4 cn be introduced s quntittive mesure of the growth rte dependent promoter ctivity. M vlues for the different promoter constructs re summrized in Tble 1. Incresing vlues of M correspond to n incresed growth rte dependence. The vlues for the promoters P2, P2F, PtcM studied in Zchris et l., 1989 (4) re given for comprison. Stringent response of the fusion promoters E. coli CP78 cells trnsformed with the plsmids ppl, pptcw, pptcmk, pp2, pp2f nd the fusion constructs were grown in medium SR to n opticl density (OD16w) of.4 nd subsequently strved for isoleucine by the ddition of vline (.5 mg/ml). Becuse mino cid strvtion bolishes trnsltion intrcellulr CAT nd BLA mrna levels nd not the enzyme ctivities were determined by Northern nlysis directly before nd 15 minutes fter onset of strvtion. The BLA expression known not to be stringent sensitive (1) ws determined to compenste for extrction efficiencies nd copy number differences. Agin, the CAT/BLA mrna rtio is corrected mesure of the reltive promoter ctivity. The constructs with the rrnb P1 nd the P2F promoters served s positive controls (known to be stringent sensitive (4)) whilst the derivtives pptcw, pptcmk nd pp2 were used s negtive controls. Figure 5 shows tht the ctivity of the fusion promoter TMP1 is clerly not under stringent control. The chnge of the CAT/BLA rtio of clone ppitm cn be interpreted s wek stringent sensitivity when compred to either promoters P1 or P2F. DISCUSSION Two results from this study support the notion tht both growth rte nd stringent control re governed by the sme moleculr mechnism. Firstly, promoter P1TM which is wekly growth rte regulted is lso wekly stringent regulted. The gretly reduced growth rte dependence of TMP1 prllels nonsensitive behviour with respect to mino cid strvtion. Secondly, s consequence of the finding tht the entire promoter structure is decisive for the regultion of stble RNA synthesis, RNA polymerse seems to be the ultimte trget molecule with ppgpp functioning s n effector substnce. This is in direct support of the RNA polymerse prtition model (25, 26) ccording to which two different interconvertible RNA.9-1,5 - e X 1, m,9-,6 -,3- m 1, T T T T T A B A B A B A B A B A B A B PtcW PtcMk P1 P2 P2F TMP1 P1TM Figure 5. Stringent response of the fusion promoters. CAT/BLA mrna rtios determined by Northern nlysis of the different promoter constructs re given (A) before nd (B) 15 minutes fter onset of mino cid strvtion. The vlues before strvtion re set to 1. nd the rtios fter strvtion re normlized ccordingly. mrna determintions were reproducible within reltive error of 15-2% s indicted by the error brs. polymerse popultions exist in the cell, one being competent for the trnscription of stble RNA genes, the other not. The effector molecule for the interconversion seems to be ppgpp. According to recent results, the X fctor my lso be involved, since it ws shown tht RNA polymerse responded to ppgpp medited ltertions of promoter selectivity in vitro only when ssocited to the X fctor (27). The two different RNA polymerse species (with or without bound ppgpp) my recognize subtly different promoter structures. In the cse of smll repressor protein s feedbck regultor molecule one would expect defined nd limited DNA sequence s trget region. The ctivity of the fusion promoter constructs P1TM nd TMP1 differs from their 'prent' promoters rrnb P1 nd PtcM both in qulittive nd quntittive mnner. The CAT/BLA ctivity of TMP1 t the higest growth rte is greter by fctor of 2 thn the corresponding rtio of promoter rrnb P1 (note tht both promoters produce the sme CAT mrna molecule). In contrst to rrnb P1, TMP1 contins cnonicl -35 sequence which could be the reson for its incresed ctivity. Similr results were obtined by Dickson et l., 1989 (28) who found tht point muttion introducing cnonicl -35 region into rrnb P1 led to n incresed promoter ctivity. In line with this result the decrese of the CAT/BLA rtio of construct P1TM s compred to PtcW (with the sme coding region) cn be ttributed to the substitution of consensus -35 region (in PtcW) by the noncnonicl sequence from rrnb P1. Stble RNA promoters re generlly chrcterized by noncnonicl -35 regions. Therefore, it is possible tht this motif in TMP1 is incomptible with stringent or growth rte regultion, which in turn would explin why construct TMP1 specifies growth rte independent ctivity. On the other hnd, fusion promoter P1TM which hs GCGC sequence nd lcks consensus -35 region, lso does not clerly confer growth rte nd stringent control. This demonstrtes tht the recognition principle must be more complex nd goes beyond these two requirements. Clerly our results indicte tht neither the GCGC discrimintor motif nor downstrem or upstrem sequences from rrnb P1 lone were sufficient to chieve growth rte or stringent regultion in comprble mnner to rrnb P1. The growth rte ws vried in two wys: either by growing trnsformed CP78 cells in
5 Nucleic Acids Reserch, Vol. 18, No different medi or by mesuring the ctivity of the plsmid constructs in different spot mutnt strins. Similr results were obtined, independent of the experimentl design of the growth rte vrition. The fct tht the fusion derivtive P1TM showed stronger growth rte dependence when compred to construct TMP1 points to slightly greter importnce for sequences upstrem of the GCGC motif for growth rte regultion thn downstrem regions. This result is in good greement with experimentl dt from Dickson et l., 1989 (28). The uthors identified severl point muttions in the spcer sequence between the -35 nd -1 regions in the rrnb P1 promoter sequence which disrupted growth rte control. We hve shown previously tht point muttion introducing the GCGC discrinrtor motif into the rrnb P2 promoter chnged the promoter to both growth rte nd stringent sensitivity (4). The rrnb P2 sequence hs much weker homology to the rrnb P1 promoter thn for exmple the fusion promoter P1TM. Despite the reduced sequence homology, the P2F promoter showed stronger functionl homology to the rrnb P1 with respect to its regultive behviour. This is suggestive of sitution where the regultory properties specified by promoter my lso be determined by the higher order structure of the entire promoter motif. 25. Ryls,J. nd Bremer,H. (1982) J. Bcteriol. 15, Little,R., Ryls,J. nd Bremer,H. (1983) J. Bcteriol. 154, Igrshi,K., Fujit,N. nd Ishihm,A. (1989) Nucleic Acids Res. 17, Dickson,R.R., Gl,T., deboer,h.a., de Hseth,P.L. nd Gourse,R.L. (1989) J. Bcteriol. 171, ACKNOWLEDGEMENTS We re grteful to Brbel Kleuvers nd Mrgot Weber for technicl help. We thnk Ctherine Prescott, Richrd Brimcombe nd Alp Subrmnin for criticl reding of the mnuscript nd helpful comments. We re gretly indebted to the lte Heinz-Gunter Wittmnn for his support. REFERENCES 1. Gusing,K. (1977) J. Mol. Biol. 115, Trvers,A.A. (1976) Mol. Gen. Genet., 147, Brchini,E. nd Bremer,B. (1988) J. Bio. Chem., 263, Zchris,M., Goringer,H.U. nd Wgner,R. (1989) EMBO J., 8, Gourse,R.L., deboer,h.a. nd Nomur,M. (1986) Cell, 44, Duester,G., Elford,R.M. nd Holmes,W.M. (1982) Cell, 3, Lmond,A.I. nd Trvers,A.A. (1985) Cell, 4, Trvers,A.A. (198) J. Bcteriol., 141, Trvers,A.A. (1984) Nucleic Acids Res., 12, Lmond,A.I. nd Trvers,A.A. (1985) Cell, 41, Trvers,A.A., Lmond,A.I. nd Weeks,J.R. (1986) J. Mol. Biol., 189, Mizushim-Sugno,J nd Kziro, Y. (1985) EMBO J. 4, Fiil,N. nd Friesen,D. (1968) J. Bcteriol., 95, Srubbi,E., Rudd,K.E. nd Cshel,M. (1988) Mol. Gen. Genet., 213, Neidhrdt,F.C., Bloch,P.L. nd Smith,D.,F. (1974) J. Bcteriol., 119, Brosius,J. (1984) Gene, 27, Snger,F., Nicklen,S. nd Coulson,A.R. (1977) Proc. Ntl. Acd. Sci. USA, 74, Zchris,M. nd Wgner,R. (1989) Mol. Microbiol., 3, Gormn,C.M., Mofft,C.F. nd Howrd,B.H. (1982) Mol. Cell. Biol., 2, Lupski,J.R., Ruize,A.A. nd Godson,G.N. (1984) Mol. Gen. Genet., 195, Mnitis,T., Fritsch,E.F. nd Smbrook,J. (1982) Moleculr Cloning. A Lbortory Mnul. Cold Spring Hrbor Lbortory Press, Cold Spring Hrbor NY. 22. Feinberg,A.P. nd Vogelstein,B. (1984) Anl. Biochem., 137, Klotzky,R.A. nd Schwrtz,I. (1987) Gene, 55, Deneer,H.G. nd Spiegelmn,G.B. (1987) J. Bcteriol. 169,
Best Practices for PCR Assays in Seed Health Tests Version 3.0; June 2018
Best Prctices for PCR Assys in Seed Helth Tests Version 3.0; June 2018 Polymerse Chin Rection (PCR) is currently the most commonly utilized moleculr technique in seed helth testing. This document provides
More informationPrimer in Population Genetics
Primer in Popultion Genetics Hierrchicl Orgniztion of Genetics Diversity Primer in Popultion Genetics Defining Genetic Diversity within Popultions Polymorphism number of loci with > 1 llele Number of lleles
More informationThree-Phase Wound-Rotor Induction Machine with a Short- Circuited Rotor
Exercise 1 Three-Phse Wound-Rotor Induction Mchine with Short- Circuited Rotor EXERCISE OBJECTIVE When you hve completed this exercise, you will know how three-phse woundrotor induction mchine cn operte
More informationThree-Phase Wound-Rotor Induction Machine with Rotor Resistance
Exercise 2 Three-Phse Wound-Rotor Induction Mchine with Rotor Resistnce EXERCISE OBJECTIVE When you hve completed this exercise, you will know the effects of vrying the rotor resistnce of three-phse wound-rotor
More informationSUPPLEMENTARY INFORMATION
SI Fig. PrpS is single copy gene k 3. 9... EcoRV EcoRV k 5 BmH Pst c well k HindIII HindIII HindIII.3.5 3.. Southern lots of Ppver genomic DNA from plnts with SS8 hplotypes, hyridized with PrpS proe..
More information[ HOCl] Chapter 16. Problem. Equilibria in Solutions of Weak Acids. Equilibria in Solutions of Weak Acids
Equilibri in Solutions of Wek Acids Chpter 16 Acid-Bse Equilibri Dr. Peter Wrburton peterw@mun.c http://www.chem.mun.c/zcourses/1011.php The dissocition of wek cid is n equilibrium sitution with n equilibrium
More informationA Little More Advanced Biotechnology Tools. Engineered plasmids. Selection for plasmid uptake. Better Plasmids. Antibiotic becomes a selecting agent
A Little More Advnced Biotechnology Tools Better Plsmids Engineered plsmids Building custom plsmids restriction enzyme sites ntibiotic resistnce genes s selectble mrker EcoRI BmHI HindIII restriction sites
More informationBiofilm Formation by Escherichia coli csga and fima mutants
Journl of Undergrdute Reserch t Minnesot Stte University, Mnkto Volume 14 Article 9 2014 Biofilm Formtion by Escherichi coli csga nd fima mutnts Nicole Snyder Minnesot Stte University, Mnkto Sen Willert
More informationNonlinear Mixed Effects Model for Swine Growth
Nonliner Mixed Effects Model for Swine Growth A. P. Schinckel nd B. A. Crig Deprtment of Animl Sciences nd Deprtment of Sttistics, Purdue University Introduction Severl nonliner growth functions model
More informationHigh strength fine grained structural steel, thermo-mechanically rolled, for high temperature application
P420M HT High strength fine grined structurl steel, thermo-mechniclly rolled, for high temperture ppliction Specifiction DH-E52-D, edition April 2016 1 P420M HT is high strength thermomechniclly rolled
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2885 kd M ΔNZipA 66.4 55.6 ZipA 42.7 34.6 6x His NiNTA 27.0 c 1.,, 2. evnescent field supported memrne Supplementry Figure 1 Experimentl ssy. () Illustrtion of protein interctions (dpted
More informationIn situ evaluation of DGT techniques for measurement of trace. metals in estuarine waters: a comparison of four binding layers
Electronic Supplementry Mteril (ESI) for Environmentl Science: Processes & Impcts. This journl is The Royl Society of Chemistry 2015 Supplementry Informtion for: In situ evlution of DGT techniques for
More information2016 Prelim Essay Question 2
216 Prelim Essy Question 2 In recent yers, the price of nturl fertilisers for orgnic brown rice production hs risen nd helthy living cmpigns re seeing more consumers switching from nonorgnic white rice
More information6.1 Damage Tolerance Analysis Procedure
6. Dmge Tolernce Anlysis Procedure For intct structure the nlysis procedures for Slow Crck Growth nd Fil Sfe structure re essentilly the sme. An initil flw is ssumed nd its growth is nlyzed until filure
More informationSpecies-Specific Signals for the Splicing of a Short Drosophila Intron In Vitro
MOLECULAR AND CELLULAR BIOLOGY, Feb. 1993, P. 114-1118 27-736/93/2114-15$2./ Copyright 1993, Americn Society for Microbiology Vol. 13, No. 2 Species-Specific Signls for the Splicing of Short Drosophil
More informationAn insight into itraq: where do we stand now?
Anlyticl nd Bionlyticl Chemistry Electronic Supplementry Mteril An insight into itraq: where do we stnd now? Croline Evns, Josselin Noirel, Sw Yen Ow, Mlind Slim, An G. Pereir-Medrno, Nrciso Couto, Jgroop
More informationa b c Nature Neuroscience: doi: /nn.3632
c Supplementry Figure 1. The reltion etween stndrd devition (STD) nd men of inter-press intervls (IPIs) under different schedules. -c, Disproportionlly fster decrese of the stndrd devition compred to the
More informationFluorescence Intensities of. GFP-PAC-1 Strains
DOI: 10.1038/ncb3168 Arbitrry Fluorescence Units 2500 2000 1500 1000 500 0 full length (1-4) Fluorescence Intensities of GFP-PAC-1 Strins ΔPH 392-838 575-4 GFP-PAC-1 Strins 2-610 1-574 b control c pc-1(3
More informationTopic 7. Acids, Bases, Buffers, Titrations, Polyprotic acids
Topic 7 cids, Bses, Buffers, Titrtions, Polyprotic cids Conjugte cids & bses Strengths of cids & bses strong cid or strong bse is completely dissocited in queous solution. Wek cids nd Wek Bses Crboxylic
More informationEffect of Tantalum Additions to a Cobalt-Chromium-Nickel
Effect of Tntlum Additions to Coblt-Chromium-Nickel Bse Alloy A. P. ROWE, W. C. BIGELOW, nd K. ASGAR University of Michign, School of Dentistry, Ann Arbor, Michign 48104, USA An investigtion by electron
More information1 Information, Persuasion, and Signalling
ECON 312: Advertising 1 We will now exmine nother strtegic vrible vilble to firms, tht of dvertising. Industril Orgniztion Advertising 1 Informtion, Persusion, nd Signlling 1.1 Persusion versus Informtion
More informationChapter 9. Quadratics
Chpter 9 Qudrtics Artificil Body Prts 9.1 Solving Qudrtic Equtions by Fctoring 9. Completing the Squre 9.3 The Qudrtic Formul 9.4 Eponentil Functions (Growth nd Decy) Chpter Review Chpter Test 147 Section
More informationNumerical Analysis of a Reinforced Concrete Slab-Column Connection Subjected to Lateral & Vertical Loading
, Mrch 15-17, 2017, Hong Kong Numericl Anlysis of Reinforced Concrete Slb-Column Connection Subjected to Lterl & Verticl Loding Mostfiz Emtiz, A.S.M. Aluddin Al Azd, H. M. Shhin b nd Sultn Al Shfin c Abstrct
More informationTranscription factors mediate rrna synthesis during myogenesis
Eur. J. Biochem. 171.37-43 (1988) FEBS 1988 Trnscription fctors medite rrna synthesis during myogenesis Peter ZAHRADKA nd Bruce H. SELLS Deprtment of Moleculr Biology nd Genetics, College of Biologicl
More informationENVIRONMENTAL AUDIT OF THE SITES IMPACTED BY THE PROBO KOALA TOXIC WASTE DUMPING IN ABIDJAN, CÔTE D IVOIRE
ENVIRONMENTAL AUDIT OF THE SITES IMPACTED BY THE PROBO KOALA TOXIC WASTE DUMPING IN ABIDJAN, CÔTE D IVOIRE This series of fct sheets ws prepred s prt of UN Environment s environmentl udit of the sites
More informationTHERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING
Journl of Mining nd Metllurgy, 38 (1 2) B (2002) 93-102 THERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING N.Mitevsk* nd @.D.@ivkovi}** *RTB BOR, Copper Institute, 19210 Bor, Yugoslvi
More informationThe Effect of SFAS No. 131 on the Diversification Discount
The Effect of SFAS No. 131 on the Diversifiction Discount Seoungpil Ahn Sogng Business School, Sogng University PA706, 35 Bekbeom-ro, Mpo-gu, Seoul 121-742, Kore E-mil: sphn@sogng.c.kr Received: July 2,
More informationSupplementary Figure 1. Zhang et al.
Supplementry Figure 1. Zhng et l. T30-SurA: GGCAGTTTCATCATGAATGTGCAGGAGCTTGCAACAATTAAGGTGGAGAATCTCCC T30-SurB: GGCAGTTTCATCATGAATGTGCAGGAGCTAGCAACTATTAAGGTGGAGAATCTCCC T41-SurA: ACTGAATAATCAACACTTGGGAATGGTGGTTCAATGGGAGGATCGGTTCTAT
More informationComplex Regulation of the Muscle-Specific Contractile Protein
MOLECULAR AND CELLULAR BIOLOGY, Sept. 1987, p. 3065-3075 Vol. 7, No. 9 0270-7306/87/093065-11$02.00/0 Copyright 1987, Americn Society for Microbiology Complex Regultion of the Muscle-Specific Contrctile
More informationChickpeas Respond Well To Inoculation With TagTeam
Chickpes Respond Well To Inocultion With TgTem S.M. Phelps, nd E. Hgele Philom Bios Inc., 318-111 Reserch Drive, Ssktoon, SK S7N 3R2 Abstrct Rhizobi strins were tested in TgTem pet nd grnule formultions
More informationCrop Performance and Plant Microbe-Interactions are Affected by the Sequence and Frequency of Pulse Crops in the Canadian Prairie
Crop Performnce nd Plnt Microbe-Interctions re Affected by the Sequence nd Frequency of Pulse Crops in the Cndin Pririe Nvrro-Borrell A 1,2 ; Di M 2 ; Hmel C 1,2 ; Fernndez MR 2 ; Gn Y 2 ; Germid J 1.
More information(b) Is already deposited in a waste disposal site without methane recovery.
TYPE III - OTHER PROJECT ACTIVITIES Project prticipnts must tke into ccount the generl guidnce to the methodologies, informtion on dditionlity, bbrevitions nd generl guidnce on lekge provided t http://cdm.unfccc.int/methodologies/sscmethodologies/pproved.html.
More informationCrystal Structure. Dragica Vasileska and Gerhard Klimeck
Crystl Structure Drgic Vsilesk nd Gerhrd Klimeck Crystl Structure Issues tht re ddressed in this lecture include:. Periodic rry of toms. Fundmentl types of lttices 3. Index system for crystl plnes 4. Simple
More informationSupplemental Data. Antosz et al. Plant Cell (2017) /tpc SPT6/SPT6L. genomic DNA ACT2 +RT -RT +RT -RT
A B C SPT6/SPT6L genomic DNA ACT2 +RT -RT Col- seedlings +RT -RT PSB-D cells Supplementl Figure 1. Expression of SPT6L nd SPT6. (Supports Figure 1.) Trnscript levels of of SPT6L (At1g6544) nd SPT6 (At1g6321)
More informationThe basic model for inventory analysis
The bsic model for inventory nlysis Lecture Notes for ME515 Prepred by Joyce Smith Cooper Professor of Mechnicl Engineering University of Wshington cooperjs@uw.edu See Chpter 2 of Heijungs nd Suh (22)
More informationphenylalanine alanine
END F UNIT TET ENGINEERING PRTEIN TET 60 mrks (1 hour) A copy of the EP Informtion heet is required for this test, together with the spectroscopic dt (n.m.r.) from Tble 23 in the Dt heets. 1 nylketonuri
More informationGenetics of heredity. October 10 Lecture notes Genetics of heredity
October 10 Lecture notes Review: Meiosis, digrmmed on blckbord. Meiosis: The division of single nucleus (nd the cell tht contins it) into four dughter nuclei (nd cells tht contin them). The four dughter
More informationWeb Crippling of Wide Deck Sections
Missouri University of Science nd Technology Scholrs' Mine Interntionl Specilty Conference on Cold- Formed Steel Structures (1990) - 10th Interntionl Specilty Conference on Cold-Formed Steel Structures
More informationExtracts of Vegetative and Sporulating Bacillus subtilis
Proc. Nt. Acd. Sci. USA Vol. 71, No. 7, pp. 2872-2876, July 1974 An Immunologicl Assy for the Sigm Subunit of RNA Polymerse in Extrcts of Vegettive nd Sporulting Bcillus subtilis (ntibody precipittion)
More informationDisposable bioreactor systems are
Oxygen Mss Trnsfer Correltion for Rocking- Motion Biorector System Erin Shughnessey, Armin Opitz, nd Jck Prior Disposble biorector systems re technologies commonly used in bioprocessing. They provide costeffective
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture965 footprinting deep-sequencing Supplementry Figure. Schemtic of riosome profiling experiment for quntifiction of riosome occupncy long mrna. The protocol for cteril riosome profiling with
More informationWesternBright TM MCF and MCF-IR
WesternBright TM MCF nd MCF-IR Quntittive, multi-color fluorescent Western lotting kits WesternBright MCF visile nd ner infrred (IR) fluorescent Western lotting kits llow the ssy of two proteins t once,
More informationBuilding better lithium-sulfur batteries: from LiNO 3 to solid oxide catalyst
Supplementry Informtion Building etter lithium-sulfur tteries: from LiN to solid oxide ctlyst Ning Ding, Ln Zhou, Chngwei Zhou, Dongsheng Geng, Jin Yng, Sheu Wei Chien, Zholin Liu, Mn-Fi Ng, Aishui Yu,
More information1. Supplementary Figures and Legends a b
doi:10.1038/nture09540 1. Supplementry Figures nd Legends Supplementry Figure 1. Scnning trnsmission electron microgrphs (STEM) of NCC., STEM prepred from fst evportion of dilute NCC suspension shows individul
More informationObserving Patterns in Inherited Traits. Chapter 10
Observing Ptterns in Inherited Trits Chpter 10 10.1 Mendel, Pe Plnts, nd Inheritnce Ptterns By experimenting with pe plnts, Mendel ws the first to gther evidence of ptterns by which prents trnsmit genes
More informationInterplay between NS3 protease and human La protein---- by Ray and Das Supplementary fig 1. NS3 pro
Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 1 1 2 3 4 UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES RNA ws UV-crosslinked to incresing concentrtions (0.1, 0.2 nd 0.4µM) in
More informationBRICK LINTELS. ~2 cm STRETCHER COURSE BRICKWORK MOUNTING OF LINTELS UP TO 2 M BRICK LINTELS STRETCHER COURSE BRICKWORK
BRICK LINTELS STRETCHER COURSE BRICKWORK BRICK LINTELS STRETCHER COURSE BRICKWORK Lintel consist of t lest three courses of bricks bonded with mortr. The first course of bricks, ech verticl joint, hs nchors
More informationNOTICE CONCERNING COPYRIGHT RESTRICTIONS
NOTICE CONCERNING COPYRIGHT RESTRICTIONS This document my contin copyrighted mterils. These mterils hve been mde vilble for use in reserch, teching, nd privte study, but my not be used for ny commercil
More informationInitiation of DNA-Dependent RNA Synthesis and the Effect of Heparin on RNA Polymerase
Europen J. Biochem. 3 (1967) 194-201 Initition of DNA-Dependent RNA Synthesis nd the Effect of Heprin on RNA Polymerse G. WALTER, W. ZILLIG, P. PALM, nd E. FUCHS Mx-Plnck-Institut fur Biochemie, Munchen
More informationChandoga M., Jaroševič A., Sedlák J., Sedlák E. 3rd fib International Congress
Chndog M., Jroševič A., Sedlák J., Sedlák E. 3rd fib Interntionl Congress - 2010 EXPERIMENTAL AND IN SITU STUDY OF BRIDGE BEAMS SUPPORTED BY BOTTOM EXTERNAL TENDONS Doc. Ing. Miln Chndog, PhD., Projstr
More informationMutations in the arac Regulatory Gene of Escherichia coli B/r That Affect Repressor and Activator Functions of AraC Protein
JOURNAL OF BACTERIOLOGY, June 1986, p. 892-900 0021-9193/86/060892-09$02.00/0 Copyright 1986, Americn Society for Microbiology Vol. 166, No. 3 Muttions in the rc Regultory Gene of Escherichi coli B/r Tht
More informationPolynucleotide phosphorylase of Escherichia coli induces the degradation of its RNase III processed messenger by preventing its translation
1994 Oxford University Press Nucleic cids Reserch, 1994, Vol. 22, No. 3 397-403 Polynucleotide phosphorylse of Escherichi coli induces the degrdtion of its RNse III processed messenger by preventing its
More informationCrystallization Time (min) PCL block. PCL homopolymer. Crystallization Time (min)
Figure S-1 Crystllinity of PCL Chins.4.3.2.1 2 PCL homopolymer T c = -54 o C D = 13. nm PCL lock 4 6 8 1 Crystlliztion Time (min) Crystllinity of PCL Chins.4.3.2.1 PCL lock PCL homopolymer T c = -45 o
More informationStationary-Phase-Inducible "Gearbox" Promoters: Differential
JOURNAL OF BACTERIOLOGY, JUlY 1991, p. 4482-4492 21-9193/91/144482-11$2./ Copyright D 1991, Americn Society for Microbiology Vol. 173, No. 14 Sttionry-Phse-Inducible "Gerbox" Promoters: Differentil Effects
More informationInvasive Pneumococcal Disease Quarterly Report. January March 2017
Invsive Pneumococcl Disese Qurterly Report Jnury Mrch 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Ali Bormn Helen Heffernn My 2017 Acknowledgements This report could not
More informationSupplementary Material
Supplementry Mteril Kineticlly-controlled Synthesis of LiNi 0.5 Mn 1.5 O 4 Micro/nno-structured Hollow Spheres s High-rte Cthode Mterils for Lithium Ion Btteries Sheng Li, Guo M, Bing Guo, Zeheng Yng,
More informationRole of Clp Protease Subunits in Degradation of Carbon Starvation Proteins in Escherichia coli
JOURNAL OF BArERIOLOGY, Jn. 1993, p. 53-63 21-9193/93/153-11$2./ opyright 1993, Americn Society for Microbiology Vol. 175, No. 1 Role of lp Protese Subunits in Degrdtion of rbon Strvtion Proteins in Escherichi
More informationSLASH PINE FAMILIES IDENTIFIED WITH HIGH RESISTANCE TO FUSIFORM RUST. C. H. Walkinshaw '
SLASH PINE FAMILIES IDENTIFIED WITH HIGH RESISTANCE TO FUSIFORM RUST C. H. Wlkinshw ' Abstrct.--Fusiform rust redily kills slsh pine, Pinus elliottii Engelm. vr. elliottii. When the number of rust-infected
More informationMechanisms of Specific Immunological Unresponsiveness to Bacterial Lipopolysaccharides
INFECTION AND IMMUNITY, Dec. 1987, P. 3093-3102 0019-9567/87/123093-10$02.00/0 Copyright C) 1987, Americn Society for Microbiology Vol. 55, No. 12 Mechnisms of Specific Immunologicl Unresponsiveness to
More informationDeoxidation Equilibrium of Manganese and Silicon in Liquid Iron Nickel Alloys
ISIJ Interntionl, Vol. 43 (003), No. 10, pp. 1487 1494 Deoxidtion Equilibrium of Mngnese nd Silicon in Liquid Iron Nickel Alloys V. Y. DASHEVSKII, A. M. KATSNELSON, N. N. MAKAROVA, K. V. GRIGOROVITCH nd
More informationESTIMATION AND UTILIZATION OF STRUCTURE ANISOTROPY IN FORMING PIECES
www.cermics-silikty.cz Cermics-Silikáty 61 (), 141-146 (17) doi: 1.13168/cs.17.9 ESTIMATION AND UTILIZATION OF STRUCTURE ANISOTROPY IN FORMING PIECES MAROS MARTINKOVIC Slovk University of Technology in
More informationcomponent in Salmonella typhimurium (hisp gene/hisq gene/hisj gene/transport operon/protein interaction)
Proc. Ntl. Acd. Sci. USA Vol. 75, No. 11, pp. 5447-5451, November 1978 Biochemistry dentifiction of membrne protein s histidine trnsport component in Slmonell typhimurium (hisp gene/hisq gene/hisj gene/trnsport
More informationA BEHAVIOR OF ELASTIC AND PLASTIC STRAIN FOR (α+γ) DUAL PHASE STAINLESS STEELS IN ROTATING BENDING TEST
Copyright JCDS - Interntionl Centre for Diffrction Dt 24, Advnces in X-ry Anlysis, Volume 47. 39 ISSN 197-2 A BEHAVIOR OF ELASTIC AND LASTIC STRAIN FOR (+) DUAL HASE STAINLESS STEELS IN ROTATING BENDING
More informationSupporting Information
Supporting Informtion Cllegri et l. 10.1073/pns.1003449107 SI Mterils nd Methods Yest Strins. Fission yest mutnts were isogenic to the WT strin (smt0, leu1-32, nd ur4-d18). The rev1 gene ws disrupted by
More informationCopyright 1982 by ASME. Combined Cycles
THE AMERICAN OCIETY OF MECHANICAL ENGINEER 345 E. 47 t., New York, N.Y. 117 82-GT-38 ^,+ w The ociety shll not be responsible for sttements or opinions dvnced in ppers or in C discussion t meetings of
More informationSupporting Information
Supporting Informtion Positive Potentil Opertion of Cthodic Electrogenerted Chemiluminescence Immunosensor bsed on Luminol nd Grphene for Cncer iomrker Detection Shoujing Xu, Yng Liu*, Tihong Wng*, Jinghong
More informationWhat do genes code for?
From ene to Protein How enes Work 2007-2008 Wht do genes code for? How does code for cells & bodies? how re cells nd bodies mde from the instructions in proteins cells bodies he entrl Dogm Flow of genetic
More informationCHAPTER 5 SEISMIC RESERVOIR CHARACTERIZATION.
CHAPTER 5 ISMIC RERVOIR CHARACTERIZATION. ISMIC RERVOIR CHARACTERIZATION Centrl Scotin Slope Study CANADA June 2016 Ojectives: Chrcterize the snd distriution, using the Mrthon nd Verits 3D post-stck seismic
More informationShot Peening and Ball-Burnishing to Improve HCF Strength of the New Titanium Alloy TIMETAL-54M
Shot Peening nd Bll-Burnishing to Improve HCF Strength of the New Titnium Alloy TIMETAL-54M K. Zy 1, Y. Shn 1, Y. Kosk 2, L. Wgner 1 1 Institute of Mterils Science nd Engineering Clusthl University of
More information3-PG transport was measured as follows; an aliquot (25,ul) of cell suspension prepared as described above was incubated
JOURNAL OF BACTERIOLOGY, Sept. 1988, p. 4304-4308 0021-9193/88/094304-05$02.00/0 Copyright C 1988, Americn Society for Microbiology Vol. 170, No. 9 Genetic Evidence for Modultion of the Activtor by Two
More informationMultiple Antibiotic Resistance in Escherichia coli
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1994, p. 1773-1779 Vol. 38, No. 8 0066-4804/94/$04.OO+O Copyright 1994, Americn Society for Microbiology Genetic Reltionship between soxrs nd mr Loci in Promoting
More informationFibre-reinforced plastic composites Declaration of raw material characteristics Part 4: Additional requirements for fabrics
CEN/TC 249 N493 Dte: 2010-02 pren xxxx-4:2010 CEN/TC 249 Secretrit: NBN Fibre-reinforced plstic composites Declrtion of rw mteril chrcteristics Prt 4: Additionl requirements for fbrics Einführendes Element
More informationEconomic Profitability and Sustainability of Canola Production Systems in Western Canada
Economic Profitility nd Sustinility of Cnol Production Systems in Western Cnd Elwin Smith, R. Blckshw, Agriculture nd Agri-Food Cnd (AAFC), Lethridge, AB, N. Hrker, J. O'Donovn, AAFC Lcome AB, S. Brndt,
More informationSUPPLEMENTARY INFORMATION
1 1 μm c d EGF + TPA + e f Intensity 1.8 1.6 1.4 1.2 1.8.6.4.2 2 4 8 2 4 8 (Hours) 2 4 6 8 1 Time (Hours) Reltive luciferse ctivity 4 3 2 1 + CAMEK1 FRE reporter Figure S1 inhiitor incresed protein expression
More informationH. Randall Smith; Ph.D. Agronomy and Wayne Porter: Ph.D. Horticulture Mississippi State University Extension Service
Effect of SumGrow on growth, development nd yield of Irish pottoes (Solnum tuerosum) t the Beumont Reserch Sttion (Mississippi Stte University) during 217 H. Rndll Smith; Ph.D. Agronomy nd yne Porter:
More informationSTATUS OF LAND-BASED WIND ENERGY DEVELOPMENT IN GERMANY
Yer STATUS OF LAND-BASED WIND ENERGY Deutsche WindGurd GmbH - Oldenburger Strße 65-26316 Vrel - Germny +49 (4451)/9515 - info@windgurd.de - www.windgurd.com Annul Added Cpcity [MW] Cumultive Cpcity [MW]
More informationCORROSION RESISTANCE AND COMPATIBILITY OF EUROFER STEEL COATINGS IN THE Pb-Li AT THE TEMPERATURE OF 550 C
CORROSION RESISTANCE AND COMPATIBILITY OF EUROFER STEEL COATINGS IN THE P-Li AT THE TEMPERATURE OF 55 C Zuzn Skoumlová, Krel ŠPLÍCHAL, Lukáš KOŠEK, Jroslv BURDA Ústv jderného výzkumu, Řež.s., Husinec-Řež
More informationII. Separation of proteins
Journl of Chromtogrphy A, 890 (2000) 37 43 www.elsevier.com/ locte/ chrom High-performnce chromtofocusing using liner nd concve ph grdients formed with simple buffer mixtures q II. Seprtion of proteins
More informationUNIVERSITY OF NOTTINGHAM. Discussion Papers in Economics WHERE TO ENCOURAGE ENTRY: UPSTREAM OR DOWNSTREAM
UNVERSTY OF NOTTNGHAM Discussion Ppers in Economics Discussion Pper No. 0/1 WHERE TO ENCOURAGE ENTRY: UPSTREAM OR DOWNSTREAM by Arijit Mukherjee nd Som Mukherjee August 00 DP 0/1 SSN 160-48 UNVERSTY OF
More informationSUBSURFACE CRACK INITIATION DURING FATIGUE AS A RESULT OF RESIDUAL STRESSES. (Received 1 I May 1979)
Ftigue of Engineering Mterils nd Sfrucrures Vol. 1, pp. 31%327 Pergmon Press. Printed in Gret Britin. Ftigue of Engineering Mterils Ltd. 1979. SUBSURFACE CRACK INITIATION DURING FATIGUE AS A RESULT OF
More informationFrom Gene to Protein: How Genes Work. AP Biology
From ene to Protein: How enes Work How does single fulty gene result in the drmtic ppernce of n lbino deer nd rcoon? ene expression, the process by which DN directs protein synthesis, includes two stges:
More informationQuantifying the Total Cost of Ownership for Entry-Level and Mid-Range Server Clusters
Quntifying the Totl Cost of Ownership for Entry-Level nd Mid-Rnge Server Clusters A Detiled Anlysis of the Totl Cost of Ownership of OpenVMS, IBM AIX nd Sun Solris server clusters. June 2007 Version 1.0
More informationStructure and Organization of Escherichia coli Genes Involved in
JOURNAL OF BACTEROLOGY, Apr. 1991, p. 2256-2264 0021-9193/91/072256-09$02.00/0 Copyright C 1991, Americn Society for Microbiology Vol. 173, No. 7 Structure nd Orgniztion of Escherichi coli Genes nvolved
More informationINTERSTITIAL VOIDS IN TETRAHEDRALLY AND IN THREE-FOLD BONDED ATOMIC NETWORKS
Journl of Non-Oxide Glsses Vol. 5, No 2, 2013, p. 21-26 INTERSTITIAL VOIDS IN TETRAHEDRALLY AND IN THREE-FOLD BONDED ATOMIC NETWORKS F. SAVA, M. POPESCU *, I.D. SIMANDAN, A. LŐRINCZI, A. VELEA Ntionl Institute
More informationPREPARATION OF NOVOLACS USING PHENOLIC RICH COMPONENTS AS PARTIAL SUBSTITUTE OF PHENOL FROM BIOMASS PYROLYSIS OILS
, 251-257. ISSN 1011-3924 Printed in Ethiopi 2010 Chemicl Society of Ethiopi PREPARATION OF NOVOLACS USING PHENOLIC RICH COMPONENTS AS PARTIAL SUBSTITUTE OF PHENOL FROM BIOMASS PYROLYSIS OILS Xu Junming
More informationIMPACT OF MOTIVATION ON EFFECTIVENESS OF SALES FORCE THROUGH TRAINING: A STUDY OF TELECOMMUNICATION SECTOR. Rajul Dutt* 1
ISSN 2277-2685 IJESR/Sept. 2015/ Vol-5/Issue-9/1254-1259 Rjul Dutt et.l.,/ Interntionl Journl of Engineering & Science Reserch IMPACT OF MOTIVATION ON EFFECTIVENESS OF SALES FORCE THROUGH TRAINING: A STUDY
More informationPlasmid ptic58. expressed at intermediate (virg) or very low (virb, virc, vird, and vire) levels and show under laboratory conditions
JOURNAL OF BACTERIOLOGY, Nov. 1987, p. 5101-5112 Vol. 169, No. 11 0021-9193/87/115102-12$02.00/0 Copyright C) 1987, Americn Society for Microbiology Regultion of the vir Genes of Agrobcterium tumefciens
More informationDetection of amplified Y chromosome-specific sequence by capillary electrophoresis with laser-induced fluorescence*
FERTILITY AND STERILITY Copyright @ 1995 Americn Society for Reproductive Medicine Vol. 64, No., August 1995 Printed on cid free pper in U. S. A. Detection of mplified Y chromosome-specific sequence by
More informationChapter 9: Phase Diagrams
Chpter 9: Phse Digrms ISSUES TO ADDRESS... When we combine two elements... wht is the resulting equilibrium stte? In prticulr, if we specify... -- the composition (e.g., wt% Cu - wt% Ni), nd -- the temperture
More informationInfluence of Stress Ratio on Fatigue Crack Propagation Behavior of Stainless Steel Welds
ELDING RESEARCH Influence of Stress Rtio on Ftigue Crck Propgtion Behvior of Stinless Steel elds Crck initition nd growth rtes in reltion to residul stresses were studied in gs metl rc welds of 316L BY
More informationVariables that influence outcomes of AI programs: Cow Biology
Vribles tht influence outcomes of AI progrms: Cow Biology Sndy Johnson, Ph.D. sndyj@ksu.edu K-Stte Reserch & Extension Northwest Reserch & Extension Center, Colby, KS Producers tht chieve excellent responses
More informationMovement of yeast transposable elements by gene conversion (gene replacement/recombination/transposition/controlling elements/gene expression)
Proc. NtL Acd. Sci. USA Vol. 79, pp. 5621-5625, September 1982 Genetics Movement of yest trnsposble elements by gene conversion (gene replcement/recombintion/trnsposition/controlling elements/gene expression)
More informationIncreased Employment Rates and the Nature of the Economic Growth in Poland s Voivodships
Brometr Regionlny Tom 16 nr 4 Incresed Employment Rtes nd the Nture of the Economic Growth in Polnd s Voivodships Mriusz Zieliński Opole University of Technology, Polnd Abstrct The purpose of the rticle
More informationSupplemental Figure S1
Supplementl Figure S1 TG nrt1.5- Li et l., 1 nrt1.5- Lin et l., 8 F L CTGCCT R T 5'UTR 3'UTR 1 3 81p (k) nrt1.5- C nrt1.5- Supplementl Figure S1. Phenotypes of the T-DN insertion mutnts (this pper), nrt1.5-
More informationBinding of Polyomavirus Large T Antigen to the Human hsp7o
MOLECULAR AND CELLULAR BIOL_OGY, Sept. 1986. p. 3180-319() Vol. 6, No. 9 0270-7306/86/093180-11$02.00/0 Copyright 1986, Americn Society for Microbiology Binding of Polyomvirus Lrge T Antigen to the Humn
More informationSaccharomyces cerevisiae (aas mutants/suppressors/epistasis/molecular cloning/gene dosage)
Proc. Nti. Acd. Sci. USA Vol. 8, pp. 5374-5378, September 1983 Genetics Positive regultion in the generl nino cid control of Scchromyces cerevisie (s mutnts/suppressors/epistsis/moleculr cloning/gene dosge)
More informationEffect of Sodium Nitrite on Toxin Production by Clostridium botulinum in bacon
APPLIED MICROBIOLOGY, Apr. 1974, p. 733-737 Copyright i 1974 Americn Society for Microbiology Vol. 27, No. 4 Printed in U.S.A. Effect of Sodium Nitrite on Toxin Production by Clostridium botulinum in bcon
More informationReturn Temperature in DH as Key Parameter for Energy Management
Interntionl OPEN ACCESS Journl Of Modern Engineering Reserch (IJMER) Return Temperture in DH s Key Prmeter for Energy Mngement Normunds Tlcis 1, Egīls Dzelzītis 2, Agnese Līckrstiņ 2 *JSC Rīgs siltums
More informationnm nm nm nm nm nm. Seed surface. oi-ab. oi-ad. ii-ab. ii-ad/endothelium. endosperm.
B 360-370nm Seed surfce oi- 90-100nm A 630-640nm oi-d ii- ii-d/endothelium 230-240nm 220-230nm 240-280nm 1mm endosperm C oi-d D ii-d/endothelium ii- endosperm Supplementry Figure 1 Cell wll thickness mesurements
More informationLos Alamos NITRIC ACID VAPOR REMOVAL BY ACTIVATED, IMPREGNATED CARBONS. Gerry 0. Wood
Title: NITRIC ACID VAPOR REMOVAL BY ACTIVATED, IMPREGNATED CARBONS Author(s): Gerry. Wood Submitted to U.S. Army Edgewood Reserch, Development nd Engineering (ERDEC) Scientific Conference Los Almos NATIONAL
More information