Clonality testing Potentials & Problems

Transcription

1 Clonality testing Potentials & Problems For the Biomed 2 group Han van Krieken Nijmegen, the Netherlands EAHP 2010, Uppsala

2 Introduction Clonality testing needs to be based on knowledge of immunology Poly- vs oligo- vs monoclonal Restricted repertoires Sensitivity issues Interpretation in a pathology setting Not a black and white test Knowledge of the pathology is needed

3 IGH locus 14q32 IGH VH DH JH n s C n D to J joining V to DJ joining Transcription 7 Precursor mrna RNA splicing Mature mrna V DJ C Open Reading Frame Ig Heavy chain protein PJTA Groenen PhD, Dept of Pathology

4 BIOMED-2 Concerted Action BMH4-CT : PCR-based clonality studies PCR targets for diagnostic clonality studies Ig genes: IGH: VH-JH and DH-JH IGK: Vκ-Jκ and ΚDE IGL: Vλ-Jλ TCR genes TCRB: Vβ-Jβ and Dβ-Jβ TCRG: Vγ-Jγ TCRD: Vδ-Jδ, Dδ-Dδ, Dδ-Jδ, and Vδ-Dδ Chromosome aberrations: t(14;18): BCL2-IGH (JH) t(11;14): BCL1-IGH (JH) PJTA Groenen PhD, Dept of Pathology

5 BIOMED-2 multiplex PCR analysis Gene Rearrangement Upstream primers Downstream primers No. of tubes IGH VH-JH (3x) VH-JH (3x) IGK Vκ-Jκ Kde 1 7 (6+1) 1 IGL Vλ-Jλ TCRB Vβ-Jβ 2 23 (2x) 13 Dβ-Jβ TCRG Vγ-Jγ 4 2 (2x) 2 TCRD Vδ Jδ etc 7 5

6 BIOMED-2 Concerted Action BMH4-CT : PCR-based clonality studies PCR GeneScan analysis of IGH tube A: VH-J Hrearrangements VH DH JH 6 VH -FR1 primers (V H family primers) J H primer * CTGTGCAAGAGCGGGCTATGGTTCAGGGAGTTATGGCTACTACGGTATGGACGTCTGG CTGTGCAAGAGGACGAAACAGTAACTGCCTACTACTACTACGGTATGGACGTCTGG CTGTGCAAGAGAGATAGTATAGCAGCTCGTACAACTGGTTCGACTCCTGG CTGTGCAAGAGATCCGGGCAGCTCGTTTTGCTTTTGATATCTGG CTGTGCAAGAGCCTCTCTCCACTGGGATGGGGGGCTACTGG CTGTGCAAGAGCAGCAGCTCGGCCCCCTTTGACTACTGG CTGTGCAAGAG GACTTTGGATGCTTTTGATATCTGG CTGTGCAAGAGGGTGGGAGCTACTAGACTACTGG CTGTGCAAGGGTAGCTAAACCTTTGACTACTGG CTGTGCAATATCTACTTTGACTACTGG PJTA Groenen PhD, Dept of Pathology

7 Heteroduplex analysis T D (1290) T M (1294) Monoclonal Polyclonal IGL 300 bp 200 bp 100 bp Size and conformation PJTA Groenen PhD, Dept of Pathology

8 Complementarity of Ig targets for clonality detection in B-cell malignancies IGH IGK all IGH DH-JH VH-JH DH-JH VH-JH Vκ-Jκ Kde Vκ-Jκ + IGK + Kde * +DH-JH + Kde MCL (n=54) 100% 11% 100% 94% 75% 100% 100% 78% B-CLL/SLL (n=56) 100% 43% 100% 96% 61% 100% 100% 73% FL (n=109) 84% 19% 86% 63% 59% 84% 100% 64% MZL (n=41) 88% 51% 95% 68% 54% 83% 100% 68% DLBCL (n=109) 79% 30% 85% 61% 58% 80% 98% 72% TOTAL (n=369) 88% 28% 91% 73% 60% 88% 99% 70% * Combination of two Ig gene rearrangements without somatic mutations BIOMED-2 B-cell malignancy report: PAS Evans et al, Leukemia 2007

9 Specific Ig/TCR gene patterns in B-cell malignancies (Virtually) all B-cell malignancies have IGH rearrangements; Incomplete DH-JH rearrangements occur in 30-40% of cases, except of MCL (~10%) and FCL (~20%), most of which contain BCL1-IGH or BCL2-IGH rearrangements on the second allele; All Igλ + B-cell malignancies have IGK deletions on at least one allele (80% have biallelic deletions); Igκ + B-cell malignancies rarely contain IGL rearrangements (<5%), but 30% have IGK deletions on one allele; TCR gene rearrangements occur in 5 to 15% of mature B-cell malignancies and in 80 to 90% of immature B-cell malignancies (precursor-b-all). 9

10 Complementarity of TCR targets for clonality detection in T-cell malignancies TCRB TCRG TCRB Vβ-Jβ Dβ-Jβ Vβ-Jβ Vγ-Jγ + TCRG + Dβ-Jβ T-PLL (n=33) 94% 47% 100% 94% 100% T-LGL (n=28) 86% 62% 96% 96% 100% PTCL-U (n=47) 85% 67% 98% 94% 100% AILT (n=37) 70% 61% 89% 92% 95% ALCL (n=43) 70% 48% 74% 74% 79%* TOTAL (n=188) 80% 58% 91% 89% 94%* (99%) * 20% to 25 % of anaplastic large cell lymphomas do not have TCR gene rearrangements (null-alcl) BIOMED-2 T-cell malignancy report: M. Brüggemann Leukemia 2007

11 Specific TCR/Ig gene rearrangements in T-cell malignancies Virtually all TCRαβ + T-cell malignancies have TCRG gene rearrangements and ~20% have TCRD gene rearrangements on one allele. A large part of TCRγδ + T-cell malignancies (30 to 40%) contain TCRB gene rearrangements, particularly incomplete Dβ-Jβ rearrangements. Approximately 5 to 20% of T-cell malignancies contain IGH gene rearrangements, including incomplete DH-JH rearrangements. IGK or IGL gene rearrangements are generally rare (<5%) in T-cell malignancies. Conclusion: TCR/Ig gene rearrangements are not lineage specific, even not for TCRαβ versus TCRγδ lineage. 11

12 Conclusions concerning BIOMED-2 multiplex tubes Unprecedentedly high level of clonality detection based on: primers recognise majority of functional gene segments (multiplexing of multiple primers) introduction of incomplete rearrangements: DH-JH and Dβ-Jβ usage of unmutated targets: DH-JH and IGK-Kde complementarity of Ig/TCR targets (e.g. IGH and IGK; TCRB andtcrg ) Clonal results in more than one tube! Minimal sets of BIOMED-2 multiplex tubes: suspected B-cell proliferation: VH-JH and IGK (5 tubes) suspected T-cell proliferation: TCRB and TCRG (5 tubes) TCRγδ + T-cell proliferation: TCRG and TCRD (3 tubes) 12

13 BIOMED-2 clonality strategy Suspected B-cell proliferations Suspected lymphoid proliferations of unknown origin (B or T) Suspected T-cell proliferations TCR γδ+ proliferations or immature T-cells IGH VH-JH 3 tubes preferably with IGK Vκ-Jκ IGK Kde 2 tubes clonality (generally multiple clonal results) TCRB Vβ-Jβ TCRB Dβ-Jβ 3 tubes preferably with TCRG 2 tubes no clonality TCRG but still suspected 2 tubes and IGK DH-J H and IGL TCRD 2 tubes clonality 1 tube no clonality detected no evidence of clonality; probably polyclonality (particularly in case of clear Gaussian GeneScan profiles or heteroduplex smears) no clonality detected Van Krieken et al., Leukemia 2007; 21:

14 When to use clonality testing? Reactive versus Malignant Recurrence versus new lymphoma Lineage verification Lymphoproliferations in immune deficiency NOT: Hodgkin versus non-hodgkin Know the pitfalls Interaction pathologist-molecular biologist

15 Standard lab procedure diagnostic requests Frozen tissue Paraffin-embedded tissue Quality control: Biomed size-ladder PCR (control gene primer sets) 400 bp 300 bp 200 bp 100 bp Representative tissue; HE stainings: percentage of B-T-cells, tumour load PJTA Groenen PhD, Dept of Pathology

16 Common problems encountered in workshops Unknown or poor quality of DNA Too few targets Only one read-out (genescan/heteroduplex) Misinterpretation of polyclonality in TCR Aspecific peaks Peaks outside size range Mathematical analysis of peaks Signing out as presence or absence of clonality Insufficient data on the histopathology

17 BIOMED-2 WP2a category: reactive tissue lesions Inclusion by experienced hematopathologists - cases clinically suspected for lymphoma, but histopathologically reactive - additional archival cases (retrospective) Site of biopsy lymph node (91) (6 axillary, 13 cervical, 7 inguinal, 1 mediastinal, 1 mesenteric, 1 midline, 20 neck, 1 para aortic, 5 submandibular, 36 of unknown site) appendix (1) sinus maxillaris (1) skin (4) spleen (5) thyroid gland (1) tonsil (7) BIOMED-2 Reactive lesions report; AW Langerak et al., Leukemia 2007

18 BIOMED-2 WP2a category: reactive tissue lesions Initial histopathological diagnosis Non-specific lymphadenitis, often follicular hyperplasia (n=74) EBV / CMV / HIV infection (n=5/1/1) Dermatopathic lymphadenopathy (n=4) Cat scratch disease (n=3) Toxoplasmosis (n=3) Sarcoidosis (n=2) Tuberculosis (n=2) Progressively transformed GC (n=2) Spleen in spherocytosis / spleen in ITP / trauma spleen (n=1/1/1) Myoepithelial sialo-adenitis (n=1) Kikuchi s lymphadenitis (n=1) Skin pseudo lymphoma (n=1) Hashimoto (n=1) Reactive, suspect B / T (n=1/1) BIOMED-2 Reactive lesions report; AW Langerak et al., Leukemia 2007

19 BIOMED-2 WP2a category: reactive tissue lesions (n=107) Results clear clonal results (categories I + II): 11% (12 / 107) - missed lymphomas (n=2) - unexplained clonal results (n=10) ambiguous molecular results (category III): 14% (15 / 107) - mainly oligoclonality (restricted repertoire) in polyclonal background clear polyclonal results (category IV): 75% (80 / 107) Ι ΙΙ ΙΙΙ ΙV : clear clonal products in multiple loci and multiple tubes : clear clonal products, but in single locus : ambiguous, mostly clonality with single technique or single tube : polyclonal in every locus and tube

20 Molecular results Clear clonal results n = 15 Clerical errors n = 3 Missed lymphomas n = 2 Unconfirmed clonal result n = 32

21 BIOMED-2 WP2a category: reactive tissue lesions Missed lymphomas (only recognised after molecular results!) involved by MF / Sezary syndrome (DE 069; cat. I) involved by MZL (DE 105; cat. I) Unexplained clonal results (n = 10) skin pseudolymphoma (NL 108; cat. I) EBV infection (ES 189; cat. I) ruptured spleen (remark. plasma cells!) (PT 021; cat. I) early AILD in M. Sjögren? (PT 024; cat. I) large GC in frozen tissue (GBN017;cat.I) reactive lymph node (treated for DLBCL) (DE 107; cat. I) reactive, but difficult (skin; B-NHL?) (GBN037;cat.II) traumatic spleen (unusual T-cells) (NL 111; cat. II) spleen ITP (NL 156; cat. II) reactive (progressively transformed GC) (NL 172; cat. II)

22 Clonality analysis and histopathology in case NL 111 TCRB Vβ-Jβ TCRB Dβ-Jβ TCRG monoclonal monoclonal monoclonal NL 111 NL 111 NL 111 polyclonal polyclonal polyclonal Hematoxylin and eosin staining of spleen Granzyme staining of spleen BIOMED-2 Reactive lesions report; AW 22Langerak et al, Leukemia 2007;21:222-2

23 Clonality analysis and histopathology in case PT 021 IGH VH-J H FR1 IGH VH-J H FR monoclonal monoclonal MC PT 021 PC PT 021 PT 021 polyclonal polyclonal Hematoxylin and eosin staining of spleen Ig κ staining of spleen Ig λ staining of spleen BIOMED-2 Reactive lesions report; AW 23 Langerak et al, Leukemia 2007;21:222-

24 Conclusions Clonality testing is a mature technique Well defined indications for hematopathology Needs expertise and experience from molecular biologist and pathologist Well recognised do s and don t s Clonality does not equal malignancy Yearly workshops in Nijmegen and worldwide Website for education and consultation ( Publications, guidelines, FAQ s, QA-program Workshops difficult cases